The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031018	Lactobacillus helveticus isolate NWC_2_4 chromosome, complete genome	2177422	10464	81471	2177422	transposase	Streptococcus_phage(23.53%)	48	NA	NA
AZA19117.1|10464_11742_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	7.6e-11
AZA19118.1|11832_13086_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.1	2.0e-08
AZA19119.1|13096_14863_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	4.8e-88
AZA19120.1|17184_18363_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA19121.1|18397_20005_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	32.2	4.9e-15
AZA19122.1|21642_21951_-	hypothetical protein	NA	NA	NA	NA	NA
AZA19123.1|22272_22881_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19124.1|22988_25010_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19125.1|25021_25477_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
AZA19126.1|25507_26902_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	50.1	3.2e-119
AZA19127.1|27095_28274_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA19128.1|28535_29465_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA19129.1|29581_30859_-|transposase	ISL3-like element ISLhe2 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	1.4e-12
AZA19130.1|32637_32823_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19131.1|32838_33768_+	DegV family protein	NA	NA	NA	NA	NA
AZA19132.1|33897_34749_+	ROK family protein	NA	NA	NA	NA	NA
AZA19133.1|34900_35071_+	CsbD family protein	NA	NA	NA	NA	NA
AZA19134.1|35121_35382_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AZA19135.1|35442_36672_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
AZA19136.1|36755_37460_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	43.6	2.1e-18
AZA19137.1|38012_39299_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	51.3	1.7e-106
AZA19138.1|39556_39910_-	DUF3278 domain-containing protein	NA	NA	NA	NA	NA
AZA19139.1|39906_40107_-	transcriptional regulator	NA	NA	NA	NA	NA
AZA19140.1|40274_40913_+	ATP-binding cassette domain-containing protein	NA	F2Y302	Organic_Lake_phycodnavirus	31.8	7.6e-20
AZA19141.1|40909_41668_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
AZA19142.1|44379_44967_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZA19143.1|45070_46372_+	restriction endonuclease	NA	NA	NA	NA	NA
AZA20729.1|48034_49300_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
AZA19144.1|49502_50903_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AZA19145.1|50999_51773_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19146.1|51811_52372_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AZA19147.1|52372_52897_-	ECF transporter S component	NA	NA	NA	NA	NA
AZA19148.1|52898_53309_-	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
AZA19149.1|53329_55564_-	ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent	NA	A0A222ZQ84	Mycobacterium_phage	33.2	2.5e-89
AZA19150.1|55817_56852_+	AI-2E family transporter	NA	NA	NA	NA	NA
AZA19151.1|56848_57421_+	esterase	NA	NA	NA	NA	NA
AZA19152.1|57600_58629_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.7	2.6e-46
AZA19153.1|59812_60934_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.0e-92
AZA19154.1|62235_62550_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AZA19155.1|65117_65879_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	28.6	6.5e-18
AZA19156.1|65875_66772_-	ABC transporter permease	NA	NA	NA	NA	NA
AZA19157.1|66768_67761_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA19158.1|68058_68766_+	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
AZA19159.1|69841_70699_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	43.1	3.9e-59
AZA19160.1|73968_74982_-	D-2-hydroxyacid dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	35.6	1.0e-50
AZA19161.1|75108_75951_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
AZA19162.1|76405_77233_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	63.5	3.4e-97
AZA19163.1|80292_81471_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP031018	Lactobacillus helveticus isolate NWC_2_4 chromosome, complete genome	2177422	102551	147096	2177422	protease,transposase	Bacillus_phage(30.0%)	36	NA	NA
AZA19172.1|102551_103730_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA19173.1|106655_107414_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AZA19174.1|107542_108664_+	s-layer protein	NA	NA	NA	NA	NA
AZA19175.1|108937_110344_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AZA20732.1|110447_111713_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
AZA19176.1|113660_114776_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA19177.1|114940_115135_-	hypothetical protein	NA	NA	NA	NA	NA
AZA19178.1|115620_116799_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA19179.1|116918_117125_-	hypothetical protein	NA	NA	NA	NA	NA
AZA19180.1|117444_118851_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AZA19181.1|119061_119778_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.3	3.3e-40
AZA20733.1|119844_121701_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	32.4	1.3e-32
AZA19182.1|121681_123040_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19183.1|123042_123867_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19184.1|123882_124680_+	MBL fold metallo-hydrolase	NA	A0A2I7SDH3	Paenibacillus_phage	34.1	2.0e-30
AZA19185.1|124766_126008_+	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.4	1.1e-17
AZA20734.1|126472_126952_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
AZA20735.1|127062_127332_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19186.1|127460_128345_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
AZA19187.1|128353_129007_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
AZA19188.1|129010_130360_-	ABC transporter ATP-binding protein	NA	A0A1V0SI78	Klosneuvirus	23.1	2.1e-11
AZA19189.1|130517_131459_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZA19190.1|132547_133036_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	33.8	4.9e-11
AZA19191.1|133127_134024_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
AZA19192.1|134038_134599_-	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	33.7	1.2e-13
AZA19193.1|134665_135772_-	cation transporter	NA	NA	NA	NA	NA
AZA19194.1|135949_136354_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
AZA19195.1|136686_136827_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19196.1|137785_139045_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	58.5	7.8e-125
AZA19197.1|140204_140438_-	hypothetical protein	NA	NA	NA	NA	NA
AZA19198.1|140602_141250_+	HD domain-containing protein	NA	NA	NA	NA	NA
AZA19199.1|141250_142168_+	HNH endonuclease	NA	NA	NA	NA	NA
AZA19200.1|142220_142976_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.1e-28
AZA19201.1|142975_144589_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
AZA19202.1|144916_145549_-	3-methyladenine DNA glycosylase	NA	NA	NA	NA	NA
AZA19203.1|145689_147096_-|transposase	ISLre2-like element ISLhe10 family transposase	transposase	NA	NA	NA	NA
>prophage 3
CP031018	Lactobacillus helveticus isolate NWC_2_4 chromosome, complete genome	2177422	194860	313541	2177422	tRNA,protease,holin,transposase	Bacillus_phage(11.54%)	90	NA	NA
AZA20738.1|194860_196126_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
AZA19246.1|196184_198206_-	potassium transporter Kup	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	34.4	1.6e-63
AZA19247.1|198469_198904_-	hypothetical protein	NA	NA	NA	NA	NA
AZA19248.1|199154_199262_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AZA19249.1|199419_199821_-	hypothetical protein	NA	NA	NA	NA	NA
AZA19250.1|200057_200273_+	DUF1659 domain-containing protein	NA	NA	NA	NA	NA
AZA19251.1|201105_202440_+	S-layer protein	NA	NA	NA	NA	NA
AZA19252.1|204442_205666_+	N-acetylmuramidase	NA	S5M9Y4	Brevibacillus_phage	36.9	1.6e-13
AZA19253.1|205684_206776_+	amidase	NA	A0A2H4JAS1	uncultured_Caudovirales_phage	26.9	1.3e-19
AZA19254.1|206925_208104_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA19255.1|208259_210095_+	potassium transporter	NA	NA	NA	NA	NA
AZA19256.1|210212_210947_+	DUF4065 domain-containing protein	NA	Q9AZG0	Lactococcus_phage	31.6	6.5e-31
AZA19257.1|211292_212258_-	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AZA19258.1|212267_213059_-	hypothetical protein	NA	NA	NA	NA	NA
AZA19259.1|215505_216198_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
AZA19260.1|216420_217023_+	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
AZA19261.1|217086_217647_+	aldose epimerase	NA	NA	NA	NA	NA
AZA19262.1|217748_218858_+	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AZA19263.1|218857_219475_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19264.1|219510_222501_+	LTA synthase family protein	NA	NA	NA	NA	NA
AZA19265.1|222586_223972_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
AZA19266.1|224225_225488_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	3.0e-84
AZA19267.1|225908_226265_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19268.1|226570_227884_+	aminopeptidase	NA	R4TV59	Phaeocystis_globosa_virus	33.0	3.3e-62
AZA20739.1|227883_228540_+	HD domain-containing protein	NA	NA	NA	NA	NA
AZA19269.1|228655_229798_+	guanosine monophosphate reductase	NA	A0A1V0SHK8	Klosneuvirus	34.0	1.3e-62
AZA19270.1|229850_231167_-	aminopeptidase E	NA	R4TV59	Phaeocystis_globosa_virus	36.3	3.6e-64
AZA19271.1|231307_231733_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AZA19272.1|231979_232441_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AZA19273.1|232529_233192_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AZA19274.1|233352_233952_-	DUF159 family protein	NA	NA	NA	NA	NA
AZA19275.1|234108_235515_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AZA19276.1|235683_236706_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AZA19277.1|236730_237210_+	competence protein ComE	NA	A7KUY9	Bacillus_phage	59.0	5.2e-37
AZA19278.1|237190_237808_+	TPM domain-containing protein	NA	NA	NA	NA	NA
AZA19279.1|238105_240769_+	magnesium-translocating P-type ATPase	NA	M1HXH2	Paramecium_bursaria_Chlorella_virus	24.4	1.3e-36
AZA19280.1|240861_242838_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.2	2.3e-99
AZA19281.1|242837_243605_+	TatD family deoxyribonuclease	NA	NA	NA	NA	NA
AZA19282.1|243591_244158_+	ribonuclease M5	NA	NA	NA	NA	NA
AZA19283.1|244147_245032_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
AZA19284.1|245093_245351_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19285.1|245469_246300_+	pur operon repressor	NA	NA	NA	NA	NA
AZA19286.1|246346_247732_+	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	A0A0G2Y8M0	Acanthamoeba_polyphaga_mimivirus	34.0	1.0e-29
AZA19287.1|247963_248569_+	S-layer protein	NA	NA	NA	NA	NA
AZA19288.1|248654_249848_+	cell separation protein	NA	NA	NA	NA	NA
AZA19289.1|249983_251378_+	cell division protein	NA	NA	NA	NA	NA
AZA19290.1|251618_252593_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	36.8	8.6e-47
AZA19291.1|253622_253898_-	hypothetical protein	NA	NA	NA	NA	NA
AZA19292.1|253925_255290_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	32.6	1.1e-31
AZA20740.1|255387_256653_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.4	6.1e-53
AZA19293.1|256903_258310_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AZA19294.1|258480_258882_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
AZA19295.1|258928_259486_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
AZA19296.1|259603_261223_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	47.2	5.6e-136
AZA19297.1|261352_262648_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AZA19298.1|263002_263392_+	HAD family hydrolase	NA	NA	NA	NA	NA
AZA19299.1|263447_264872_-	dipeptidase A	NA	NA	NA	NA	NA
AZA19300.1|264952_265771_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZA19301.1|265822_267001_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA19302.1|267256_268531_-	purine permease	NA	Q9KX94	Enterobacteria_phage	27.9	1.4e-28
AZA19303.1|268534_269113_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AZA20741.1|269353_269956_-	hypothetical protein	NA	NA	NA	NA	NA
AZA19304.1|270258_271437_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA19305.1|271618_272878_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	58.5	9.2e-126
AZA20742.1|273376_273670_-	hypothetical protein	NA	NA	NA	NA	NA
AZA19306.1|273712_273865_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZA19307.1|274088_275639_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	34.1	6.2e-23
AZA19308.1|277173_278352_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA19309.1|280771_282049_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.3	3.8e-10
AZA19310.1|284553_285732_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA19311.1|286359_286605_+	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
AZA19312.1|286731_288099_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
AZA19313.1|288111_289623_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	39.1	3.8e-70
AZA19314.1|289705_290062_+	holo-ACP synthase	NA	NA	NA	NA	NA
AZA19315.1|290064_291195_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.7	7.2e-29
AZA19316.1|293447_294155_-	CBS domain-containing protein	NA	NA	NA	NA	NA
AZA19317.1|294298_295705_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AZA19318.1|295950_296922_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
AZA19319.1|297056_297614_+|tRNA	peptidyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AZA19320.1|297615_301113_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
AZA19321.1|301124_301367_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
AZA19322.1|301432_301810_+	septum formation initiator family protein	NA	NA	NA	NA	NA
AZA19323.1|301809_302172_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
AZA19324.1|302212_303469_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
AZA19325.1|303563_305729_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5EQU5	Bathycoccus_sp._RCC1105_virus	47.8	3.0e-108
AZA19326.1|305781_306672_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
AZA19327.1|306746_307775_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AZA19328.1|307790_309341_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	35.6	1.5e-82
AZA19329.1|310500_310956_+	GAF domain-containing protein	NA	NA	NA	NA	NA
AZA19330.1|311060_313541_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	33.3	4.8e-118
>prophage 4
CP031018	Lactobacillus helveticus isolate NWC_2_4 chromosome, complete genome	2177422	343050	381111	2177422	tRNA,transposase	Bacillus_phage(27.27%)	30	NA	NA
AZA19368.1|343050_343842_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AZA19369.1|343942_344386_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AZA19370.1|344401_344797_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
AZA19371.1|344906_346184_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.2	2.4e-12
AZA19372.1|346329_347352_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
AZA19373.1|348126_348885_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
AZA19374.1|348923_349604_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
AZA20744.1|349846_351112_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.4	6.1e-53
AZA19375.1|351215_352622_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AZA19376.1|352743_353643_+	cation transporter	NA	A0A1V0SED0	Indivirus	35.7	9.8e-13
AZA19377.1|353651_353834_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19378.1|353847_354528_+	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
AZA19379.1|354631_355567_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	A0A2H4IYY2	uncultured_Caudovirales_phage	29.1	1.2e-10
AZA19380.1|355707_355896_+	hypothetical protein	NA	Q5ULQ4	Lactobacillus_virus	67.3	2.9e-12
AZA19381.1|357233_358412_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA19382.1|358785_361464_+	magnesium-translocating P-type ATPase	NA	M1HJQ2	Paramecium_bursaria_Chlorella_virus	24.4	1.1e-43
AZA19383.1|362115_362958_-	sugar transporter	NA	NA	NA	NA	NA
AZA19384.1|363101_364451_-	aminopeptidase C	NA	R4TV59	Phaeocystis_globosa_virus	35.5	4.8e-72
AZA19385.1|364660_365518_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA19386.1|365754_367038_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	58.5	7.9e-125
AZA19387.1|367157_367460_-	hypothetical protein	NA	NA	NA	NA	NA
AZA19388.1|367572_368751_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA19389.1|368976_369528_+	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	48.6	3.1e-38
AZA19390.1|370979_372479_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
AZA19391.1|372571_374002_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	29.4	6.2e-46
AZA19392.1|373994_374435_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19393.1|374421_375174_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
AZA19394.1|375316_375862_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AZA19395.1|375937_376156_+	hypothetical protein	NA	NA	NA	NA	NA
AZA20745.1|379845_381111_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
>prophage 5
CP031018	Lactobacillus helveticus isolate NWC_2_4 chromosome, complete genome	2177422	406251	457957	2177422	holin,tRNA,transposase	Burkholderia_virus(15.0%)	47	NA	NA
AZA19421.1|406251_406986_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AZA19422.1|406969_407542_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
AZA20746.1|407619_408669_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	35.2	1.1e-50
AZA19423.1|408737_410015_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	5.3e-12
AZA19424.1|410192_412106_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.4	6.0e-60
AZA19425.1|412279_412927_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
AZA19426.1|412990_414268_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.9	3.4e-11
AZA19427.1|414536_414995_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
AZA19428.1|414991_415738_+	hypothetical protein	NA	NA	NA	NA	NA
AZA20747.1|417152_417683_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
AZA19429.1|417826_418120_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19430.1|418263_418356_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AZA19431.1|418653_419184_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19432.1|419399_419684_+	co-chaperone GroES	NA	A0A221S304	uncultured_virus	40.7	1.2e-12
AZA19433.1|419737_421360_+	chaperonin GroEL	NA	A0A240F766	uncultured_virus	54.2	9.0e-158
AZA20748.1|421540_424117_+	DNA mismatch repair protein MutS	NA	F2QAF7	Pyramimonas_orientalis_virus	25.2	4.6e-39
AZA19434.1|424116_426027_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.3	2.9e-54
AZA19435.1|426027_426618_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AZA19436.1|426666_427683_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	32.5	7.4e-09
AZA19437.1|427732_428167_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
AZA19438.1|428302_429754_+	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	32.4	3.3e-63
AZA19439.1|429746_430868_+	DNA polymerase IV	NA	A0A1P8CWP4	Bacillus_phage	24.5	3.1e-16
AZA19440.1|430927_431884_+	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
AZA19441.1|431876_433238_+	ATP-dependent helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.2	1.5e-49
AZA19442.1|433977_435156_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA19443.1|435252_435681_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19444.1|435950_438590_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	33.0	6.1e-63
AZA19445.1|438650_438908_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
AZA19446.1|438907_439336_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
AZA19447.1|439337_439649_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
AZA19448.1|439712_442070_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	48.7	9.7e-20
AZA19449.1|442170_442482_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	43.8	5.9e-18
AZA19450.1|442541_443819_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.1	3.8e-10
AZA19451.1|443994_444366_-	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
AZA19452.1|445668_446082_-	DUF2507 domain-containing protein	NA	NA	NA	NA	NA
AZA19453.1|446158_446962_+	glutamate racemase	NA	NA	NA	NA	NA
AZA19454.1|446961_447582_+	XTP/dITP diphosphatase	NA	A0A2P1DNP2	Cassava_brown_streak_virus	34.0	8.8e-13
AZA19455.1|448013_449315_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.9	7.0e-12
AZA19456.1|449347_450526_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA19457.1|450773_451937_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	36.1	8.6e-54
AZA19458.1|452519_452972_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19459.1|453011_453305_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19460.1|453308_453542_+	hypothetical protein	NA	NA	NA	NA	NA
AZA20749.1|453600_453942_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19461.1|453980_455159_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA19462.1|455258_456164_+	MFS transporter	NA	NA	NA	NA	NA
AZA19463.1|456262_457957_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	4.6e-88
>prophage 6
CP031018	Lactobacillus helveticus isolate NWC_2_4 chromosome, complete genome	2177422	461597	540751	2177422	tRNA,transposase	Staphylococcus_phage(28.57%)	58	NA	NA
AZA19466.1|461597_462842_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.3	3.1e-09
AZA19467.1|463009_463861_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
AZA19468.1|463994_464420_+	DUF948 domain-containing protein	NA	NA	NA	NA	NA
AZA19469.1|464437_464809_+	DUF1269 domain-containing family protein	NA	NA	NA	NA	NA
AZA19470.1|464874_465981_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
AZA19471.1|466127_467129_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.3	1.1e-20
AZA19472.1|467209_468580_-	glycerophosphodiester phosphodiesterase	NA	A0A173GBD0	Staphylococcus_phage	26.5	2.8e-11
AZA19473.1|468687_469008_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19474.1|469022_470414_+	bifunctional metallophosphatase/5'-nucleotidase	NA	S4VPC4	Pandoravirus	23.2	3.9e-08
AZA19475.1|470397_471021_+	DUF1027 domain-containing protein	NA	NA	NA	NA	NA
AZA19476.1|471020_471800_+	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
AZA19477.1|471796_472405_+	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
AZA19478.1|472418_473069_-	hypothetical protein	NA	NA	NA	NA	NA
AZA19479.1|473077_474007_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K9L162	Tupanvirus	25.2	4.1e-14
AZA19480.1|482918_484082_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
AZA19481.1|484095_485139_+	glycosyltransferase	NA	NA	NA	NA	NA
AZA19482.1|485138_486161_+	UPF0104 family protein	NA	NA	NA	NA	NA
AZA19483.1|486236_488300_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	45.7	1.0e-142
AZA19484.1|488424_489831_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AZA19485.1|489967_490201_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
AZA19486.1|490275_492615_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	36.0	5.5e-84
AZA19487.1|492627_493086_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	57.4	2.1e-43
AZA19488.1|495260_495446_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19489.1|498805_499696_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA19490.1|500147_501347_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	66.8	2.6e-138
AZA19491.1|501365_502826_+	MFS transporter	NA	S4TR35	Salmonella_phage	24.2	4.9e-06
AZA19492.1|503986_504649_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AZA19493.1|504792_506199_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AZA19494.1|506545_508960_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	65.8	0.0e+00
AZA19495.1|509053_510700_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AZA19496.1|511967_512423_+	pullulanase	NA	NA	NA	NA	NA
AZA19497.1|513855_514419_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19498.1|514415_515111_+	hypothetical protein	NA	NA	NA	NA	NA
AZA20750.1|516064_516397_+	thiol reductase thioredoxin	NA	NA	NA	NA	NA
AZA19499.1|516386_517037_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AZA19500.1|517127_518075_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	48.9	5.7e-80
AZA20751.1|518213_518327_+	protein-disulfide isomerase	NA	NA	NA	NA	NA
AZA19501.1|518382_518682_+	dithiol-disulfide isomerase	NA	NA	NA	NA	NA
AZA19502.1|518802_519096_-	hypothetical protein	NA	NA	NA	NA	NA
AZA19503.1|519432_520611_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA19504.1|521088_521397_-	PspC domain-containing protein	NA	NA	NA	NA	NA
AZA19505.1|521696_522992_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	27.6	3.8e-18
AZA19506.1|522993_523842_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
AZA19507.1|523968_524643_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
AZA19508.1|524682_525174_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AZA19509.1|525882_526494_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
AZA19510.1|527028_528714_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	31.2	5.1e-71
AZA19511.1|528824_529736_+	ketose-bisphosphate aldolase	NA	NA	NA	NA	NA
AZA19512.1|529807_530326_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AZA19513.1|530328_530598_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19514.1|530745_531030_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19515.1|531019_531631_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19516.1|533717_533939_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19517.1|534047_534338_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZA19518.1|534513_534768_+	AbrB family toxin-antitoxin system antitoxin	NA	NA	NA	NA	NA
AZA19519.1|534832_535147_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
AZA19520.1|538605_539445_+	DegV family protein	NA	NA	NA	NA	NA
AZA19521.1|539572_540751_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 7
CP031018	Lactobacillus helveticus isolate NWC_2_4 chromosome, complete genome	2177422	558726	702467	2177422	bacteriocin,protease,tRNA,transposase	Bacillus_phage(34.62%)	102	NA	NA
AZA19536.1|558726_559905_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA19537.1|559973_560309_-	hypothetical protein	NA	NA	NA	NA	NA
AZA19538.1|560318_560756_-	HIT family protein	NA	NA	NA	NA	NA
AZA19539.1|561250_561586_+	addiction module antidote protein, HigA family	NA	NA	NA	NA	NA
AZA19540.1|561600_562344_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.6	1.7e-18
AZA19541.1|562336_563524_+	ABC transporter permease	NA	NA	NA	NA	NA
AZA19542.1|563535_564189_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AZA19543.1|564259_564580_+	thioredoxin	NA	NA	NA	NA	NA
AZA19544.1|564599_565247_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
AZA19545.1|565298_566606_-	hypothetical protein	NA	NA	NA	NA	NA
AZA19546.1|568251_569430_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA19547.1|569612_569810_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19548.1|569917_570526_+|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	42.0	8.8e-34
AZA19549.1|570555_571881_+|transposase	transposase	transposase	G3MB42	Bacillus_virus	36.3	7.3e-57
AZA20754.1|572245_572632_+	ABC transporter permease	NA	NA	NA	NA	NA
AZA19550.1|572969_577940_+	peptidase S8	NA	A0A1B0T6A2	Bacillus_phage	32.8	3.1e-15
AZA19551.1|578106_579384_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.2	2.2e-10
AZA19552.1|579697_580933_-|transposase	IS3-like element ISLhe6 family transposase	transposase	A0A1B1P773	Bacillus_phage	47.3	9.8e-56
AZA19553.1|580988_581633_-	hypothetical protein	NA	NA	NA	NA	NA
AZA19554.1|581667_582300_-	aggregation promoting protein	NA	A0A0E3XCL7	Enterococcus_phage	62.2	4.1e-18
AZA19555.1|583127_584306_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA19556.1|584859_586173_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
AZA19557.1|586227_587205_-	cell surface protein	NA	NA	NA	NA	NA
AZA19558.1|587293_588808_-	M1 family peptidase	NA	NA	NA	NA	NA
AZA19559.1|588945_589923_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
AZA19560.1|590329_590644_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
AZA19561.1|590661_591543_+	SPFH domain-containing protein	NA	NA	NA	NA	NA
AZA20755.1|592511_593777_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
AZA19562.1|596418_597597_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA19563.1|597898_599599_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.7	1.3e-87
AZA19564.1|599630_600488_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA19565.1|600649_603184_+	CRISPR-associated helicase Cas3'	NA	A0A2R2ZGW0	Clostridioides_phage	20.8	2.0e-10
AZA19566.1|603198_603942_+	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
AZA19567.1|603941_605915_+	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
AZA19568.1|605917_606769_+	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
AZA19569.1|606771_607428_+	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
AZA19570.1|607424_608456_+	type I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
AZA19571.1|611092_613756_+	DNA polymerase I	NA	F8WQ35	Bacillus_phage	30.6	8.9e-62
AZA19572.1|613764_614595_+	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	25.9	1.6e-17
AZA19573.1|614591_615194_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
AZA19574.1|615196_615664_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AZA19575.1|615666_616998_+	chromosome replication initiation protein	NA	NA	NA	NA	NA
AZA20756.1|617029_617938_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	28.1	9.2e-27
AZA19576.1|618228_620163_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	33.2	3.6e-97
AZA19577.1|620438_621617_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA19578.1|622356_622887_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19579.1|623077_623686_+|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	4.0e-34
AZA19580.1|623715_625041_+|transposase	transposase	transposase	G3MB42	Bacillus_virus	35.8	8.9e-55
AZA20757.1|626220_626538_+	ACT domain-containing protein	NA	NA	NA	NA	NA
AZA19581.1|629074_630253_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA19582.1|631159_631705_+	translation initiation factor IF-3	NA	A0A2I7S9Q1	Vibrio_phage	37.3	1.1e-14
AZA19583.1|631726_631927_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AZA19584.1|631970_632327_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AZA19585.1|632472_632997_+	YqeG family HAD IIIA-type phosphatase	NA	NA	NA	NA	NA
AZA19586.1|632989_634099_+	ribosome biogenesis GTPase YqeH	NA	NA	NA	NA	NA
AZA19587.1|634109_634775_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
AZA19588.1|634755_635349_+	HD domain-containing protein	NA	NA	NA	NA	NA
AZA19589.1|635370_635718_+	ribosome silencing factor	NA	NA	NA	NA	NA
AZA19590.1|635723_636875_+	nucleotidyltransferase	NA	NA	NA	NA	NA
AZA19591.1|636876_637431_+	DUF177 domain-containing protein	NA	NA	NA	NA	NA
AZA19592.1|637593_638310_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	30.1	1.8e-25
AZA19593.1|638296_639856_+	sensor histidine kinase	NA	NA	NA	NA	NA
AZA19594.1|639907_641185_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.5	1.9e-09
AZA19595.1|641362_641851_-|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
AZA19596.1|641898_642873_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
AZA19597.1|642919_643192_-	Acylphosphatase domain-containing protein	NA	NA	NA	NA	NA
AZA19598.1|643289_644057_+	RNA methyltransferase	NA	NA	NA	NA	NA
AZA19599.1|644168_644528_+	transcriptional regulator	NA	NA	NA	NA	NA
AZA20758.1|644754_646020_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.4	4.7e-53
AZA19600.1|646123_647530_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AZA19601.1|647881_648931_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.3	5.3e-34
AZA19602.1|648934_651349_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AZA19603.1|651425_651902_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AZA19604.1|651964_652879_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
AZA20759.1|653066_653408_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AZA19605.1|653376_653673_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZA20760.1|653731_654997_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.4	4.7e-53
AZA19606.1|655209_656133_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AZA19607.1|656240_658832_-	ABC transporter permease	NA	NA	NA	NA	NA
AZA19608.1|658922_661031_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
AZA19609.1|661107_661257_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AZA19610.1|661305_661866_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
AZA19611.1|661886_662567_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AZA19612.1|662567_662795_+	DUF910 family protein	NA	NA	NA	NA	NA
AZA19613.1|662853_663255_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AZA19614.1|663333_664254_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AZA19615.1|666016_667354_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
AZA19616.1|669339_670746_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AZA19617.1|671078_672068_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19618.1|673666_674944_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	5.3e-12
AZA19619.1|675073_676066_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	5.3e-52
AZA19620.1|676170_677127_-	beta-galactosidase small subunit	NA	NA	NA	NA	NA
AZA19621.1|677110_678997_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	33.5	3.1e-93
AZA19622.1|680223_681231_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AZA20761.1|683541_685461_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AZA20762.1|688144_689410_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
AZA19623.1|690170_690752_-	PepQ	NA	NA	NA	NA	NA
AZA19624.1|690754_691372_-	PepQ protein	NA	NA	NA	NA	NA
AZA19625.1|693524_695399_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
AZA19626.1|695471_696701_-	MFS transporter	NA	NA	NA	NA	NA
AZA19627.1|696855_698253_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AZA19628.1|701288_702467_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 8
CP031018	Lactobacillus helveticus isolate NWC_2_4 chromosome, complete genome	2177422	707721	778668	2177422	transposase	Bacillus_phage(20.0%)	49	NA	NA
AZA19633.1|707721_708549_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA19634.1|710412_711585_+	MFS transporter	NA	NA	NA	NA	NA
AZA19635.1|711603_712011_+	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AZA19636.1|712030_712735_+	aldo/keto reductase	NA	NA	NA	NA	NA
AZA19637.1|713707_714985_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.4	1.3e-10
AZA20763.1|716258_717524_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
AZA19638.1|717659_718838_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA19639.1|719057_720509_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AZA19640.1|720786_722016_-|transposase	IS110-like element ISLhe4 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.4	2.2e-63
AZA19641.1|722253_723513_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.8	6.8e-12
AZA19642.1|723775_726988_+	type I restriction-modification system endonuclease	NA	A0A1B1IW48	uncultured_Mediterranean_phage	28.9	1.2e-09
AZA19643.1|727008_728463_+	SAM-dependent methyltransferase	NA	J7I0U9	Acinetobacter_phage	26.5	8.9e-24
AZA19644.1|728449_729892_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AZA20764.1|729979_730594_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19645.1|730676_731921_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
AZA19646.1|732160_733345_+	hypothetical protein	NA	NA	NA	NA	NA
AZA20765.1|733616_734882_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
AZA19647.1|736136_736373_-	hypothetical protein	NA	NA	NA	NA	NA
AZA19648.1|736483_737455_-	hypothetical protein	NA	NA	NA	NA	NA
AZA19649.1|739308_740487_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA19650.1|741238_741565_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
AZA19651.1|741566_742451_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
AZA19652.1|742465_743128_-	serine dehydratase	NA	NA	NA	NA	NA
AZA19653.1|743481_744888_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AZA19654.1|745264_745561_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19655.1|745695_746931_+	MFS transporter	NA	NA	NA	NA	NA
AZA20766.1|746987_749612_-	cation-translocating P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	30.0	1.1e-83
AZA20768.1|750774_751158_-	ABC transporter permease	NA	NA	NA	NA	NA
AZA20767.1|751541_751820_+	damage-inducible protein J	NA	NA	NA	NA	NA
AZA19656.1|752044_752668_-	orotate phosphoribosyltransferase	NA	A0A0B5IW17	Pandoravirus	32.9	2.6e-25
AZA19657.1|752669_753374_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
AZA19658.1|753628_754552_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AZA19659.1|754718_755261_+	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
AZA20769.1|755400_756666_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.4	4.7e-53
AZA19660.1|757832_759110_+	dihydroorotase	NA	NA	NA	NA	NA
AZA19661.1|759109_760195_+	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.1	1.3e-56
AZA19662.1|760187_763376_+	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
AZA19663.1|765610_765781_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AZA19664.1|765959_766823_+	sugar transporter	NA	NA	NA	NA	NA
AZA19665.1|766938_767220_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19666.1|767212_767638_+	peptide-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
AZA19667.1|767689_770071_-	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
AZA19668.1|770351_771530_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA19669.1|772165_772522_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	39.6	1.7e-13
AZA19670.1|772530_773427_-	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	26.6	2.4e-11
AZA19671.1|773885_775106_+	lysin	NA	X2CXX8	Lactobacillus_phage	50.9	1.7e-60
AZA19672.1|775228_777025_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
AZA19673.1|777095_777275_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
AZA19674.1|778059_778668_+|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	4.0e-34
>prophage 9
CP031018	Lactobacillus helveticus isolate NWC_2_4 chromosome, complete genome	2177422	787305	865662	2177422	protease,tRNA,transposase	Prochlorococcus_phage(11.76%)	60	NA	NA
AZA19684.1|787305_788355_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.7	1.1e-47
AZA19685.1|789386_790730_+	exodeoxyribonuclease VII large subunit	NA	A0A160DEV2	Gordonia_phage	32.1	7.7e-30
AZA19686.1|790732_790975_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
AZA19687.1|790977_791847_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
AZA19688.1|791847_792660_+	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
AZA19689.1|792670_794353_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AZA19690.1|798266_799673_+|transposase	ISLre2-like element ISLhe10 family transposase	transposase	NA	NA	NA	NA
AZA19691.1|799805_800420_+	guanylate kinase	NA	A0A223FN12	Murmansk_poxvirus	29.8	1.1e-18
AZA19692.1|800422_800647_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AZA19693.1|800697_803097_+	primosomal protein N'	NA	NA	NA	NA	NA
AZA19694.1|803110_804055_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	30.2	6.2e-10
AZA19695.1|804005_805370_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
AZA20770.1|805374_806130_+	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
AZA19696.1|806119_808135_+	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	Q8QNG7	Ectocarpus_siliculosus_virus	29.2	5.4e-19
AZA19697.1|808135_809026_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
AZA19698.1|809038_809689_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
AZA19699.1|809688_810375_+	thiamine diphosphokinase	NA	NA	NA	NA	NA
AZA19700.1|810648_811878_+|transposase	IS110-like element ISLhe4 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.9	1.5e-64
AZA19701.1|812082_812388_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19702.1|812494_812680_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
AZA19703.1|812835_813198_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
AZA19704.1|813219_814881_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
AZA20771.1|814882_816913_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
AZA19705.1|816933_817935_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
AZA19706.1|817965_818208_+	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	56.1	8.1e-07
AZA19707.1|818329_819364_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.2	4.6e-14
AZA19708.1|819367_820354_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.1	3.7e-13
AZA19709.1|820356_821316_+	ABC transporter permease	NA	NA	NA	NA	NA
AZA19710.1|821330_822260_+	ABC transporter permease	NA	NA	NA	NA	NA
AZA19711.1|824425_826189_+	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA19712.1|826298_826985_+	ribonuclease III	NA	M1HR51	Paramecium_bursaria_Chlorella_virus	30.6	8.2e-20
AZA19713.1|827000_830570_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
AZA19714.1|830570_831863_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
AZA19715.1|831935_833357_+	dipeptidase	NA	NA	NA	NA	NA
AZA19716.1|833556_833844_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZA19717.1|835471_836428_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	3.3e-27
AZA19718.1|836542_836884_+	transcriptional regulator	NA	NA	NA	NA	NA
AZA19719.1|836888_838319_+	signal recognition particle protein	NA	NA	NA	NA	NA
AZA19720.1|838409_838682_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AZA19721.1|838750_839266_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AZA19722.1|839255_839975_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AZA19723.1|840087_840435_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AZA19724.1|841474_842209_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
AZA19725.1|842289_842916_-	LexA repressor	NA	A0A1B2APZ1	Phage_Wrath	53.6	8.9e-13
AZA19726.1|843067_843331_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
AZA19727.1|843393_843612_+	YneF family protein	NA	NA	NA	NA	NA
AZA19728.1|846237_847497_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	22.0	3.5e-08
AZA19729.1|848569_849799_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	57.7	3.5e-122
AZA19730.1|852737_854681_+	M13 family peptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	28.2	1.2e-60
AZA19731.1|854738_855920_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	36.1	4.7e-47
AZA19732.1|855974_856589_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AZA19733.1|856654_857686_+	methyltransferase	NA	NA	NA	NA	NA
AZA19734.1|857847_858621_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
AZA19735.1|858654_859680_+	elongation factor Ts	NA	NA	NA	NA	NA
AZA19736.1|859818_860544_+	UMP kinase	NA	NA	NA	NA	NA
AZA19737.1|860543_861101_+	ribosome recycling factor	NA	NA	NA	NA	NA
AZA19738.1|861103_861838_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	39.0	2.5e-22
AZA19739.1|861839_862655_+	CDP-archaeol synthase	NA	NA	NA	NA	NA
AZA19740.1|862665_863922_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
AZA19741.1|863964_865662_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 10
CP031018	Lactobacillus helveticus isolate NWC_2_4 chromosome, complete genome	2177422	875438	1075713	2177422	portal,capsid,integrase,head,transposase,tail,tRNA	Lactobacillus_phage(41.89%)	173	901095:901154	940487:941855
AZA19747.1|875438_876332_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
AZA19748.1|876352_877312_+	riboflavin biosynthesis protein RibF	NA	A0A1V0SD03	Indivirus	30.1	8.0e-05
AZA19749.1|877349_878528_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA19750.1|878848_879898_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
AZA19751.1|879913_880513_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AZA19752.1|880530_882357_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.3	5.4e-143
AZA19753.1|882438_883593_+	molecular chaperone DnaJ	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	30.2	9.6e-21
AZA19754.1|884447_884663_-	hypothetical protein	NA	NA	NA	NA	NA
AZA19755.1|884831_886670_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.1	4.0e-21
AZA19756.1|886672_887362_+	class A sortase	NA	NA	NA	NA	NA
AZA19757.1|887482_889756_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	35.9	1.3e-77
AZA19758.1|889860_890388_+	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
AZA19759.1|890531_891461_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	59.9	4.4e-101
AZA19760.1|891476_892271_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
AZA19761.1|892474_893524_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.9	4.7e-51
AZA19762.1|893635_894814_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA19763.1|895033_895534_+	lactocepin S-layer protein	NA	NA	NA	NA	NA
AZA19764.1|895602_897876_-	HAD family hydrolase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	26.8	2.7e-43
AZA19765.1|898004_898859_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
901095:901154	attL	GAAACTGTCAAATCTTTTGTGTAAATAGATCTTTCTCATAGATTGATTTTTTATTATTTA	NA	NA	NA	NA
AZA19766.1|901155_902334_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA19767.1|903537_904074_+	citrate lyase holo-[acyl-carrier protein] synthase	NA	NA	NA	NA	NA
AZA19768.1|904194_905361_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZA19769.1|905473_906652_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA19770.1|906918_907524_+	transcriptional regulator	NA	NA	NA	NA	NA
AZA19771.1|907690_908719_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.3	7.7e-46
AZA19772.1|909268_910147_-	YitT family protein	NA	NA	NA	NA	NA
AZA19773.1|910250_911372_-|integrase	site-specific integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	41.4	6.8e-72
AZA19774.1|911527_911749_-	hypothetical protein	NA	E9LUL0	Lactobacillus_phage	66.7	2.5e-18
AZA19775.1|911762_912422_-	hypothetical protein	NA	NA	NA	NA	NA
AZA19776.1|912493_912895_-	ImmA/IrrE family metallo-endopeptidase	NA	X2CXW8	Lactobacillus_phage	38.9	1.8e-22
AZA19777.1|912887_913232_-	XRE family transcriptional regulator	NA	M1I9X0	Streptococcus_phage	33.3	3.8e-10
AZA19778.1|913519_913729_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZA19779.1|913734_914034_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19780.1|914192_914528_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19781.1|914514_914793_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19782.1|914782_915028_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19783.1|915027_915726_+	DNA-binding protein	NA	Q9T1I1	Lactobacillus_phage	76.1	5.7e-101
AZA19784.1|915646_916219_+	endonuclease	NA	A0A1W6JH43	Lactococcus_phage	45.7	5.4e-33
AZA19785.1|917580_918111_+	DUF669 domain-containing protein	NA	Q9T1H8	Lactobacillus_phage	73.9	7.6e-74
AZA19786.1|918166_920485_+	DNA primase	NA	Q9T1H6	Lactobacillus_phage	72.7	0.0e+00
AZA19787.1|920751_920931_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19788.1|921678_922227_+	endonuclease	NA	A0A1L2JXM8	Streptococcus_phage	42.9	6.1e-34
AZA20774.1|922240_922600_+	VRR-NUC domain-containing protein	NA	L0P7E5	Lactobacillus_phage	89.8	1.0e-58
AZA19789.1|923025_923466_+	hypothetical protein	NA	L0P6G6	Lactobacillus_phage	96.6	6.8e-76
AZA19790.1|924023_925073_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.9	2.1e-51
AZA19791.1|925222_925480_+	hypothetical protein	NA	A0A0S2MYF8	Enterococcus_phage	54.0	1.7e-07
AZA19792.1|925613_926102_+	helix-turn-helix domain-containing protein	NA	L0P6X1	Lactobacillus_phage	86.0	1.1e-55
AZA20775.1|927516_928935_+|portal	phage portal protein	portal	X2CY64	Lactobacillus_phage	66.6	6.6e-181
AZA19793.1|928970_929996_+|head	phage head morphogenesis protein	head	A9D9S7	Lactobacillus_prophage	59.7	7.5e-118
AZA19794.1|929968_930157_+	hypothetical protein	NA	L0P6G0	Lactobacillus_phage	98.4	6.7e-25
AZA19795.1|930266_930806_+|capsid	phage capsid protein	capsid	L0P7B0	Lactobacillus_phage	97.2	1.9e-88
AZA19796.1|930820_931897_+|capsid	capsid protein	capsid	L0P8M2	Lactobacillus_phage	99.4	2.4e-199
AZA19797.1|931914_932286_+	hypothetical protein	NA	L0P6D1	Lactobacillus_phage	100.0	1.6e-62
AZA19798.1|932282_932645_+	hypothetical protein	NA	A9D9T8	Lactobacillus_prophage	67.5	3.2e-39
AZA19799.1|932641_933043_+	HK97 gp10 family phage protein	NA	A9D9U1	Lactobacillus_prophage	54.2	6.0e-39
AZA19800.1|933039_933465_+	hypothetical protein	NA	L0P6G4	Lactobacillus_phage	100.0	5.9e-77
AZA19801.1|933433_933637_+	hypothetical protein	NA	L0P7B3	Lactobacillus_phage	100.0	2.1e-24
AZA19802.1|933640_935101_+|tail	phage tail protein	tail	L0P8M7	Lactobacillus_phage	94.9	7.3e-260
AZA19803.1|935112_935586_+|tail	phage tail protein	tail	L0P6D4	Lactobacillus_phage	98.7	4.2e-84
AZA19804.1|935597_936014_+	hypothetical protein	NA	L0P6Y3	Lactobacillus_phage	99.3	2.9e-68
AZA20776.1|938608_939082_+	hypothetical protein	NA	L0P7B8	Lactobacillus_phage	98.1	1.0e-61
AZA19805.1|939088_939790_+	hypothetical protein	NA	L0P8M9	Lactobacillus_phage	94.0	4.3e-117
AZA19806.1|940547_941726_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA19807.1|942199_942544_+	DUF2577 domain-containing protein	NA	L0P6Y6	Lactobacillus_phage	100.0	9.0e-60
940487:941855	attR	GAAACTGTCAAATCTTTTGTGTAAATAGATCTTTCTCATAGATTGATTTTTTATTATTTATTTAATCAAAGTAAGATTCTAAGGTGTCCTGAACCTGACCAAAGCCTTTGTGAATTCGGTTGAAGTAGCGGTCATTGTAACTCATTACTTGGATGCCAATGAAAGTATCAAGCGACTGTTCAGTCGGAAACTCTGCTTTGGGCTTAGCCTTGCGCTTAATGACGTTGTTAAAAGATTCAATCATGTTGGTAGAGTAAATTGAAGCTCTGATCTGCTTAGGATAATTATAGAAGACCAGCAGGTCCGGCTCGATGTCTTTCAGGTTTCTTATGACATGATTATAACTCTTGTCCCATTTGGCATAGAAGGCATGCAATACATCAACAGCAGCTGCTTTATTGGCTTGCTGGTGAATCTGCTTGAATTCGTTCATAATTGCCTCGCGATCCTCCACGCGTACTTTAGCGCAGATATTACGCATGACATGAACCAAGCAACGCTGGAAATGAGCTTGAGGATAGGTCTTTGCCAGTGCTGTCTTCATGCCCACAACGCCATCTGAAAGAAAAAGCTCTACTTGCTCTAAGCCGCGAGACTTCATGCTTTGGAGCAGCTCCGTCCAGACTTCAATGTTTTCATTGGGCGCAATGCAGTAGTCGATAACTTCCTTGTGGCCATTAGGTTTGATGCCAATGGCAATATAGACAGCTTCACGTTCAAAAGTTTCTCGGCGCAGAGGAACGTAGGTAGCGTCTAGATAAACGCAGAAGAACTTATCGCTAAGCTTACGCTTGTGATAGGCCTCTACCTTGGGGATCATCTGCTTAGAAATATTGGATACTTGAGCGGGGCTGTAATGGCTGCCATACATTTTTTCAATCAAATCAGCTATCTCTCTGGTAGTTACACCTTTAGAGTAAAGCTTGATGATCATGTTTTCCAAGACATCGGAGTGCTGCTTGTAGTCAGGCAGCGTGTGCTGATGAAACAGGCCGTTGCGGTCTCGTGGCACCTGGATTTCAATTTTGCCAAACTGCGTATCCACCTTGCGAAAGTAGGTACCGTTCCTAGAATTGCCGGTATTCCAGCCGTCTCTTGCATAAGGATTATAACCTAAAAAGGCGGTTAATTCAGCTTCTAACAAGTCATTAACTGCTTGTTGTAATTCTTTACGCAATAAATCATTAATTTTGTCTTGATTGAATAGAGCTTGAGCAATATTTTTGGTAAAATCATTCATGAAGGAGTTCTTCTTTCTGTATGTTTTTTTGTTCAAACCAATCATACGAGAAAGGAACTCCTTTTTCTAATATTTTAAGAAATTAATTTAAGGAATCATTCATCCTTACACAAACTATTTTACAGTCTC	NA	NA	NA	NA
AZA20777.1|942569_942983_+	DUF2634 domain-containing protein	NA	L0P6H1	Lactobacillus_phage	97.8	2.9e-68
AZA19808.1|942972_944118_+	hypothetical protein	NA	L0P7C2	Lactobacillus_phage	75.9	6.7e-168
AZA19809.1|944110_944785_+	DUF2313 domain-containing protein	NA	Q9AZ88	Lactobacillus_prophage	43.4	6.4e-33
AZA19810.1|944781_946203_+	hypothetical protein	NA	X2CXX7	Lactobacillus_phage	25.2	8.2e-06
AZA19811.1|946220_947084_+	hypothetical protein	NA	F8J1C9	Lactobacillus_phage	34.9	8.7e-27
AZA19812.1|947490_948039_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19813.1|948038_948221_+	XkdX family protein	NA	NA	NA	NA	NA
AZA19814.1|948180_948594_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19815.1|948613_948823_+	hypothetical protein	NA	L0P8N8	Lactobacillus_phage	89.9	7.2e-20
AZA19816.1|948806_949034_+	hypothetical protein	NA	L0P6E4	Lactobacillus_phage	100.0	2.7e-36
AZA20778.1|949042_949429_+	hypothetical protein	NA	L0P6Z4	Lactobacillus_phage	95.3	4.7e-57
AZA19817.1|949495_950617_+	lysin	NA	L0P6H6	Lactobacillus_phage	87.9	5.4e-186
AZA19818.1|951044_951644_-	M23 family peptidase	NA	NA	NA	NA	NA
AZA19819.1|951847_952684_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
AZA19820.1|952938_953115_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AZA19821.1|953225_953669_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	32.9	1.5e-11
AZA19822.1|953694_954654_+	PhoH family protein	NA	W8D063	Erwinia_phage	46.1	1.7e-47
AZA19823.1|954656_955181_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
AZA19824.1|955180_956086_+	GTPase Era	NA	NA	NA	NA	NA
AZA19825.1|957091_958009_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
AZA19826.1|958001_960065_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AZA19827.1|960090_961926_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	34.8	1.0e-56
AZA19828.1|961942_963055_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	37.6	2.4e-37
AZA19829.1|963380_963728_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZA20779.1|963767_963998_+|transposase	transposase	transposase	NA	NA	NA	NA
AZA19830.1|963972_965310_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	5.6e-49
AZA19831.1|965383_966031_-	M23 family peptidase	NA	NA	NA	NA	NA
AZA19832.1|966569_967748_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA19833.1|967907_968594_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZA19834.1|968586_969384_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
AZA19835.1|969403_970645_+	peptidase T	NA	NA	NA	NA	NA
AZA19836.1|970919_971285_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZA19837.1|971286_971994_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	3.7e-15
AZA19838.1|971993_972839_+	ABC transporter permease	NA	NA	NA	NA	NA
AZA19839.1|973894_975073_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA19840.1|975290_975860_-	signal peptidase I	NA	NA	NA	NA	NA
AZA19841.1|975945_976698_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZA19842.1|976687_977671_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19843.1|977645_979028_+	RNA methyltransferase	NA	NA	NA	NA	NA
AZA19844.1|979079_980096_-	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
AZA19845.1|980108_981191_-	phosphomevalonate kinase	NA	NA	NA	NA	NA
AZA19846.1|981234_982197_-	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
AZA19847.1|982196_983105_-	mevalonate kinase	NA	NA	NA	NA	NA
AZA19848.1|983185_986668_+	ATP-dependent helicase	NA	NA	NA	NA	NA
AZA19849.1|986670_990285_+	helicase-exonuclease AddAB subunit AddA	NA	S5M596	Bacillus_phage	23.9	1.9e-22
AZA19850.1|990303_993093_+	ATP-dependent DNA helicase	NA	A0A1X9I5C8	Streptococcus_phage	26.9	2.3e-68
AZA20780.1|993092_993590_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19851.1|993643_994942_+|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	27.8	2.3e-47
AZA19852.1|995027_995672_+	DnaD domain protein	NA	A0A0N7AE27	Bacillus_phage	36.0	4.2e-10
AZA19853.1|995673_996294_+	endonuclease III	NA	NA	NA	NA	NA
AZA19854.1|996377_997655_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.9	3.4e-11
AZA19855.1|997979_1000259_-	penicillin-binding protein	NA	NA	NA	NA	NA
AZA19856.1|1000255_1000888_-	Holliday junction resolvase RecU	NA	A0A1B1P798	Bacillus_phage	31.2	1.6e-17
AZA19857.1|1000951_1001521_+	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
AZA19858.1|1001611_1002028_+	DivIVA domain-containing protein	NA	NA	NA	NA	NA
AZA19859.1|1002491_1003616_+	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
AZA19860.1|1004918_1005197_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19861.1|1005193_1006867_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
AZA19862.1|1006873_1007338_+	signal peptidase II	NA	NA	NA	NA	NA
AZA19863.1|1007330_1008242_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.1	1.0e-09
AZA19864.1|1008244_1009300_+	carbamoyl phosphate synthase small subunit	NA	NA	NA	NA	NA
AZA19865.1|1009303_1012495_+	carbamoyl phosphate synthase large subunit	NA	NA	NA	NA	NA
AZA19866.1|1012562_1014257_-	fibronectin/fibrinogen-binding protein	NA	Q84500	Paramecium_bursaria_Chlorella_virus	40.0	3.2e-09
AZA19867.1|1014380_1015559_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA19868.1|1015785_1016202_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZA19869.1|1016277_1017159_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.9	4.4e-10
AZA19870.1|1017887_1019066_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA19871.1|1020354_1020810_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19872.1|1020816_1021308_+	adenylate kinase	NA	A0A097BYE2	Leuconostoc_phage	36.1	5.0e-19
AZA19873.1|1021353_1021971_-	DUF5052 family protein	NA	A0A2K9VCV0	Lactobacillus_phage	44.2	1.9e-39
AZA19874.1|1022178_1022550_-	hypothetical protein	NA	NA	NA	NA	NA
AZA19875.1|1022599_1022803_-	gametolysin	NA	NA	NA	NA	NA
AZA19876.1|1023919_1025098_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA19877.1|1025700_1026879_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA19878.1|1028732_1029086_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZA19879.1|1029115_1029700_-	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	44.6	8.2e-29
AZA19880.1|1029784_1030720_-	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
AZA19881.1|1031865_1034322_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.3	3.0e-96
AZA19882.1|1034338_1036285_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	41.0	2.7e-116
AZA19883.1|1036381_1037008_+	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
AZA19884.1|1038658_1039126_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
AZA19885.1|1039214_1039733_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZA19886.1|1041543_1042134_+	Sir2 silent information regulator family NAD-dependent deacetylase	NA	NA	NA	NA	NA
AZA19887.1|1042803_1043043_-	ACT domain-containing protein	NA	NA	NA	NA	NA
AZA19888.1|1043198_1043951_-	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
AZA19889.1|1043983_1045162_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA19890.1|1046761_1047793_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	39.2	1.8e-34
AZA19891.1|1048612_1049473_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA20781.1|1049484_1050225_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.2	4.1e-33
AZA19892.1|1050234_1050909_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AZA19893.1|1050889_1051549_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AZA19894.1|1051923_1052292_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AZA19895.1|1052489_1052696_-	hypothetical protein	NA	NA	NA	NA	NA
AZA19896.1|1052880_1053417_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AZA19897.1|1053428_1054520_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	23.1	1.4e-05
AZA19898.1|1054509_1055844_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AZA19899.1|1056897_1057248_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AZA19900.1|1057487_1058765_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.9	2.6e-11
AZA19901.1|1059986_1061264_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.9	8.4e-10
AZA19902.1|1061337_1061613_-	hypothetical protein	NA	NA	NA	NA	NA
AZA19903.1|1061790_1062228_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
AZA19904.1|1062229_1062643_+	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
AZA19905.1|1062678_1063176_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZA19906.1|1064729_1064942_+	transcriptional regulator	NA	NA	NA	NA	NA
AZA19907.1|1064977_1067716_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AZA19908.1|1067854_1069261_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AZA19909.1|1070305_1071319_-	class A beta-lactamase-related serine hydrolase	NA	NA	NA	NA	NA
AZA19910.1|1071520_1072924_+	dipeptidase PepV	NA	NA	NA	NA	NA
AZA19911.1|1074435_1075713_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	5.3e-12
>prophage 11
CP031018	Lactobacillus helveticus isolate NWC_2_4 chromosome, complete genome	2177422	1082492	1160276	2177422	protease,integrase,tRNA,transposase	Bacillus_phage(25.0%)	49	1114704:1114720	1150242:1150258
AZA19918.1|1082492_1083671_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA19919.1|1085562_1086810_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
AZA19920.1|1089515_1090703_-	amidohydrolase	NA	NA	NA	NA	NA
AZA19921.1|1090860_1092138_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	5.3e-12
AZA19922.1|1094339_1095671_-	amino acid permease	NA	NA	NA	NA	NA
AZA19923.1|1095967_1096333_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
AZA19924.1|1096470_1097877_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AZA19925.1|1098118_1100065_+	M13 family peptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	28.8	3.0e-59
AZA19926.1|1101208_1102387_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA19927.1|1106261_1106651_-	hypothetical protein	NA	NA	NA	NA	NA
AZA19928.1|1106718_1107897_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA19929.1|1108056_1108494_-	hypothetical protein	NA	NA	NA	NA	NA
AZA19930.1|1108642_1110223_+	hypothetical protein	NA	NA	NA	NA	NA
AZA19931.1|1110396_1111674_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.9	3.4e-11
AZA19932.1|1111745_1112291_-	hypothetical protein	NA	NA	NA	NA	NA
AZA19933.1|1112879_1113257_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
AZA19934.1|1113269_1114010_-	hypothetical protein	NA	NA	NA	NA	NA
AZA19935.1|1114016_1115600_-	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	26.5	1.1e-19
1114704:1114720	attL	ATTATTCATCAAATTAT	NA	NA	NA	NA
AZA19936.1|1115589_1117194_-	ATP-binding cassette domain-containing protein	NA	A0A076FI99	Aureococcus_anophage	21.6	3.8e-15
AZA19937.1|1117366_1117717_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20782.1|1118258_1118471_-	hypothetical protein	NA	NA	NA	NA	NA
AZA19938.1|1118476_1119763_-	peptidase T	NA	NA	NA	NA	NA
AZA19939.1|1119921_1121256_+	MATE family efflux transporter	NA	NA	NA	NA	NA
AZA20783.1|1121447_1122713_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
AZA19940.1|1124057_1124615_-	hypothetical protein	NA	NA	NA	NA	NA
AZA19941.1|1124621_1125503_-	pyridoxal kinase	NA	NA	NA	NA	NA
AZA19942.1|1125509_1126607_-	class C beta-lactamase-related serine hydrolase	NA	NA	NA	NA	NA
AZA19943.1|1126731_1127346_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
AZA19944.1|1127446_1128079_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AZA19945.1|1128307_1128757_-	transcriptional regulator	NA	NA	NA	NA	NA
AZA19946.1|1128984_1130163_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA19947.1|1130245_1132018_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	38.6	2.9e-77
AZA19948.1|1133446_1134145_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
AZA19949.1|1134211_1135471_-	aluminum resistance protein	NA	NA	NA	NA	NA
AZA20784.1|1138682_1139948_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
AZA19950.1|1140685_1142092_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AZA20785.1|1142342_1143608_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
AZA19951.1|1145395_1145773_-	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
AZA19952.1|1145774_1146158_-	CrcB family protein	NA	A0A2H4PQR0	Staphylococcus_phage	36.5	3.1e-08
AZA19953.1|1147818_1148634_+|integrase	integrase	integrase	NA	NA	NA	NA
AZA19954.1|1149701_1150601_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
1150242:1150258	attR	ATTATTCATCAAATTAT	NA	NA	NA	NA
AZA19955.1|1150753_1152157_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IB03	Erwinia_phage	25.3	9.8e-28
AZA19956.1|1152167_1152692_-	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
AZA19957.1|1152700_1153609_-	tyrosine recombinase	NA	A0A1P8DJJ6	Virus_Rctr41k	25.1	2.3e-14
AZA19958.1|1153608_1154925_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
AZA19959.1|1154985_1157073_-	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	37.2	1.5e-96
AZA19960.1|1157144_1157993_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	36.8	4.9e-30
AZA20786.1|1158043_1159309_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
AZA19961.1|1159523_1160276_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	38.6	1.3e-26
>prophage 12
CP031018	Lactobacillus helveticus isolate NWC_2_4 chromosome, complete genome	2177422	1193434	1235203	2177422	tRNA,transposase	Bacillus_phage(22.22%)	32	NA	NA
AZA19992.1|1193434_1194292_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA19993.1|1194368_1194731_-	hypothetical protein	NA	NA	NA	NA	NA
AZA19994.1|1194744_1195335_-	hypothetical protein	NA	NA	NA	NA	NA
AZA19995.1|1195552_1196068_-	hypothetical protein	NA	NA	NA	NA	NA
AZA19996.1|1196778_1197714_-	Mrr restriction system protein	NA	NA	NA	NA	NA
AZA19997.1|1197898_1198756_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA20788.1|1198827_1200093_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
AZA19998.1|1200383_1200980_+	DedA family protein	NA	NA	NA	NA	NA
AZA19999.1|1201086_1202472_+	amino acid permease	NA	NA	NA	NA	NA
AZA20000.1|1204420_1205257_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	36.3	1.5e-36
AZA20001.1|1205428_1206622_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.4	1.3e-41
AZA20002.1|1206757_1208164_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AZA20789.1|1208414_1209680_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
AZA20003.1|1210202_1211609_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AZA20004.1|1211737_1212922_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AZA20005.1|1213010_1214864_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	24.4	2.2e-11
AZA20006.1|1214869_1216156_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	25.1	5.3e-20
AZA20007.1|1216480_1216918_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
AZA20008.1|1216917_1219158_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.0	1.3e-10
AZA20009.1|1219172_1219622_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20010.1|1219590_1220538_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AZA20011.1|1220598_1221108_+|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
AZA20012.1|1222805_1223312_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AZA20013.1|1223414_1224761_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
AZA20014.1|1224993_1225851_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA20015.1|1226859_1227192_+	transporter	NA	A0A0P0I7G8	Lactobacillus_phage	43.6	4.4e-19
AZA20016.1|1227446_1227827_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
AZA20017.1|1227958_1228516_+	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA20018.1|1228528_1230238_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.6	1.3e-18
AZA20019.1|1230230_1231064_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
AZA20020.1|1233114_1233933_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20021.1|1234024_1235203_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 13
CP031018	Lactobacillus helveticus isolate NWC_2_4 chromosome, complete genome	2177422	1239476	1311568	2177422	transposase	Bacillus_virus(22.22%)	55	NA	NA
AZA20026.1|1239476_1240883_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AZA20790.1|1240986_1242252_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
AZA20027.1|1242491_1243283_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZA20028.1|1243360_1244827_-	anion permease	NA	NA	NA	NA	NA
AZA20029.1|1245145_1246459_-	aminopeptidase	NA	R4TV59	Phaeocystis_globosa_virus	32.3	1.1e-57
AZA20030.1|1246556_1247090_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20031.1|1247112_1247784_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20032.1|1250217_1251144_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
AZA20033.1|1251417_1252596_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20034.1|1252838_1253486_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20035.1|1253555_1253870_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20036.1|1253938_1254184_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20037.1|1254180_1255017_-	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
AZA20038.1|1255051_1255219_-	mucus-binding protein	NA	NA	NA	NA	NA
AZA20039.1|1255266_1255569_-	mucus-binding protein	NA	NA	NA	NA	NA
AZA20040.1|1255555_1256248_-	mucus-binding protein	NA	NA	NA	NA	NA
AZA20041.1|1256238_1256559_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20042.1|1256853_1258230_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.9	1.4e-55
AZA20043.1|1258241_1259645_-	class II fumarate hydratase	NA	NA	NA	NA	NA
AZA20044.1|1259835_1261014_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20045.1|1261212_1261437_+	hypothetical protein	NA	NA	NA	NA	NA
AZA20046.1|1261599_1263303_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	4.6e-88
AZA20047.1|1264706_1265408_-	ABC transporter permease	NA	NA	NA	NA	NA
AZA20048.1|1265400_1266462_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.1e-30
AZA20049.1|1266474_1267335_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA20050.1|1267685_1270103_-	HAD family hydrolase	NA	E4ZFI9	Streptococcus_phage	20.2	2.1e-17
AZA20051.1|1270202_1270385_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZA20052.1|1270397_1270601_-	hypothetical protein	NA	Q9AZG0	Lactococcus_phage	50.0	5.6e-09
AZA20791.1|1270720_1271239_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.5	2.2e-25
AZA20053.1|1271253_1272210_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	60.5	3.6e-114
AZA20054.1|1272351_1273740_-	amino acid permease	NA	NA	NA	NA	NA
AZA20055.1|1274073_1275480_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AZA20792.1|1275752_1275824_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
AZA20056.1|1275845_1276214_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0A7S1E5	Clostridium_phage	39.8	4.9e-11
AZA20057.1|1278911_1279487_+	PAP2 family protein	NA	NA	NA	NA	NA
AZA20058.1|1279534_1280365_-	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	40.6	3.0e-48
AZA20059.1|1280587_1281874_+	enolase	NA	A0A1X9I5Z8	Streptococcus_phage	51.7	2.3e-108
AZA20060.1|1281949_1282552_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
AZA20061.1|1282704_1283193_-	nitroreductase	NA	NA	NA	NA	NA
AZA20062.1|1284355_1285738_+	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
AZA20063.1|1285737_1286679_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
AZA20064.1|1286837_1288079_-|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	57.5	9.7e-120
AZA20065.1|1288829_1289552_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZA20066.1|1290546_1291251_-	ADP-ribose pyrophosphatase	NA	G3MA14	Bacillus_virus	25.5	1.6e-07
AZA20067.1|1292958_1294398_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	41.8	1.5e-95
AZA20068.1|1294394_1294949_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.8	4.7e-34
AZA20069.1|1296808_1297987_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20070.1|1298527_1299163_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZA20071.1|1301847_1302777_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA20793.1|1302836_1304123_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.8	4.3e-54
AZA20072.1|1304310_1304826_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20073.1|1305433_1307044_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
AZA20074.1|1307088_1307664_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AZA20075.1|1308552_1309731_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20794.1|1310302_1311568_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
>prophage 15
CP031018	Lactobacillus helveticus isolate NWC_2_4 chromosome, complete genome	2177422	1393055	1528311	2177422	protease,tRNA,transposase	Streptococcus_phage(22.22%)	108	NA	NA
AZA20147.1|1393055_1394234_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20148.1|1394741_1395959_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
AZA20149.1|1395958_1397119_-	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	31.8	2.3e-38
AZA20150.1|1397211_1398921_-	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
AZA20151.1|1399042_1400221_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20152.1|1400663_1401275_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
AZA20153.1|1401365_1401833_+	DUF1694 domain-containing protein	NA	NA	NA	NA	NA
AZA20154.1|1401832_1403149_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	49.2	1.4e-100
AZA20797.1|1403388_1404654_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
AZA20155.1|1404757_1406164_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AZA20156.1|1406525_1406807_+	hypothetical protein	NA	NA	NA	NA	NA
AZA20157.1|1406874_1407339_+	universal stress protein	NA	NA	NA	NA	NA
AZA20158.1|1407404_1408598_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
AZA20159.1|1408619_1408847_-	DUF2969 domain-containing protein	NA	NA	NA	NA	NA
AZA20160.1|1408855_1409149_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
AZA20161.1|1409162_1410152_-	rod shape-determining protein	NA	NA	NA	NA	NA
AZA20162.1|1410235_1410466_-	DUF1146 domain-containing protein	NA	NA	NA	NA	NA
AZA20163.1|1410529_1410970_-	ATP synthase epsilon chain	NA	NA	NA	NA	NA
AZA20164.1|1410981_1412421_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
AZA20165.1|1412443_1413406_-	ATP synthase subunit gamma	NA	NA	NA	NA	NA
AZA20166.1|1413416_1414928_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
AZA20167.1|1414942_1415491_-	ATP synthase subunit delta	NA	NA	NA	NA	NA
AZA20168.1|1415490_1416000_-	ATP synthase F0 subunit B	NA	NA	NA	NA	NA
AZA20169.1|1416051_1416285_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
AZA20170.1|1416304_1417018_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
AZA20171.1|1417141_1417771_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AZA20172.1|1417855_1418857_-	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	38.7	7.2e-49
AZA20173.1|1418862_1419705_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AZA20174.1|1419697_1420786_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	44.6	1.4e-05
AZA20175.1|1420802_1421402_-	thymidine kinase	NA	C1KFH3	Lactobacillus_virus	50.8	2.4e-47
AZA20176.1|1421552_1422905_+	Mur ligase family protein	NA	NA	NA	NA	NA
AZA20177.1|1423224_1424238_+	class A beta-lactamase-related serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	25.7	3.4e-06
AZA20178.1|1425835_1427176_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AZA20179.1|1427251_1427866_-	VanZ family protein	NA	NA	NA	NA	NA
AZA20180.1|1427990_1430162_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	43.2	1.6e-149
AZA20798.1|1430739_1432005_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
AZA20181.1|1434583_1435306_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.9	1.0e-36
AZA20182.1|1435305_1435698_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20183.1|1435732_1436698_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
AZA20184.1|1436790_1437948_-	putative C-S lyase	NA	NA	NA	NA	NA
AZA20185.1|1439062_1440241_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20186.1|1440374_1441652_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	4.5e-11
AZA20799.1|1441926_1443192_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
AZA20187.1|1443661_1444846_-	acetate kinase	NA	NA	NA	NA	NA
AZA20188.1|1444894_1445896_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZA20800.1|1446065_1446566_-	competence protein ComGF	NA	NA	NA	NA	NA
AZA20189.1|1446573_1446843_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20190.1|1446839_1447271_-	prepilin-type cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
AZA20191.1|1447239_1447590_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
AZA20192.1|1449693_1450422_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AZA20193.1|1450512_1451028_-	VanZ family protein	NA	NA	NA	NA	NA
AZA20194.1|1451193_1452372_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20195.1|1452502_1452688_-	type Z 30S ribosomal protein S14	NA	NA	NA	NA	NA
AZA20196.1|1452785_1454072_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	58.2	6.7e-124
AZA20197.1|1455752_1456709_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZA20198.1|1461585_1462740_+	glycerate kinase	NA	NA	NA	NA	NA
AZA20199.1|1462744_1463212_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
AZA20200.1|1463595_1464774_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20201.1|1465260_1466076_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AZA20202.1|1466085_1466901_-	HAD family phosphatase	NA	NA	NA	NA	NA
AZA20203.1|1467156_1468434_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.9	3.4e-11
AZA20204.1|1468444_1469818_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AZA20205.1|1469848_1470808_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20206.1|1470804_1471647_-	TIGR00159 family protein	NA	NA	NA	NA	NA
AZA20207.1|1471704_1472778_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
AZA20208.1|1472774_1473590_-	ABC transporter permease	NA	NA	NA	NA	NA
AZA20209.1|1473586_1474399_-	ABC transporter permease	NA	NA	NA	NA	NA
AZA20210.1|1474388_1475486_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	41.1	2.5e-34
AZA20211.1|1475551_1476448_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
AZA20212.1|1476545_1477079_+	exonuclease	NA	M1PFD8	Streptococcus_phage	36.6	6.8e-22
AZA20213.1|1477085_1477586_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
AZA20214.1|1477585_1478575_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
AZA20215.1|1478586_1479285_-	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	43.0	2.7e-42
AZA20216.1|1479353_1480235_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AZA20217.1|1480241_1480763_+	hypothetical protein	NA	NA	NA	NA	NA
AZA20218.1|1481093_1481852_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
AZA20219.1|1481877_1483089_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AZA20220.1|1483201_1484218_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AZA20221.1|1484273_1485305_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20222.1|1490120_1491398_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	5.3e-12
AZA20223.1|1491608_1492424_+	HAD family hydrolase	NA	NA	NA	NA	NA
AZA20224.1|1492478_1494104_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20225.1|1494247_1495105_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA20226.1|1495265_1496444_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20227.1|1496643_1497228_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	54.9	3.7e-53
AZA20228.1|1497279_1498215_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	35.2	1.4e-46
AZA20229.1|1498207_1499251_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	50.2	2.4e-87
AZA20230.1|1499261_1500137_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.3	4.1e-08
AZA20231.1|1500225_1500768_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20232.1|1500832_1503673_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	2.9e-305
AZA20233.1|1503662_1505711_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
AZA20234.1|1505813_1507538_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	46.0	2.6e-147
AZA20801.1|1507639_1508092_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
AZA20235.1|1508271_1509495_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	58.3	1.0e-121
AZA20236.1|1509842_1511021_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20237.1|1511929_1513639_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	4.6e-88
AZA20238.1|1513642_1514662_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AZA20239.1|1514703_1515546_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AZA20240.1|1515535_1516504_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
AZA20241.1|1516520_1516799_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20242.1|1516806_1517923_-	peptide chain release factor 2	NA	NA	NA	NA	NA
AZA20243.1|1517990_1520390_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
AZA20244.1|1520529_1521075_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AZA20245.1|1521155_1521851_-	ComF family protein	NA	NA	NA	NA	NA
AZA20246.1|1523176_1523839_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	43.8	3.4e-39
AZA20247.1|1523865_1525023_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
AZA20248.1|1525130_1526762_-	ribonuclease Y	NA	NA	NA	NA	NA
AZA20249.1|1526904_1528311_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
>prophage 16
CP031018	Lactobacillus helveticus isolate NWC_2_4 chromosome, complete genome	2177422	1537549	1590509	2177422	protease,tRNA,transposase	Bacillus_phage(23.08%)	44	NA	NA
AZA20258.1|1537549_1538110_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
AZA20259.1|1538160_1539360_-	AI-2E family transporter	NA	NA	NA	NA	NA
AZA20260.1|1542737_1543766_+	lactonase family protein	NA	NA	NA	NA	NA
AZA20261.1|1543954_1545133_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20262.1|1545252_1545945_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
AZA20802.1|1545976_1547242_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
AZA20263.1|1549335_1550232_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	31.0	3.6e-07
AZA20264.1|1550215_1551028_-	NAD(+) kinase	NA	NA	NA	NA	NA
AZA20265.1|1551024_1551657_-	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
AZA20266.1|1551780_1552395_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
AZA20267.1|1552473_1553091_+	DsbA family protein	NA	NA	NA	NA	NA
AZA20268.1|1553660_1554035_+|transposase	transposase	transposase	NA	NA	NA	NA
AZA20803.1|1554046_1554277_+|transposase	transposase	transposase	NA	NA	NA	NA
AZA20269.1|1554251_1555589_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
AZA20270.1|1555684_1556863_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20271.1|1557672_1558413_-	adaptor protein MecA	NA	NA	NA	NA	NA
AZA20272.1|1558504_1558903_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
AZA20273.1|1559058_1560465_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AZA20804.1|1560568_1561834_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
AZA20274.1|1562211_1563945_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
AZA20275.1|1563944_1564211_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AZA20276.1|1564324_1564519_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20805.1|1564669_1565935_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
AZA20277.1|1566153_1566858_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA20278.1|1566987_1569177_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A1C3S747	Escherichia_phage	40.5	8.8e-124
AZA20279.1|1569275_1569557_+	DUF1827 family protein	NA	NA	NA	NA	NA
AZA20280.1|1569618_1570896_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	5.3e-12
AZA20281.1|1571093_1572665_-	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	26.2	5.5e-35
AZA20282.1|1572664_1573537_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
AZA20283.1|1573644_1574106_+	hypothetical protein	NA	NA	NA	NA	NA
AZA20284.1|1574107_1574593_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20285.1|1574603_1575419_-	recombination regulator RecX	NA	NA	NA	NA	NA
AZA20286.1|1575540_1576923_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	33.2	3.9e-69
AZA20287.1|1576980_1578258_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.9	3.4e-11
AZA20288.1|1579110_1579695_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20289.1|1579743_1580199_-|transposase	IS4/IS5 family transposase	transposase	NA	NA	NA	NA
AZA20290.1|1580202_1580472_-|transposase	transposase	transposase	NA	NA	NA	NA
AZA20291.1|1580825_1581914_+|transposase	IS110 family transposase	transposase	A0A1X9I5Z0	Streptococcus_phage	38.2	6.4e-51
AZA20292.1|1582148_1582523_+|transposase	transposase	transposase	NA	NA	NA	NA
AZA20806.1|1582534_1582765_+|transposase	transposase	transposase	NA	NA	NA	NA
AZA20293.1|1582739_1584077_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
AZA20294.1|1584495_1585674_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20295.1|1586049_1588914_-	peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	27.0	1.9e-33
AZA20296.1|1589330_1590509_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
>prophage 17
CP031018	Lactobacillus helveticus isolate NWC_2_4 chromosome, complete genome	2177422	1610909	1839992	2177422	holin,integrase,tRNA,transposase	Bacillus_phage(19.15%)	170	1702000:1702059	1776698:1778166
AZA20807.1|1610909_1612175_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.4	6.1e-53
AZA20314.1|1612266_1612752_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
AZA20315.1|1617444_1618293_-	patatin family protein	NA	NA	NA	NA	NA
AZA20316.1|1618458_1619736_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	5.3e-12
AZA20317.1|1619834_1622234_-	phosphoketolase family protein	NA	NA	NA	NA	NA
AZA20318.1|1622530_1623295_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AZA20319.1|1623752_1624076_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
AZA20320.1|1624075_1625479_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AZA20321.1|1625471_1625933_-	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
AZA20322.1|1625919_1627158_-	SufS family cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.6	2.3e-97
AZA20323.1|1627132_1628410_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AZA20324.1|1628421_1629216_-	Fe-S cluster assembly ATPase SufC	NA	A0A1M7XV31	Cedratvirus	27.6	7.3e-12
AZA20325.1|1629408_1630587_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20326.1|1631659_1632478_+	HAD family hydrolase	NA	NA	NA	NA	NA
AZA20327.1|1632567_1632861_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20328.1|1635257_1636184_-	nucleoside hydrolase	NA	NA	NA	NA	NA
AZA20329.1|1636301_1638317_-	potassium transporter Kup	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	36.0	6.5e-65
AZA20330.1|1638377_1639070_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
AZA20331.1|1639069_1639996_-	ribokinase	NA	A0A2H4N7X4	Lake_Baikal_phage	37.5	6.3e-07
AZA20808.1|1641233_1642499_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.4	1.8e-52
AZA20332.1|1642603_1644010_+|transposase	ISLre2-like element ISLhe13 family transposase	transposase	NA	NA	NA	NA
AZA20333.1|1644164_1644434_+	ACT domain-containing protein	NA	NA	NA	NA	NA
AZA20334.1|1644446_1645790_+	PFL family protein	NA	NA	NA	NA	NA
AZA20335.1|1645938_1647240_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
AZA20336.1|1647523_1648720_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20337.1|1648803_1650114_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	4.6e-11
AZA20338.1|1650810_1652064_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	58.3	3.0e-121
AZA20339.1|1652576_1653230_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AZA20340.1|1653244_1653886_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AZA20341.1|1653885_1654704_-	glutamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA20342.1|1654714_1655455_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.4	9.4e-38
AZA20343.1|1655605_1656784_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20344.1|1656988_1657507_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20345.1|1657674_1659444_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.5	1.4e-55
AZA20346.1|1659443_1661174_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.7	4.9e-29
AZA20347.1|1661152_1661614_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZA20348.1|1661758_1662577_+	glutamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA20349.1|1662619_1663288_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
AZA20809.1|1663300_1663972_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZA20350.1|1664248_1665871_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	27.8	4.1e-54
AZA20351.1|1665975_1667058_-	M42 family peptidase	NA	NA	NA	NA	NA
AZA20352.1|1667195_1668602_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AZA20353.1|1668791_1669997_+	MFS transporter	NA	NA	NA	NA	NA
AZA20354.1|1670020_1671490_-	MFS transporter	NA	NA	NA	NA	NA
AZA20355.1|1671723_1673130_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AZA20356.1|1673152_1673332_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20357.1|1673387_1673918_+	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
AZA20358.1|1673930_1675259_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	35.9	2.0e-62
AZA20359.1|1676181_1677411_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	57.4	9.3e-123
AZA20360.1|1680410_1681019_-|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	1.5e-33
AZA20361.1|1681121_1681622_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZA20362.1|1681832_1683239_-|transposase	ISLre2-like element ISLhe10 family transposase	transposase	NA	NA	NA	NA
AZA20363.1|1684510_1684939_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20364.1|1685147_1685348_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.4	2.4e-20
AZA20365.1|1686702_1687659_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.0	2.9e-39
AZA20366.1|1687776_1688334_-	DUF1541 domain-containing protein	NA	NA	NA	NA	NA
AZA20367.1|1688515_1688740_-	PspC domain-containing protein	NA	NA	NA	NA	NA
AZA20368.1|1688762_1689941_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA20369.1|1690190_1690538_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AZA20370.1|1690611_1691073_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20371.1|1692933_1693725_+	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
AZA20372.1|1693745_1694924_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AZA20373.1|1694942_1695905_+	ketopantoate reductase family protein	NA	NA	NA	NA	NA
AZA20374.1|1697384_1698737_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	48.2	1.4e-116
AZA20375.1|1699102_1700479_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
AZA20376.1|1700515_1700857_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20377.1|1700941_1701799_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
1702000:1702059	attL	ATGATATGAACCCCGAAATTCGGACAAGAATTTCGAGGTTTTTGTTATGTCCAAATTATC	NA	NA	NA	NA
AZA20810.1|1702174_1703440_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
AZA20378.1|1703543_1704950_+|transposase	ISLre2-like element ISLhe10 family transposase	transposase	NA	NA	NA	NA
AZA20379.1|1705090_1705795_+	BAX inhibitor (BI)-1/YccA family protein	NA	NA	NA	NA	NA
AZA20380.1|1706587_1707508_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	25.8	2.7e-18
AZA20381.1|1707532_1708963_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
AZA20382.1|1708967_1710407_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
AZA20383.1|1710406_1710715_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
AZA20384.1|1710728_1711877_-	CamS family sex pheromone protein	NA	NA	NA	NA	NA
AZA20385.1|1711889_1713896_-	DNA ligase (NAD(+)) LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.1	7.1e-104
AZA20386.1|1713936_1716174_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.5	5.2e-132
AZA20387.1|1716259_1716907_-	N-acetylmuramidase	NA	S5M633	Brevibacillus_phage	47.7	1.0e-27
AZA20388.1|1717144_1717615_-	SprT family protein	NA	NA	NA	NA	NA
AZA20389.1|1717602_1718301_-	glycosyl transferase	NA	L7RBS6	Acanthamoeba_polyphaga_moumouvirus	27.6	2.1e-07
AZA20390.1|1718303_1719734_-	flippase	NA	NA	NA	NA	NA
AZA20391.1|1719738_1720893_-	CDP-glycerol--glycerophosphate glycerophosphotransferase	NA	NA	NA	NA	NA
AZA20392.1|1723831_1725073_-|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	57.2	7.7e-117
AZA20393.1|1725269_1726100_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	51.1	1.3e-67
AZA20394.1|1726096_1727575_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	47.6	1.3e-115
AZA20395.1|1727662_1728763_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
AZA20396.1|1728770_1729499_-	glycosyltransferase	NA	NA	NA	NA	NA
AZA20397.1|1731051_1731438_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A0F7LBI5	uncultured_marine_virus	47.2	7.1e-13
AZA20398.1|1731500_1732202_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZA20399.1|1732290_1733406_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20400.1|1733795_1734347_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20401.1|1735630_1736809_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20402.1|1738202_1739480_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.9	4.9e-10
AZA20403.1|1741150_1742329_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20404.1|1743252_1744470_-	phosphoglycerate mutase	NA	A0A1X9IGJ2	Lactococcus_phage	37.9	8.3e-15
AZA20405.1|1744470_1745049_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	37.1	2.5e-22
AZA20811.1|1745118_1746177_-	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
AZA20406.1|1746314_1747004_-	hypothetical protein	NA	A0A249XZV3	Enterococcus_phage	52.2	2.8e-12
AZA20407.1|1747386_1747503_+	hypothetical protein	NA	NA	NA	NA	NA
AZA20408.1|1747742_1749149_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AZA20409.1|1750300_1750693_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20410.1|1750794_1751004_+	hypothetical protein	NA	NA	NA	NA	NA
AZA20411.1|1751102_1751501_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
AZA20412.1|1751806_1753048_-|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	58.3	4.3e-120
AZA20413.1|1753313_1754468_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AZA20414.1|1754484_1755198_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZA20415.1|1755418_1755664_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20416.1|1756025_1757228_-|integrase	site-specific integrase	integrase	Q4ZE80	Staphylococcus_phage	24.4	5.5e-11
AZA20417.1|1757291_1757486_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20418.1|1757531_1758575_-	replication initiation protein	NA	A0A2K9LWK0	uncultured_virus	28.5	6.4e-08
AZA20419.1|1758588_1758927_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20420.1|1758923_1759325_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20421.1|1760115_1760460_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20422.1|1760456_1761530_-	cell division protein FtsK	NA	NA	NA	NA	NA
AZA20423.1|1761532_1761847_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20424.1|1762745_1763924_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20425.1|1765122_1766376_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	58.3	3.6e-122
AZA20426.1|1767456_1768635_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20427.1|1768788_1769538_+	TIGR02452 family protein	NA	NA	NA	NA	NA
AZA20428.1|1769555_1769927_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20429.1|1773715_1774894_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20430.1|1775190_1775418_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20812.1|1776872_1778138_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
AZA20431.1|1779221_1780400_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
1776698:1778166	attR	ATGATATGAACCCCGAAATTCGGACAAGAATTTCGAGGTTTTTGTTATGTCCAAATTATCTAAACAAGACAAAATTGATATTTACAATAGCTGGAAAAATTATGGTAAATCAGTTGAGCAATTAGGTAGAGAATACAATGTTACTTCTGGTAATTTAAGATATGTATTAAGCTTAATGGAGCGTTATGGAGTAAAAGTTCTAGATAAGCCATACGAAAATTATGCAACAGAGTTCAAAGAAAAAGCCATTAAAAGAGTCCTTTTTGCTCATGAATCAGCTCGCCGAGTATCATTAGAGCTAGGTTTATCCAATGGTGGACAAATTCATAATTGGATTCGCAAATATAAAGAAGATGGGTATAATGTCATTAATCACAAGAAAGGCAGACCTACCCATGAAGAACAAAGACAAGCAGATAGAGGAGCTTCAAAGGCAGATAAAAGACCTAAAACAGAAGAACTTAAGACTTACTGTCGAGAACGAGTTTGTAAAAAAATTGAACGCCTTAGTCTCCCAAAGAACCAAAAACCAACAGCACAAGAAATAGCTACTACGGTTACTCAGCTAAGGCAGGAACTTCACGTAACCGTTAAGTTTGTGCTTGATACGATCAATGCCAATCCTGATCTGCCACATCTGTCGCGCAGTAATTATTACTACACTTTGACTAAAGATGACAAAAATTTAAAAAACGAAAAAGTTATGAAGCGGATTAAAGAAATATTCGAAGAGCACAGACACCGGTATGGTTACCGCAGAATTACTGCTCAATTGCATCGAGAAGGTATGAGAGTGAATCATAAGCGCGTCAAGCGATTAATGGTCAAAATGCATTTATATGCCATTACCATCAGACGTAGATTTAAATATTCAAGCTATAAAGGAACTATTGGAAAAATCAAGTCCAATTTAATTAAACGTCATTTTGCGGCGATTATCCCAGATAGGCATTGGTACTCAGATATTACTGAATTTCACCTTAATGGAGAAAAGCTTTATCTATCGCCTGTGATGGATGGCTGCAGTCAAGAGATTGTTGCTTATACATTAAGCCGTCATCCAGTATTGAAACAAGTTATGGATATGCTGGATTTAGCTTATAAGAAACATCCAGCTCTTAATGGCCTAATTTTTCATACTGATCAAGGCTGGCAATATCAGCACGCTGCATTCCAAGCTTGGCTTAAAAATCATGGTGTTTCTCAATCTATGTCACGCAAAGGCAATTCTTTAGATGATGGCTTAATGGAAGGGTTTTTTGGTATTCTTAAGCGTGAGATGTTCTATGGCTTTGAAAAAACATTCAAAACCATGGATGAATTAGAGCAAGCAATCAAAGAATACATTCATTACTACAATCATGATAGAATCAAAACGGTACTAAAAAACCATACTCCGATAGAATATCGAAATATGGTCTTAAATAAAGCAGTCCAATAATATGTCCAAAATTTGGGGTTCATATCAA	NA	NA	NA	NA
AZA20813.1|1780676_1781159_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AZA20432.1|1781397_1781790_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20815.1|1781743_1782211_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20814.1|1782192_1782795_+	amino acid permease	NA	NA	NA	NA	NA
AZA20433.1|1783008_1783122_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AZA20434.1|1783305_1783599_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20435.1|1783672_1785484_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q76DQ7	Chlorella_virus	37.2	8.1e-91
AZA20436.1|1785678_1788303_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
AZA20816.1|1790027_1790519_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
AZA20437.1|1790618_1791797_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA20438.1|1792081_1792912_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZA20439.1|1794426_1794795_-	DUF956 family protein	NA	NA	NA	NA	NA
AZA20440.1|1794798_1795719_-	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
AZA20441.1|1795747_1796560_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
AZA20442.1|1796578_1797589_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
AZA20443.1|1799783_1800185_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
AZA20444.1|1800382_1801234_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZA20817.1|1804511_1804697_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20445.1|1806830_1808138_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.6	2.0e-91
AZA20446.1|1808361_1808913_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZA20447.1|1808912_1809521_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	38.5	4.7e-35
AZA20448.1|1809650_1810448_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZA20449.1|1810444_1810552_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZA20450.1|1810603_1811305_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZA20451.1|1811388_1812771_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AZA20452.1|1812816_1813851_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AZA20453.1|1814009_1817378_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20454.1|1817382_1817955_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZA20455.1|1818085_1819492_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AZA20456.1|1819697_1820648_-	serine hydrolase	NA	NA	NA	NA	NA
AZA20457.1|1820660_1821578_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
AZA20458.1|1821716_1823018_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
AZA20459.1|1823069_1824365_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AZA20460.1|1824348_1825173_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
AZA20461.1|1825176_1826043_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AZA20462.1|1826042_1827128_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.2	3.2e-26
AZA20463.1|1827368_1828796_-	dipeptidase	NA	NA	NA	NA	NA
AZA20464.1|1828837_1829692_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
AZA20465.1|1829782_1830736_-	DNA polymerase III subunit epsilon	NA	A0A0K2SUJ2	Clostridium_phage	33.1	8.8e-12
AZA20466.1|1830744_1831566_-	Sir2 family NAD-dependent protein deacetylase	NA	NA	NA	NA	NA
AZA20467.1|1831832_1833074_-|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	57.0	1.1e-118
AZA20468.1|1833254_1833662_-	DUF3290 domain-containing protein	NA	NA	NA	NA	NA
AZA20469.1|1833749_1834490_-	hypothetical protein	NA	A0A0A7NTY4	Lactobacillus_phage	82.7	2.6e-120
AZA20470.1|1835339_1836944_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.3	1.3e-15
AZA20818.1|1837216_1838482_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.4	6.1e-53
AZA20471.1|1838585_1839992_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
>prophage 18
CP031018	Lactobacillus helveticus isolate NWC_2_4 chromosome, complete genome	2177422	1846724	1976092	2177422	bacteriocin,protease,transposase	Bacillus_phage(21.88%)	117	NA	NA
AZA20478.1|1846724_1847903_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20479.1|1848015_1848576_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
AZA20480.1|1850122_1852429_-	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
AZA20481.1|1852578_1853265_+|protease	metalloprotease	protease	NA	NA	NA	NA
AZA20482.1|1853326_1853977_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
AZA20483.1|1854082_1855261_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20484.1|1855573_1857373_-	ABC transporter permease	NA	NA	NA	NA	NA
AZA20485.1|1857385_1858135_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	3.7e-34
AZA20486.1|1858281_1859553_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20487.1|1859641_1860313_+	hypothetical protein	NA	NA	NA	NA	NA
AZA20488.1|1860736_1861741_-	asparaginase	NA	NA	NA	NA	NA
AZA20489.1|1862193_1862379_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	71.7	7.3e-16
AZA20490.1|1862622_1862991_+	hypothetical protein	NA	NA	NA	NA	NA
AZA20819.1|1863056_1863332_+	hypothetical protein	NA	NA	NA	NA	NA
AZA20491.1|1863945_1865124_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20492.1|1865175_1865691_+	transcriptional regulator	NA	NA	NA	NA	NA
AZA20820.1|1865707_1866103_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZA20493.1|1866883_1867759_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	50.3	7.1e-77
AZA20494.1|1867923_1870029_-	putative ornithine decarboxylase	NA	NA	NA	NA	NA
AZA20495.1|1870253_1871705_+	APC family permease	NA	NA	NA	NA	NA
AZA20496.1|1871772_1873050_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	9.9e-11
AZA20497.1|1873812_1875279_-	flippase	NA	NA	NA	NA	NA
AZA20498.1|1875302_1876265_-	glycosyltransferase	NA	NA	NA	NA	NA
AZA20499.1|1876346_1876550_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20500.1|1876548_1877727_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20501.1|1878118_1879177_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.4	7.1e-47
AZA20502.1|1879189_1880167_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AZA20503.1|1881120_1882134_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AZA20504.1|1882234_1883413_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA20505.1|1883597_1884689_-	EpsG family protein	NA	NA	NA	NA	NA
AZA20506.1|1884762_1885584_-	glycosyltransferase	NA	A0A2P1ELT8	Moumouvirus	31.9	4.0e-05
AZA20507.1|1885598_1886501_-	capsular polysaccharide synthesis family protein	NA	NA	NA	NA	NA
AZA20508.1|1886500_1887313_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	39.3	2.7e-09
AZA20509.1|1887303_1888428_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AZA20510.1|1888433_1889087_-	sugar transferase	NA	NA	NA	NA	NA
AZA20511.1|1889203_1889974_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AZA20512.1|1889973_1890762_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AZA20513.1|1890772_1891660_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AZA20514.1|1891671_1892733_-	LytR family transcriptional regulator	NA	A0A1X9I5X1	Streptococcus_phage	30.6	1.5e-15
AZA20515.1|1893213_1894479_+	GTPase HflX	NA	NA	NA	NA	NA
AZA20516.1|1894500_1895514_+	CAP domain-containing protein	NA	NA	NA	NA	NA
AZA20517.1|1895724_1896657_-	hydrolase	NA	M9MUG9	Rhodococcus_phage	36.0	1.7e-12
AZA20821.1|1897587_1898853_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
AZA20518.1|1900048_1900831_-	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	46.4	2.3e-18
AZA20519.1|1901048_1901411_-	ATPase	NA	NA	NA	NA	NA
AZA20520.1|1901747_1903331_-|transposase	transposase	transposase	NA	NA	NA	NA
AZA20521.1|1903263_1903914_-|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	45.2	5.2e-40
AZA20522.1|1903979_1904300_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20523.1|1904347_1904557_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20822.1|1904651_1905905_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	58.5	6.1e-122
AZA20823.1|1905963_1906233_-	ATPase	NA	NA	NA	NA	NA
AZA20524.1|1906326_1906878_-	NlpC/P60 family protein	NA	A0A1V0DZX6	Clostridioides_phage	44.4	1.2e-18
AZA20525.1|1907067_1907613_-	guanylate kinase	NA	A0A218KC48	Bacillus_phage	31.7	7.2e-11
AZA20526.1|1907707_1908007_+	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
AZA20527.1|1908099_1909605_+	hypothetical protein	NA	NA	NA	NA	NA
AZA20528.1|1909619_1910261_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20529.1|1910505_1911699_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	57.0	2.3e-118
AZA20530.1|1911782_1912961_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20531.1|1913332_1914511_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA20532.1|1914767_1915112_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20533.1|1915224_1915761_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20534.1|1915936_1917223_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	55.4	5.1e-116
AZA20535.1|1917475_1917961_-	threonine/serine exporter	NA	NA	NA	NA	NA
AZA20536.1|1917963_1918734_-	threonine/serine exporter	NA	NA	NA	NA	NA
AZA20537.1|1918744_1920286_-	ABC transporter ATP-binding protein	NA	A0A2H4UUX5	Bodo_saltans_virus	28.0	3.7e-44
AZA20538.1|1920294_1920672_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20539.1|1920836_1921361_+	N-acetyltransferase	NA	NA	NA	NA	NA
AZA20540.1|1924938_1926735_+	oligoendopeptidase F	NA	NA	NA	NA	NA
AZA20541.1|1927022_1927316_+	Fic family protein	NA	NA	NA	NA	NA
AZA20542.1|1928233_1929610_-	L-cystine transporter	NA	NA	NA	NA	NA
AZA20543.1|1931233_1932412_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20544.1|1933035_1933830_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AZA20545.1|1933829_1934477_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	29.1	2.1e-17
AZA20546.1|1934508_1935426_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA20824.1|1935688_1935961_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AZA20547.1|1936164_1938162_-	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
AZA20548.1|1938182_1939097_-	1-phosphofructokinase	NA	NA	NA	NA	NA
AZA20825.1|1939096_1939852_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.8	5.0e-18
AZA20549.1|1940211_1940379_-	toxin-antitoxin system protein	NA	NA	NA	NA	NA
AZA20550.1|1940359_1940668_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20826.1|1940938_1941130_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20551.1|1941429_1941651_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20552.1|1941640_1941868_-	transcriptional regulator	NA	NA	NA	NA	NA
AZA20553.1|1942015_1942339_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AZA20554.1|1944070_1944820_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
AZA20555.1|1944828_1946400_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
AZA20556.1|1946450_1947599_-	sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	31.7	2.0e-18
AZA20557.1|1947602_1948289_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	37.2	1.1e-35
AZA20827.1|1948467_1950327_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.4	1.6e-46
AZA20558.1|1950336_1952061_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	7.6e-38
AZA20559.1|1952174_1952957_-	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
AZA20560.1|1952965_1954066_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
AZA20561.1|1954124_1954388_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
AZA20562.1|1954380_1955265_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.7	1.9e-16
AZA20563.1|1955242_1956022_-	ParA family protein	NA	Q8JL10	Natrialba_phage	31.5	4.3e-25
AZA20564.1|1956037_1956877_-	nucleoid occlusion protein	NA	S5VSZ7	Leptospira_phage	43.3	1.4e-16
AZA20565.1|1956891_1957614_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
AZA20566.1|1957775_1958312_+	CvpA family protein	NA	NA	NA	NA	NA
AZA20567.1|1958353_1959283_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
AZA20568.1|1959291_1960083_-	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
AZA20569.1|1960175_1960724_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	38.8	1.1e-27
AZA20570.1|1960737_1961277_-	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
AZA20571.1|1961501_1962680_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20572.1|1962801_1963425_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZA20573.1|1963709_1965035_-|transposase	transposase	transposase	G3MB42	Bacillus_virus	36.0	8.1e-56
AZA20574.1|1965064_1965673_-|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	2.0e-33
AZA20575.1|1965850_1966093_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20576.1|1966194_1967607_+	dipeptidase	NA	NA	NA	NA	NA
AZA20828.1|1967815_1969081_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
AZA20829.1|1969121_1969796_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	1.7e-33
AZA20577.1|1969797_1970859_-	ABC transporter permease	NA	NA	NA	NA	NA
AZA20578.1|1970859_1971387_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZA20579.1|1971497_1972097_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
AZA20580.1|1972252_1973008_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZA20581.1|1973004_1973766_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
AZA20582.1|1973824_1974469_+	hypothetical protein	NA	NA	NA	NA	NA
AZA20583.1|1974913_1976092_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 19
CP031018	Lactobacillus helveticus isolate NWC_2_4 chromosome, complete genome	2177422	1986038	2052712	2177422	bacteriocin,transposase	Bacillus_phage(16.67%)	54	NA	NA
AZA20589.1|1986038_1987217_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20830.1|1987337_1987691_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AZA20590.1|1987995_1988553_-	serine acetyltransferase	NA	NA	NA	NA	NA
AZA20591.1|1988518_1989703_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
AZA20592.1|1989724_1990636_-	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	41.7	2.8e-60
AZA20593.1|1991108_1991315_+	hypothetical protein	NA	NA	NA	NA	NA
AZA20831.1|1991540_1992806_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
AZA20594.1|1992909_1994316_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AZA20595.1|1994610_1996878_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.1	1.2e-59
AZA20596.1|1999208_2000096_-	sugar transporter	NA	NA	NA	NA	NA
AZA20832.1|2002626_2002926_-	resolvase	NA	A0A0A8WIK3	Clostridium_phage	40.0	5.2e-11
AZA20597.1|2002969_2003239_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20833.1|2004263_2005340_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	50.1	3.0e-85
AZA20598.1|2005822_2006269_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AZA20599.1|2006298_2006766_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZA20600.1|2006762_2007746_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
AZA20601.1|2007804_2008047_+	acyl carrier protein	NA	NA	NA	NA	NA
AZA20602.1|2008056_2008974_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
AZA20603.1|2008973_2009705_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.0	2.1e-13
AZA20604.1|2009726_2010956_+	beta-ketoacyl-[acyl-carrier-protein] synthase II	NA	NA	NA	NA	NA
AZA20605.1|2010959_2011430_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
AZA20606.1|2011434_2011851_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AZA20607.1|2011864_2013244_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AZA20608.1|2013224_2014067_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
AZA20609.1|2014059_2014830_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
AZA20610.1|2014889_2015648_+	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
AZA20611.1|2015695_2016685_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
AZA20612.1|2016758_2017301_+	biotin transporter BioY	NA	NA	NA	NA	NA
AZA20613.1|2018862_2019420_-	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
AZA20834.1|2019422_2020499_-	NCS2 family permease	NA	NA	NA	NA	NA
AZA20614.1|2020871_2021777_-	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
AZA20615.1|2021754_2024040_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
AZA20616.1|2024193_2024667_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
AZA20617.1|2025172_2026567_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AZA20618.1|2027396_2028293_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
AZA20619.1|2028280_2029945_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.0	2.4e-20
AZA20620.1|2029952_2030663_+	ECF transporter S component	NA	NA	NA	NA	NA
AZA20621.1|2031770_2032106_+	ethanolamine utilization protein EutP	NA	NA	NA	NA	NA
AZA20622.1|2032700_2033879_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20623.1|2033949_2035227_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	2.6e-11
AZA20624.1|2035368_2036718_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	50.3	7.0e-124
AZA20625.1|2037127_2037217_+	hypothetical protein	NA	NA	NA	NA	NA
AZA20626.1|2038902_2039742_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
AZA20627.1|2039765_2040926_-	MFS transporter	NA	A0A2H4UVM2	Bodo_saltans_virus	22.1	5.7e-05
AZA20628.1|2042263_2042674_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZA20629.1|2042776_2042875_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
AZA20630.1|2043253_2043397_+	hypothetical protein	NA	NA	NA	NA	NA
AZA20631.1|2043514_2044756_-	MFS transporter	NA	NA	NA	NA	NA
AZA20632.1|2046197_2047148_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.4	2.7e-13
AZA20633.1|2047155_2047929_-	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
AZA20634.1|2049608_2050418_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AZA20635.1|2050420_2050606_+	hypothetical protein	NA	NA	NA	NA	NA
AZA20636.1|2050699_2051386_+	cobalamin biosynthesis protein CobQ	NA	NA	NA	NA	NA
AZA20835.1|2051446_2052712_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.4	4.7e-53
>prophage 20
CP031018	Lactobacillus helveticus isolate NWC_2_4 chromosome, complete genome	2177422	2056352	2135273	2177422	protease,holin,transposase	Heterosigma_akashiwo_virus(16.67%)	60	NA	NA
AZA20641.1|2056352_2057210_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA20642.1|2057361_2057841_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20643.1|2057938_2058301_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20644.1|2058369_2059668_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.5	1.7e-18
AZA20645.1|2059671_2060961_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	36.3	5.8e-67
AZA20646.1|2061171_2062164_+	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	67.3	1.7e-130
AZA20647.1|2062602_2063625_-	DUF871 domain-containing protein	NA	NA	NA	NA	NA
AZA20648.1|2063692_2064871_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20649.1|2065484_2066498_+	asparagine synthetase A	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	41.4	2.1e-64
AZA20650.1|2066987_2068166_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20651.1|2068779_2069793_+	asparagine synthetase A	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	41.4	2.1e-64
AZA20652.1|2070282_2071461_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20653.1|2072177_2072492_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20654.1|2072640_2073819_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20655.1|2074022_2075348_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
AZA20656.1|2075316_2076240_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZA20657.1|2076524_2078648_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	40.6	4.5e-117
AZA20658.1|2078761_2079940_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20659.1|2080134_2080776_+	signal peptidase I	NA	NA	NA	NA	NA
AZA20660.1|2080869_2081661_+	hypothetical protein	NA	NA	NA	NA	NA
AZA20661.1|2081736_2083143_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AZA20662.1|2083333_2084686_+	amino acid permease	NA	NA	NA	NA	NA
AZA20663.1|2087152_2088544_+	APC family permease	NA	NA	NA	NA	NA
AZA20664.1|2088564_2088717_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20665.1|2088798_2089977_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA20666.1|2090535_2091252_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.6	3.5e-13
AZA20667.1|2091244_2091703_+	hypothetical protein	NA	NA	NA	NA	NA
AZA20668.1|2091741_2092920_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20669.1|2096258_2096495_+	hypothetical protein	NA	NA	NA	NA	NA
AZA20670.1|2096533_2098150_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AZA20671.1|2098311_2099490_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20672.1|2101786_2102965_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20673.1|2103590_2103998_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20674.1|2104406_2105114_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AZA20675.1|2105256_2106435_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20676.1|2106551_2106743_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZA20677.1|2106954_2107899_-	class A beta-lactamase-related serine hydrolase	NA	NA	NA	NA	NA
AZA20678.1|2107898_2109185_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
AZA20679.1|2109177_2109417_-	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
AZA20680.1|2109475_2110714_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	27.4	2.0e-24
AZA20681.1|2110713_2112228_-	D-alanine--poly(phosphoribitol) ligase subunit 1	NA	A0A2K9KZV5	Tupanvirus	28.4	5.8e-34
AZA20682.1|2112243_2112396_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
AZA20683.1|2112607_2113786_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20684.1|2113937_2115344_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AZA20836.1|2115447_2116713_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
AZA20685.1|2117063_2118242_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20686.1|2118399_2118696_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20687.1|2118715_2119852_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20688.1|2120725_2121904_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20689.1|2124684_2125863_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA20690.1|2126125_2127910_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.7	1.7e-69
AZA20691.1|2128063_2129233_+	cation:proton antiporter	NA	NA	NA	NA	NA
AZA20692.1|2129361_2129670_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AZA20693.1|2129656_2129926_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
AZA20694.1|2129963_2131532_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.1	4.2e-11
AZA20695.1|2131536_2132166_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20696.1|2132257_2133115_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZA20697.1|2133111_2133393_+	hypothetical protein	NA	NA	NA	NA	NA
AZA20837.1|2133546_2133690_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AZA20698.1|2134415_2135273_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
