The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032566	Yersinia pseudotuberculosis strain IP2666pIB1 chromosome, complete genome	4614856	203201	255317	4614856	protease,plate,transposase,tail	Pseudomonas_phage(33.33%)	58	NA	NA
AZA28704.1|203201_203354_-|transposase	transposase	transposase	NA	NA	NA	NA
AZA28705.1|203417_204176_-	DeoR/GlpR family transcriptional regulator	NA	NA	NA	NA	NA
AZA28706.1|204210_205047_-|protease	rhomboid family intramembrane serine protease GlpG	protease	NA	NA	NA	NA
AZA28707.1|205064_205394_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
AZA28708.1|205768_208480_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AZA28709.1|208797_211203_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	39.1	4.0e-13
AZA28710.1|211215_213312_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
AZA28711.1|213496_214072_-	Fe-S biogenesis protein NfuA	NA	NA	NA	NA	NA
AZA28712.1|214131_214833_-	DNA utilization protein GntX	NA	NA	NA	NA	NA
AZA28713.1|214919_215696_+	pimeloyl-[acyl-carrier protein] methyl ester esterase	NA	NA	NA	NA	NA
AZA28714.1|215865_216135_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AZA28715.1|216272_216530_-	ferrous iron transporter C	NA	NA	NA	NA	NA
AZA28716.1|216565_218881_-	Fe(2+) transporter permease subunit FeoB	NA	NA	NA	NA	NA
AZA28717.1|218972_219200_-	ferrous iron transporter A	NA	NA	NA	NA	NA
AZA28718.1|219723_222099_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
AZA28719.1|222632_223148_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
AZA28720.1|223283_224003_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	2.7e-29
AZA28721.1|223999_225352_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	24.1	1.6e-11
AZA28722.1|225690_227310_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.0	1.6e-138
AZA28723.1|227506_228388_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
AZA28724.1|228550_228958_-	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
AZA28725.1|228986_229667_-	GMP/IMP nucleotidase	NA	NA	NA	NA	NA
AZA28726.1|229810_231958_-	intracellular growth attenuator family protein	NA	NA	NA	NA	NA
AZA28727.1|232544_233090_+	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
AZA28728.1|233210_233966_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	65.1	9.1e-97
AZA28729.1|234097_234535_-|tail	tail assembly chaperone	tail	B6SCW7	Bacteriophage	35.4	4.0e-12
AZA32368.1|235773_236325_-	DUF2313 domain-containing protein	NA	A0A0M3LQE1	Mannheimia_phage	34.8	4.0e-25
AZA28730.1|236339_237401_-|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	46.0	1.6e-75
AZA28731.1|237400_237751_-	hypothetical protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	62.6	1.7e-29
AZA28732.1|237805_238456_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	48.2	2.5e-50
AZA28733.1|238445_239669_-|tail	phage tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	36.0	2.8e-71
AZA32369.1|239652_240954_-	multidrug DMT transporter permease	NA	A0A2H4JGT4	uncultured_Caudovirales_phage	30.9	1.4e-41
AZA28734.1|240973_243181_-|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	41.8	3.5e-96
AZA28735.1|243618_243816_-	hypothetical protein	NA	NA	NA	NA	NA
AZA28736.1|243808_244309_-	DUF1804 family protein	NA	A0A0A1IX73	Pseudomonas_phage	59.0	1.3e-51
AZA28737.1|244311_244599_-	hypothetical protein	NA	NA	NA	NA	NA
AZA28738.1|244595_244838_-	hypothetical protein	NA	NA	NA	NA	NA
AZA32370.1|244834_245374_-	hypothetical protein	NA	A0A2D1GNR2	Pseudomonas_phage	44.3	1.5e-24
AZA28739.1|245399_245654_-	hypothetical protein	NA	A0A2D1GNW8	Pseudomonas_phage	47.6	1.8e-12
AZA32371.1|245644_246277_-	glycoside hydrolase family 19 protein	NA	F1C5D2	Cronobacter_phage	61.1	4.1e-66
AZA28740.1|246374_246644_-	hypothetical protein	NA	NA	NA	NA	NA
AZA28741.1|246655_247090_-	hypothetical protein	NA	A0A2D1GNW5	Pseudomonas_phage	50.7	3.8e-31
AZA28742.1|247089_247491_-	regulatory protein GemA	NA	A0A0A7DJY7	Pseudomonas_phage	42.7	2.3e-22
AZA32372.1|247475_247940_-	hypothetical protein	NA	NA	NA	NA	NA
AZA28743.1|247941_248334_-	hypothetical protein	NA	NA	NA	NA	NA
AZA28744.1|248326_248536_-	hypothetical protein	NA	NA	NA	NA	NA
AZA28745.1|248535_249078_-	hypothetical protein	NA	J9Q748	Salmonella_phage	52.9	5.6e-48
AZA28746.1|249067_249310_-	hypothetical protein	NA	NA	NA	NA	NA
AZA28747.1|249306_249528_-	hypothetical protein	NA	A0A2D1GNI2	Pseudomonas_phage	54.5	9.1e-13
AZA28748.1|249524_250025_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
AZA28749.1|250024_250723_-	DUF2786 domain-containing protein	NA	A0A2H4JCP9	uncultured_Caudovirales_phage	33.5	1.7e-17
AZA28750.1|250805_250997_-	hypothetical protein	NA	NA	NA	NA	NA
AZA28751.1|250998_251637_-	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	56.5	1.6e-62
AZA28752.1|251626_251827_-	hypothetical protein	NA	NA	NA	NA	NA
AZA28753.1|251833_252067_-	hypothetical protein	NA	A0A2D1GNI5	Pseudomonas_phage	55.3	1.5e-18
AZA28754.1|252085_252976_-	ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	52.1	5.9e-79
AZA32373.1|253018_255061_-|transposase	transposase	transposase	A0A2D1GNK9	Pseudomonas_phage	51.7	3.6e-188
AZA32374.1|255074_255317_-	transcriptional regulator	NA	M1PVU4	Vibrio_phage	59.4	1.1e-16
>prophage 2
CP032566	Yersinia pseudotuberculosis strain IP2666pIB1 chromosome, complete genome	4614856	516730	575746	4614856	protease,tail	uncultured_Mediterranean_phage(18.18%)	57	NA	NA
AZA28977.1|516730_518176_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AZA28978.1|518377_521236_-	RHS repeat protein	NA	NA	NA	NA	NA
AZA28979.1|521449_521809_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AZA28980.1|521805_522207_-	M15 family peptidase	NA	A0A249XWK9	Proteus_phage	61.0	3.6e-36
AZA28981.1|522219_522522_-	hypothetical protein	NA	NA	NA	NA	NA
AZA28982.1|522655_527125_-	toxin	NA	NA	NA	NA	NA
AZA28983.1|527181_530775_-|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
AZA28984.1|530815_533317_-	toxin	NA	NA	NA	NA	NA
AZA28985.1|533552_534419_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZA28986.1|534679_535591_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
AZA28987.1|535893_536097_+	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
AZA28988.1|536104_537040_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
AZA32388.1|537041_538997_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
AZA28989.1|539263_540733_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AZA32389.1|540942_541401_+	ribonuclease	NA	NA	NA	NA	NA
AZA28990.1|541405_541687_+	ribonuclease inhibitor	NA	NA	NA	NA	NA
AZA28991.1|541782_542331_-	ribosome-associated protein	NA	NA	NA	NA	NA
AZA28992.1|542511_543852_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
AZA28993.1|543981_544620_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	49.0	5.8e-52
AZA28994.1|544827_545214_+	soluble cytochrome b562 2	NA	NA	NA	NA	NA
AZA32390.1|545445_545856_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
AZA28995.1|546208_547870_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
AZA28996.1|547964_549380_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
AZA28997.1|549790_550744_-	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
AZA28998.1|550977_551454_-	hypothetical protein	NA	NA	NA	NA	NA
AZA28999.1|551752_552139_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
AZA29000.1|552276_552741_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AZA29001.1|552752_553688_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	38.9	3.9e-49
AZA32391.1|553878_554130_+	hypothetical protein	NA	NA	NA	NA	NA
AZA29002.1|554025_554298_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
AZA29003.1|554294_555149_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.0	3.2e-05
AZA29004.1|555173_555428_+	hypothetical protein	NA	NA	NA	NA	NA
AZA32392.1|555454_555937_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AZA29005.1|556055_556343_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
AZA29006.1|556366_557800_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
AZA29007.1|557861_558587_-	lipopolysaccharide ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.4e-22
AZA29008.1|558593_559139_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AZA29009.1|559122_559686_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AZA29010.1|559682_560246_-	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	83.0	9.6e-59
AZA32393.1|560795_561782_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	30.8	6.0e-40
AZA29011.1|561892_562867_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
AZA29012.1|563131_563950_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	2.2e-19
AZA29013.1|564167_564950_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
AZA29014.1|564954_565512_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
AZA29015.1|565524_566148_+	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
AZA29016.1|566183_566486_+	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
AZA29017.1|566623_566887_+	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
AZA29018.1|567040_568303_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AZA32394.1|568483_569572_-|protease	serine endoprotease DegS	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	31.8	2.1e-09
AZA29019.1|569661_571035_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.2	7.4e-20
AZA29020.1|571305_571710_-	DUF1043 family protein	NA	NA	NA	NA	NA
AZA29021.1|571933_573061_+	cell division protein ZapE	NA	NA	NA	NA	NA
AZA29022.1|573374_573803_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AZA29023.1|573817_574210_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
AZA29024.1|574206_574404_-	hypothetical protein	NA	NA	NA	NA	NA
AZA29025.1|574583_575225_+	stringent starvation protein A	NA	NA	NA	NA	NA
AZA29026.1|575230_575746_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.6	3.6e-28
>prophage 3
CP032566	Yersinia pseudotuberculosis strain IP2666pIB1 chromosome, complete genome	4614856	968329	1033637	4614856	terminase,tRNA,head,capsid,tail,protease,transposase	Cronobacter_phage(46.15%)	62	NA	NA
AZA29304.1|968329_968788_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.0	1.5e-09
AZA29305.1|968860_969052_+	hypothetical protein	NA	NA	NA	NA	NA
AZA29306.1|969041_969500_+|transposase	IS200/IS605 family transposase IS1541B	transposase	A0A1S5RHE3	Helicobacter_phage	33.0	1.5e-09
AZA29307.1|969813_970566_-|protease	metalloprotease	protease	NA	NA	NA	NA
AZA29308.1|971039_973034_+	transketolase	NA	NA	NA	NA	NA
AZA29309.1|973448_974465_+	D-erythrose-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AZA29310.1|974567_975731_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
AZA29311.1|975850_976930_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
AZA29312.1|976833_977043_-	hypothetical protein	NA	NA	NA	NA	NA
AZA29313.1|977367_978237_+	small-conductance mechanosensitive channel MscS	NA	NA	NA	NA	NA
AZA29314.1|978482_979100_+	arginine exporter ArgO	NA	NA	NA	NA	NA
AZA32421.1|979289_980069_+	oxidative stress defense protein	NA	NA	NA	NA	NA
AZA29315.1|980079_980988_-	LysR family transcriptional regulator ArgP	NA	NA	NA	NA	NA
AZA29316.1|981329_981986_+	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
AZA29317.1|982292_983534_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	46.5	2.1e-98
AZA29318.1|983798_984395_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
AZA29319.1|984758_985088_-	cell division protein ZapA	NA	NA	NA	NA	NA
AZA32422.1|985166_985286_+	AAA family ATPase	NA	NA	NA	NA	NA
AZA29320.1|985424_986003_+	YecA family protein	NA	NA	NA	NA	NA
AZA29321.1|986090_987404_+	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
AZA29322.1|987540_988719_+	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
AZA29323.1|988891_990112_+	FAD-dependent 2-octaprenylphenol hydroxylase	NA	NA	NA	NA	NA
AZA29324.1|990077_990317_+	hypothetical protein	NA	NA	NA	NA	NA
AZA29325.1|990832_991930_+	aminomethyltransferase	NA	NA	NA	NA	NA
AZA29326.1|991998_992385_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
AZA29327.1|992596_995476_+	glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.3	1.7e-268
AZA29328.1|995853_996291_+	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
AZA32423.1|997503_999501_+	hypothetical protein	NA	NA	NA	NA	NA
AZA29329.1|999562_1000708_+	hypothetical protein	NA	NA	NA	NA	NA
AZA29330.1|1000909_1001611_+	hemolysin III family protein	NA	NA	NA	NA	NA
AZA29331.1|1001902_1002400_+	DUF2165 family protein	NA	NA	NA	NA	NA
AZA29332.1|1002472_1003465_-|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
AZA29333.1|1003781_1004048_+	FAD assembly factor SdhE	NA	NA	NA	NA	NA
AZA29334.1|1004028_1004454_+	hypothetical protein	NA	NA	NA	NA	NA
AZA29335.1|1004453_1005152_+	two-component system response regulator CreB	NA	NA	NA	NA	NA
AZA29336.1|1005176_1006610_+	two-component system sensor histidine kinase CreC	NA	NA	NA	NA	NA
AZA29337.1|1006673_1008152_+	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
AZA29338.1|1008236_1008755_-	flavodoxin FldB	NA	NA	NA	NA	NA
AZA29339.1|1008861_1009761_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	29.7	8.5e-33
AZA29340.1|1009791_1010508_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AZA29341.1|1010514_1012248_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.8	1.2e-64
AZA29342.1|1012426_1013524_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	5.4e-05
AZA29343.1|1013534_1015052_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.0	1.1e-85
AZA29344.1|1015484_1016699_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	58.8	3.7e-132
AZA29345.1|1017201_1017390_+	hypothetical protein	NA	NA	NA	NA	NA
AZA29346.1|1017521_1019219_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	48.9	2.4e-129
AZA32424.1|1019215_1019761_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	51.1	8.5e-36
AZA29347.1|1019762_1020473_-	hypothetical protein	NA	Q94MX8	Haemophilus_virus	28.1	4.2e-11
AZA29348.1|1020469_1020988_-|tail	tail assembly chaperone	tail	A9DEL3	Yersinia_phage	50.6	8.3e-41
AZA29349.1|1020987_1022583_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	40.2	1.8e-54
AZA29350.1|1022592_1023216_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	57.9	1.2e-57
AZA29351.1|1023208_1024393_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	59.0	3.0e-134
AZA29352.1|1024389_1024719_-	DUF2590 family protein	NA	Q94MY3	Haemophilus_virus	60.4	4.6e-29
AZA29353.1|1025163_1026330_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	52.6	1.1e-101
AZA29354.1|1026326_1027028_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	43.8	3.3e-40
AZA29355.1|1026987_1027494_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	38.9	2.7e-20
AZA29356.1|1027490_1027943_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	52.7	2.8e-37
AZA29357.1|1028062_1028806_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	53.6	1.4e-65
AZA29358.1|1028823_1029996_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	46.7	2.0e-82
AZA29359.1|1030078_1031014_-|capsid	phage capsid protein	capsid	A5X9H4	Aeromonas_virus	54.3	3.5e-37
AZA29360.1|1031191_1033285_+|terminase	terminase	terminase	Q94MZ6	Haemophilus_virus	49.7	2.0e-170
AZA29361.1|1033271_1033637_+	hypothetical protein	NA	F1BUM7	Cronobacter_phage	67.6	9.3e-39
>prophage 4
CP032566	Yersinia pseudotuberculosis strain IP2666pIB1 chromosome, complete genome	4614856	1896046	1937243	4614856	protease,transposase,coat	Moraxella_phage(16.67%)	34	NA	NA
AZA30068.1|1896046_1897036_-|coat	spore coat protein U	coat	NA	NA	NA	NA
AZA30069.1|1897241_1899689_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AZA30070.1|1899791_1900544_-	molecular chaperone	NA	NA	NA	NA	NA
AZA30071.1|1900574_1901132_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
AZA30072.1|1901152_1901683_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
AZA30073.1|1901688_1902243_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
AZA30074.1|1902723_1905354_-	PqiB family protein	NA	NA	NA	NA	NA
AZA30075.1|1905322_1906675_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
AZA30076.1|1906801_1907299_+	GAF domain-containing protein	NA	NA	NA	NA	NA
AZA30077.1|1907394_1908108_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
AZA30078.1|1908127_1910206_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.8	4.0e-86
AZA30079.1|1910661_1911543_+|protease	protease HtpX	protease	NA	NA	NA	NA
AZA30080.1|1911478_1911667_-	hypothetical protein	NA	NA	NA	NA	NA
AZA30081.1|1912201_1912744_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AZA30082.1|1912879_1913659_+	molecular chaperone	NA	NA	NA	NA	NA
AZA30083.1|1913740_1916353_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AZA30084.1|1916349_1917513_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AZA30085.1|1917509_1918313_+	molecular chaperone	NA	NA	NA	NA	NA
AZA30086.1|1918366_1919734_-	MFS transporter	NA	NA	NA	NA	NA
AZA30087.1|1920100_1921267_+	oligogalacturonate lyase	NA	NA	NA	NA	NA
AZA30088.1|1921453_1922245_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
AZA30089.1|1922611_1923463_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	28.8	1.7e-11
AZA30090.1|1923676_1925074_-	L-cystine transporter	NA	NA	NA	NA	NA
AZA30091.1|1925271_1925820_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	32.9	4.0e-09
AZA30092.1|1926317_1927028_-	porin	NA	NA	NA	NA	NA
AZA30093.1|1927325_1928618_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA30094.1|1928633_1929761_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.5	1.6e-12
AZA30095.1|1929774_1930695_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
AZA30096.1|1930687_1931578_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AZA30097.1|1931618_1933286_-	pectate lyase	NA	NA	NA	NA	NA
AZA30098.1|1933630_1934392_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	3.1e-20
AZA30099.1|1934483_1935320_-	5-keto-4-deoxyuronate isomerase	NA	NA	NA	NA	NA
AZA30100.1|1935655_1935988_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AZA30101.1|1936034_1937243_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 5
CP032566	Yersinia pseudotuberculosis strain IP2666pIB1 chromosome, complete genome	4614856	2404686	2512462	4614856	lysis,head,holin,plate,capsid,tail,portal,transposase,integrase	Salmonella_phage(38.0%)	112	2478487:2478546	2512615:2512737
AZA30492.1|2404686_2405145_+|transposase	IS200/IS605 family transposase IS1541B	transposase	A0A1S5RHE3	Helicobacter_phage	33.0	1.5e-09
AZA30493.1|2405314_2406103_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	73.8	2.5e-89
AZA30494.1|2406162_2406441_-	hypothetical protein	NA	NA	NA	NA	NA
AZA30495.1|2406879_2407779_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZA30496.1|2408074_2408542_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
AZA30497.1|2408538_2409873_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
AZA30498.1|2409862_2411884_-	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
AZA30499.1|2411896_2414371_-	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
AZA30500.1|2415039_2416257_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
AZA30501.1|2416397_2417285_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
AZA32493.1|2417457_2417769_-	cytochrome c	NA	NA	NA	NA	NA
AZA30502.1|2417768_2418266_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
AZA30503.1|2418255_2418969_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.2	1.6e-18
AZA32494.1|2418972_2420121_-	ABC transporter permease	NA	NA	NA	NA	NA
AZA30504.1|2420143_2421436_-	ABC transporter permease	NA	NA	NA	NA	NA
AZA30505.1|2421438_2422848_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
AZA30506.1|2423132_2423660_-	iron transporter	NA	NA	NA	NA	NA
AZA30507.1|2423863_2425783_-	FTR1 family iron permease	NA	NA	NA	NA	NA
AZA30508.1|2426382_2428023_-	MFS transporter	NA	NA	NA	NA	NA
AZA30509.1|2428133_2429141_-	glutaminase	NA	NA	NA	NA	NA
AZA30510.1|2429592_2429799_-	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
AZA30511.1|2430351_2431122_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	64.7	3.1e-84
AZA32495.1|2431889_2433416_+	L-asparagine permease	NA	NA	NA	NA	NA
AZA30512.1|2435151_2435751_+	NADH:ubiquinone reductase (Na(+)-transporting) subunit E	NA	NA	NA	NA	NA
AZA30513.1|2436055_2437000_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZA30514.1|2437111_2437981_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZA30515.1|2439495_2440056_+	hypothetical protein	NA	NA	NA	NA	NA
AZA30516.1|2440080_2440554_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
AZA30517.1|2440628_2441507_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZA30518.1|2441601_2442444_+	CoA ester lyase	NA	NA	NA	NA	NA
AZA30519.1|2442493_2443036_+	MaoC family dehydratase	NA	NA	NA	NA	NA
AZA30520.1|2443058_2444381_+	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
AZA30521.1|2445207_2445840_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	32.3	2.7e-09
AZA30522.1|2445814_2449816_+	response regulator	NA	A0A1V0SGX0	Hokovirus	29.6	1.4e-39
AZA30523.1|2450197_2450728_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AZA30524.1|2450820_2451552_+	molecular chaperone	NA	NA	NA	NA	NA
AZA30525.1|2451600_2454192_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AZA30526.1|2454207_2455557_+	hypothetical protein	NA	NA	NA	NA	NA
AZA30527.1|2455553_2456294_+	molecular chaperone	NA	NA	NA	NA	NA
AZA30528.1|2456981_2458124_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	30.4	1.1e-21
AZA30529.1|2458148_2458976_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
AZA30530.1|2458968_2459829_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AZA30531.1|2459895_2461164_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA30532.1|2461193_2462207_-	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AZA30533.1|2462714_2462834_+	transcriptional regulator	NA	NA	NA	NA	NA
AZA30534.1|2462870_2463668_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZA30535.1|2463854_2463959_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AZA30536.1|2464636_2465071_+	hypothetical protein	NA	NA	NA	NA	NA
AZA30537.1|2465082_2465652_+	hypothetical protein	NA	NA	NA	NA	NA
AZA30538.1|2467315_2468392_-	TIR domain-containing protein	NA	NA	NA	NA	NA
AZA30539.1|2468457_2468748_-	antitoxin	NA	K4NZP3	Burkholderia_phage	39.4	1.8e-05
AZA30540.1|2468749_2469001_-	BrnT family toxin	NA	NA	NA	NA	NA
AZA30541.1|2469031_2469391_+|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	62.5	8.9e-18
AZA30542.1|2469387_2469687_+	lysozyme	NA	A0A218M4K8	Erwinia_phage	64.9	2.6e-23
AZA30543.1|2469703_2469991_+	hypothetical protein	NA	NA	NA	NA	NA
AZA32496.1|2470502_2470946_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
AZA32497.1|2470950_2471205_+	hypothetical protein	NA	NA	NA	NA	NA
AZA30544.1|2471369_2472539_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	79.2	5.6e-178
AZA30545.1|2472550_2473066_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	66.9	8.5e-62
AZA30546.1|2473119_2473467_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	51.6	8.6e-18
AZA32498.1|2473481_2473601_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AZA30547.1|2473593_2476509_+|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	52.3	7.5e-155
AZA30548.1|2476520_2476985_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	56.2	7.2e-44
AZA30549.1|2476981_2478076_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	65.2	2.1e-126
AZA30550.1|2478150_2478366_+	late control protein B	NA	S4TNZ3	Salmonella_phage	60.6	1.1e-18
2478487:2478546	attL	ACAAAAAAACCGCCTCTCGGCGGTTAACGACATACTCGTACTACTTTGTTTTACTTAGAA	NA	NA	NA	NA
AZA30551.1|2478716_2479724_-|integrase	integrase	integrase	P79671	Haemophilus_phage	59.3	3.4e-107
AZA30552.1|2479731_2480244_-	hypothetical protein	NA	NA	NA	NA	NA
AZA30553.1|2480305_2480944_-	hypothetical protein	NA	NA	NA	NA	NA
AZA30554.1|2480961_2481354_-	transcriptional regulator	NA	A4JWN8	Burkholderia_virus	47.2	3.2e-21
AZA30555.1|2481432_2481624_+	hypothetical protein	NA	NA	NA	NA	NA
AZA30556.1|2481636_2481840_+	DNA-binding protein	NA	U3PFJ1	Vibrio_phage	41.1	9.8e-06
AZA30557.1|2481851_2482058_+	hypothetical protein	NA	NA	NA	NA	NA
AZA30558.1|2482054_2482369_+	hypothetical protein	NA	NA	NA	NA	NA
AZA30559.1|2482510_2482771_+	hypothetical protein	NA	NA	NA	NA	NA
AZA30560.1|2482801_2483107_+	hypothetical protein	NA	NA	NA	NA	NA
AZA30561.1|2483189_2483951_+	hypothetical protein	NA	K7ZRM8	Xanthomonas_citri_phage	49.3	1.9e-09
AZA30562.1|2484007_2484661_+	3'-5' exonuclease	NA	A0A1D9C9N8	Salinivibrio_phage	61.2	1.5e-55
AZA30563.1|2484657_2485476_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L011	Salmonella_phage	55.9	1.1e-76
AZA30564.1|2485472_2486336_+	DNA cytosine methyltransferase	NA	W0LM09	Edwardsiella_phage	59.7	8.0e-105
AZA30565.1|2486332_2488888_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	37.4	3.8e-126
AZA30566.1|2488868_2489099_+	hypothetical protein	NA	NA	NA	NA	NA
AZA30567.1|2489095_2489440_+	hypothetical protein	NA	NA	NA	NA	NA
AZA30568.1|2490122_2491154_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	65.8	3.5e-131
AZA30569.1|2491150_2491876_-	hypothetical protein	NA	F1BUR2	Erwinia_phage	31.8	2.1e-26
AZA30570.1|2491875_2493639_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	63.6	3.1e-228
AZA30571.1|2493809_2494625_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	71.1	9.6e-76
AZA30572.1|2494661_2495717_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	63.0	8.5e-125
AZA30573.1|2495723_2496377_+	hypothetical protein	NA	F1BUQ7	Erwinia_phage	46.8	1.7e-43
AZA30574.1|2496610_2497102_+|head	head completion/stabilization protein	head	A0A1S5NNA6	Burkholderia_phage	48.4	7.9e-33
AZA30575.1|2497101_2497305_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	70.1	1.8e-23
AZA30576.1|2497334_2497721_+|holin	holin	holin	NA	NA	NA	NA
AZA30577.1|2497707_2498103_+	M15 family peptidase	NA	A9DET4	Yersinia_phage	71.0	1.2e-47
AZA30578.1|2498107_2498530_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	48.6	4.9e-23
AZA30579.1|2498417_2498642_+	hypothetical protein	NA	NA	NA	NA	NA
AZA30580.1|2498628_2499096_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	57.2	1.8e-42
AZA30581.1|2499092_2499539_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	51.4	3.4e-35
AZA30582.1|2499557_2499809_-	hypothetical protein	NA	NA	NA	NA	NA
AZA30583.1|2499870_2500572_+	hypothetical protein	NA	NA	NA	NA	NA
AZA30584.1|2500839_2501538_+|plate	phage baseplate assembly protein V	plate	O80314	Escherichia_phage	62.0	5.0e-65
AZA30585.1|2501534_2501888_+|plate	baseplate assembly protein	plate	A0A218M4K8	Erwinia_phage	59.3	2.4e-31
AZA30586.1|2501890_2502799_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	73.2	1.3e-118
AZA30587.1|2502791_2503400_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	75.0	1.7e-85
AZA30588.1|2503396_2504836_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	77.8	3.8e-75
AZA30589.1|2504846_2505326_+|tail	phage tail protein	tail	F1BUP0	Erwinia_phage	41.9	2.0e-28
AZA30590.1|2505459_2506635_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	79.3	3.9e-179
AZA30591.1|2506646_2507162_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	67.4	2.9e-62
AZA30592.1|2507215_2507563_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	51.6	8.6e-18
AZA32499.1|2507577_2507697_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AZA30593.1|2507689_2510605_+|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	52.3	1.5e-155
AZA30594.1|2510616_2511081_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	56.2	7.2e-44
AZA30595.1|2511077_2512172_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	66.0	1.2e-126
AZA30596.1|2512246_2512462_+	late control protein B	NA	S4TNZ3	Salmonella_phage	62.0	4.8e-19
2512615:2512737	attR	ACAAAAAAACCGCCTCTCGGCGGTTAACGACATACTCGTACTACTTTGTTTTACTTAGAATATTTTCCATGGTGCCCGGGGCGGGACTTGAACCCGCACAGCCATAAGCCGAGGGATTTTAAA	NA	NA	NA	NA
>prophage 6
CP032566	Yersinia pseudotuberculosis strain IP2666pIB1 chromosome, complete genome	4614856	3022394	3030650	4614856	plate,coat,tail	Shigella_phage(33.33%)	9	NA	NA
AZA31021.1|3022394_3022814_-|tail	phage tail protein	tail	F1BUK2	Cronobacter_phage	33.9	1.4e-06
AZA31022.1|3022815_3023532_-|tail	phage tail protein	tail	NA	NA	NA	NA
AZA31023.1|3023628_3024231_-	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	38.6	2.0e-33
AZA31024.1|3024227_3025364_-|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.5	3.5e-31
AZA31025.1|3025367_3025823_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	43.8	4.3e-17
AZA31026.1|3025819_3026416_-|plate	baseplate assembly protein	plate	NA	NA	NA	NA
AZA31027.1|3026431_3027487_-|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	27.2	1.3e-37
AZA31028.1|3027483_3028890_-	hypothetical protein	NA	Q8SBG8	Shigella_phage	33.7	2.1e-17
AZA31029.1|3029156_3030650_-|coat	coat protein	coat	NA	NA	NA	NA
>prophage 7
CP032566	Yersinia pseudotuberculosis strain IP2666pIB1 chromosome, complete genome	4614856	3297993	3393758	4614856	tRNA,tail,plate,capsid,protease,transposase,integrase	Enterobacteria_phage(20.59%)	101	3320181:3320218	3370833:3370870
AZA31254.1|3297993_3299202_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
AZA31255.1|3299349_3300222_-	23S rRNA pseudouridine(2604) synthase RluF	NA	NA	NA	NA	NA
AZA31256.1|3300621_3302829_+	DUF4401 domain-containing protein	NA	NA	NA	NA	NA
AZA31257.1|3302821_3303352_+	hypothetical protein	NA	NA	NA	NA	NA
AZA31258.1|3303507_3305889_+	glycosyl hydrolase	NA	NA	NA	NA	NA
AZA31259.1|3305967_3307596_-	hypothetical protein	NA	NA	NA	NA	NA
AZA31260.1|3308068_3308920_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.1	5.5e-50
AZA31261.1|3308945_3309935_+	aldo/keto reductase	NA	NA	NA	NA	NA
AZA31262.1|3309989_3310883_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZA31263.1|3311185_3311491_-	hypothetical protein	NA	NA	NA	NA	NA
AZA32528.1|3311587_3311959_-	hypothetical protein	NA	NA	NA	NA	NA
AZA31264.1|3311970_3313290_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AZA31265.1|3313282_3315046_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
AZA31266.1|3315042_3315675_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AZA31267.1|3315684_3316614_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AZA31268.1|3316606_3317209_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
AZA32529.1|3317241_3317379_-	type VI secretion protein	NA	NA	NA	NA	NA
AZA31269.1|3317608_3317815_-	hypothetical protein	NA	NA	NA	NA	NA
AZA31270.1|3318026_3318305_+	hypothetical protein	NA	A0A192Y6Q1	Salmonella_phage	73.8	8.4e-32
AZA31271.1|3318387_3318726_+	hypothetical protein	NA	NA	NA	NA	NA
AZA31272.1|3318710_3319358_+	hypothetical protein	NA	NA	NA	NA	NA
AZA31273.1|3319471_3319672_+	hypothetical protein	NA	NA	NA	NA	NA
AZA31274.1|3319930_3320113_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
3320181:3320218	attL	CCCTACAGGGCTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AZA32530.1|3320372_3320741_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	32.0	9.5e-07
AZA31275.1|3322220_3323219_-	hypothetical protein	NA	NA	NA	NA	NA
AZA31276.1|3324880_3325114_-	hypothetical protein	NA	I6PDJ9	Cronobacter_phage	40.0	5.6e-05
AZA31277.1|3325193_3325826_-	hypothetical protein	NA	NA	NA	NA	NA
AZA31278.1|3326086_3326797_-	peptidase P60	NA	K7P6F5	Enterobacteria_phage	77.3	8.8e-110
AZA31279.1|3326799_3327552_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	67.7	9.4e-102
AZA31280.1|3327568_3327910_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	50.4	3.1e-28
AZA31281.1|3327912_3328119_-	hypothetical protein	NA	K7PLQ6	Enterobacteria_phage	74.4	2.5e-09
AZA31282.1|3328223_3328946_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	55.5	2.3e-65
AZA31283.1|3329082_3329505_+	hypothetical protein	NA	NA	NA	NA	NA
AZA31284.1|3329617_3330316_+	hypothetical protein	NA	NA	NA	NA	NA
AZA31285.1|3330312_3330894_+	VapC toxin family PIN domain ribonuclease	NA	NA	NA	NA	NA
AZA31286.1|3330962_3331277_-	DUF2767 family protein	NA	NA	NA	NA	NA
AZA31287.1|3331591_3332212_+	hypothetical protein	NA	A0A248SL35	Klebsiella_phage	34.5	6.9e-18
AZA31288.1|3332285_3332528_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	70.1	2.5e-24
AZA31289.1|3332541_3332787_+	DinI family protein	NA	K7PLW4	Enterobacteria_phage	45.0	1.5e-11
AZA31290.1|3333173_3333611_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	34.7	6.8e-12
AZA31291.1|3333620_3334712_-|tail	phage tail protein	tail	Q76YB0	Aeromonas_virus	38.6	4.8e-06
AZA31292.1|3334762_3335359_-	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	38.3	1.1e-33
AZA31293.1|3335355_3336492_-|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	31.7	3.7e-33
AZA31294.1|3336495_3336933_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	46.2	2.3e-20
AZA31295.1|3336929_3337523_-|plate	baseplate assembly protein	plate	NA	NA	NA	NA
AZA31296.1|3337522_3338593_-|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	30.9	3.1e-42
AZA31297.1|3338589_3339996_-	hypothetical protein	NA	A0A192Y5U9	Salmonella_phage	27.7	2.3e-24
AZA31298.1|3340072_3340603_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	59.8	4.2e-24
AZA31299.1|3340706_3342653_-	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	24.0	2.3e-14
AZA31300.1|3342775_3343075_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AZA31301.1|3343076_3343451_-|tail	phage tail protein	tail	NA	NA	NA	NA
AZA31302.1|3343463_3344897_-	hypothetical protein	NA	B5TK67	Pseudomonas_phage	47.4	4.3e-71
AZA31303.1|3344893_3345238_-	hypothetical protein	NA	NA	NA	NA	NA
AZA31304.1|3345237_3345630_-	hypothetical protein	NA	NA	NA	NA	NA
AZA31305.1|3345631_3346678_-|capsid	major capsid protein	capsid	A0A059WRQ2	Vibrio_phage	31.4	2.6e-41
AZA32531.1|3346787_3347198_-	hypothetical protein	NA	K7PH49	Enterobacterial_phage	47.0	2.4e-11
AZA31306.1|3347452_3347698_+	hypothetical protein	NA	NA	NA	NA	NA
AZA31307.1|3347868_3349023_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	70.7	3.6e-161
AZA31308.1|3349226_3350075_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AZA31309.1|3350741_3351125_-	toxin CbtA	NA	NA	NA	NA	NA
AZA31310.1|3351188_3351518_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AZA31311.1|3351530_3352001_-	DNA repair protein RadC	NA	NA	NA	NA	NA
AZA31312.1|3352071_3352893_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.4	4.0e-45
AZA31313.1|3352981_3353320_-	hypothetical protein	NA	NA	NA	NA	NA
AZA31314.1|3353340_3353805_-	hypothetical protein	NA	NA	NA	NA	NA
AZA31315.1|3353817_3353916_-	hypothetical protein	NA	NA	NA	NA	NA
AZA31316.1|3354305_3355193_-	GTP-binding protein HSR1	NA	NA	NA	NA	NA
AZA31317.1|3355284_3356658_-	hypothetical protein	NA	NA	NA	NA	NA
AZA31318.1|3357221_3357809_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AZA31319.1|3357906_3358113_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AZA31320.1|3358683_3359379_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
AZA31321.1|3359701_3360448_+	HNH endonuclease	NA	NA	NA	NA	NA
AZA31322.1|3360530_3362579_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AZA31323.1|3362589_3364512_+	hypothetical protein	NA	NA	NA	NA	NA
AZA31324.1|3364776_3365106_+	hypothetical protein	NA	NA	NA	NA	NA
AZA31325.1|3365105_3368378_+	hypothetical protein	NA	NA	NA	NA	NA
AZA31326.1|3369194_3369380_-	recombinase	NA	Q7M297	Enterobacteria_phage	57.1	2.8e-07
AZA31327.1|3369421_3370630_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	57.5	6.1e-135
AZA31328.1|3371117_3371984_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	34.1	2.2e-30
3370833:3370870	attR	CCCTACAGGGCTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AZA31329.1|3371998_3372211_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
AZA31330.1|3372432_3373818_-|tRNA	cysteine--tRNA ligase	tRNA	A0A0G2Y344	Acanthamoeba_polyphaga_mimivirus	28.9	2.6e-41
AZA31331.1|3374028_3374523_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
AZA31332.1|3374533_3375256_+	UDP-2,3-diacylglucosamine hydrolase	NA	NA	NA	NA	NA
AZA31333.1|3375342_3375552_-	hypothetical protein	NA	NA	NA	NA	NA
AZA31334.1|3375571_3376096_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
AZA31335.1|3376092_3377157_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AZA31336.1|3377200_3379630_-	ABC transporter permease	NA	NA	NA	NA	NA
AZA31337.1|3379626_3380313_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	2.1e-31
AZA32532.1|3380280_3380919_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
AZA31338.1|3381305_3382082_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AZA31339.1|3382158_3383028_+	co-chaperone YbbN	NA	NA	NA	NA	NA
AZA31340.1|3383222_3384137_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
AZA31341.1|3384139_3384589_+	NfeD family protein	NA	NA	NA	NA	NA
AZA31342.1|3384768_3385188_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AZA31343.1|3385394_3388280_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	36.8	7.8e-112
AZA31344.1|3388552_3389362_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
AZA31345.1|3389625_3390105_+|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
AZA31346.1|3390396_3390681_+	hypothetical protein	NA	NA	NA	NA	NA
AZA31347.1|3390784_3391408_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
AZA31348.1|3391401_3392439_-	hypothetical protein	NA	NA	NA	NA	NA
AZA31349.1|3393299_3393758_+|transposase	IS200/IS605 family transposase IS1541B	transposase	A0A1S5RHE3	Helicobacter_phage	33.0	1.5e-09
>prophage 8
CP032566	Yersinia pseudotuberculosis strain IP2666pIB1 chromosome, complete genome	4614856	3399375	3406839	4614856		Bacillus_phage(16.67%)	6	NA	NA
AZA31353.1|3399375_3400749_-	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	29.1	2.8e-35
AZA31354.1|3401052_3402012_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2D2W2D2	Stenotrophomonas_phage	29.3	4.7e-05
AZA31355.1|3402359_3403109_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	36.0	1.8e-07
AZA31356.1|3403143_3404538_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.7	2.6e-52
AZA31357.1|3404746_3405712_-	GDP-L-fucose synthase	NA	M1HWW2	Paramecium_bursaria_Chlorella_virus	47.9	2.1e-82
AZA31358.1|3405717_3406839_-	GDP-mannose 4,6-dehydratase	NA	M1HVG7	Acanthocystis_turfacea_Chlorella_virus	64.4	5.8e-132
