The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033933	Chryseobacterium haifense strain G0079 chromosome, complete genome	2764180	107206	135106	2764180	integrase,transposase	Leptospira_phage(50.0%)	25	125070:125085	135329:135344
AZB20753.1|107206_108472_-|integrase	site-specific integrase	integrase	S0A3I4	Cellulophaga_phage	29.4	2.6e-19
AZB20754.1|108487_108913_-	hypothetical protein	NA	NA	NA	NA	NA
AZB20755.1|108909_109176_-	hypothetical protein	NA	NA	NA	NA	NA
AZB20756.1|109178_109628_-	hypothetical protein	NA	NA	NA	NA	NA
AZB20757.1|109761_110046_+	DUF3853 family protein	NA	NA	NA	NA	NA
AZB20758.1|110045_110297_+	DUF3853 family protein	NA	NA	NA	NA	NA
AZB20759.1|110299_111010_+	hypothetical protein	NA	NA	NA	NA	NA
AZB20760.1|111069_111294_+	hypothetical protein	NA	NA	NA	NA	NA
AZB20761.1|111344_112469_+	hypothetical protein	NA	NA	NA	NA	NA
AZB20762.1|112523_112769_+	hypothetical protein	NA	NA	NA	NA	NA
AZB20763.1|112884_113724_+	DNA primase	NA	NA	NA	NA	NA
AZB20764.1|115097_116183_-	hypothetical protein	NA	NA	NA	NA	NA
AZB20765.1|116648_117602_+|integrase	integrase	integrase	S5W9T9	Leptospira_phage	31.4	3.2e-30
AZB20766.1|117585_118704_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AZB20767.1|118956_120072_-	hypothetical protein	NA	NA	NA	NA	NA
AZB20768.1|122167_123070_-	hypothetical protein	NA	NA	NA	NA	NA
AZB20769.1|123167_123383_+	hypothetical protein	NA	NA	NA	NA	NA
AZB20770.1|123582_124593_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
125070:125085	attL	AAAGCTTAGTTATTAT	NA	NA	NA	NA
AZB20771.1|125094_125862_-	hypothetical protein	NA	NA	NA	NA	NA
AZB20772.1|126560_127160_-	hypothetical protein	NA	NA	NA	NA	NA
AZB20773.1|128287_129103_-	carboxypeptidase-like regulatory domain-containing protein	NA	NA	NA	NA	NA
AZB20774.1|129154_130513_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	38.0	9.4e-76
AZB20775.1|131974_132703_-	DUF4184 family protein	NA	NA	NA	NA	NA
AZB20776.1|133062_134016_+|integrase	integrase	integrase	S5W9T9	Leptospira_phage	32.8	5.8e-32
AZB20777.1|133999_135106_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
135329:135344	attR	AAAGCTTAGTTATTAT	NA	NA	NA	NA
>prophage 2
CP033933	Chryseobacterium haifense strain G0079 chromosome, complete genome	2764180	991757	1018610	2764180	integrase,transposase	Leptospira_phage(40.0%)	19	1007651:1007674	1018810:1018833
AZB22989.1|991757_992891_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AZB21499.1|993140_993539_-	hypothetical protein	NA	NA	NA	NA	NA
AZB21500.1|993704_994094_-	hypothetical protein	NA	NA	NA	NA	NA
AZB21501.1|994156_995695_-	hypothetical protein	NA	NA	NA	NA	NA
AZB21502.1|996230_997784_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
AZB21503.1|998043_999000_+|integrase	integrase	integrase	S5W9T9	Leptospira_phage	31.7	1.7e-31
AZB21504.1|1000338_1000638_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AZB21505.1|1000634_1000886_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
AZB21506.1|1002055_1003723_-	abortive phage infection protein	NA	D0UIM0	Aggregatibacter_phage	38.6	2.2e-111
AZB22990.1|1005590_1006460_-	hypothetical protein	NA	NA	NA	NA	NA
AZB21507.1|1006494_1006692_+	hypothetical protein	NA	NA	NA	NA	NA
1007651:1007674	attL	TTTCTTGTCTTGCAGACAAAACGA	NA	NA	NA	NA
AZB21508.1|1007729_1008791_-	class C beta-lactamase-related serine hydrolase	NA	NA	NA	NA	NA
AZB22991.1|1009079_1010030_-	YncE family protein	NA	NA	NA	NA	NA
AZB21509.1|1010074_1011034_-	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
AZB21510.1|1011111_1012005_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	22.1	1.1e-05
AZB21511.1|1012376_1013930_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
AZB21512.1|1015006_1016236_-	metallophosphoesterase	NA	A0A1V0SFZ7	Hokovirus	25.7	1.6e-10
AZB21513.1|1016563_1017520_+|integrase	integrase	integrase	S5W9T9	Leptospira_phage	31.1	1.7e-31
AZB21514.1|1017503_1018610_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
1018810:1018833	attR	TTTCTTGTCTTGCAGACAAAACGA	NA	NA	NA	NA
>prophage 3
CP033933	Chryseobacterium haifense strain G0079 chromosome, complete genome	2764180	1344862	1351688	2764180		Enterobacteria_phage(33.33%)	8	NA	NA
AZB21748.1|1344862_1345408_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	48.4	4.2e-43
AZB21749.1|1345683_1346046_+	four helix bundle protein	NA	NA	NA	NA	NA
AZB21750.1|1346148_1347240_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.5	2.2e-83
AZB21751.1|1347257_1347638_+	GxxExxY protein	NA	A0A0P0YNF4	Yellowstone_lake_phycodnavirus	32.3	3.7e-06
AZB21752.1|1347690_1348548_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	60.7	1.6e-97
AZB21753.1|1348662_1349964_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
AZB21754.1|1350488_1350860_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	54.8	4.9e-19
AZB21755.1|1350926_1351688_-	exodeoxyribonuclease III	NA	A0A0N9QXX6	Chrysochromulina_ericina_virus	37.6	4.8e-37
>prophage 4
CP033933	Chryseobacterium haifense strain G0079 chromosome, complete genome	2764180	1781343	1821112	2764180	protease,integrase,transposase	Acidithiobacillus_phage(25.0%)	45	1790374:1790389	1828447:1828462
AZB22106.1|1781343_1782897_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	35.1	5.9e-82
AZB22107.1|1783182_1783974_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZB22108.1|1783983_1784544_-	hypothetical protein	NA	NA	NA	NA	NA
AZB22109.1|1784680_1785373_-	hypothetical protein	NA	NA	NA	NA	NA
AZB22110.1|1785372_1786299_-	thioredoxin family protein	NA	NA	NA	NA	NA
AZB22111.1|1787114_1787501_-	hypothetical protein	NA	NA	NA	NA	NA
AZB22112.1|1787560_1788193_-	hypothetical protein	NA	NA	NA	NA	NA
AZB22113.1|1788361_1788547_-	hypothetical protein	NA	NA	NA	NA	NA
AZB22114.1|1788641_1789190_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
AZB22115.1|1789194_1789641_-	DUF417 family protein	NA	NA	NA	NA	NA
AZB22116.1|1789739_1790132_-	DUF302 domain-containing protein	NA	NA	NA	NA	NA
AZB22117.1|1790128_1790428_-	hypothetical protein	NA	NA	NA	NA	NA
1790374:1790389	attL	ATGTTTTTATTGCCGA	NA	NA	NA	NA
AZB22118.1|1790587_1790989_-	hypothetical protein	NA	NA	NA	NA	NA
AZB22119.1|1790985_1791474_-	hypothetical protein	NA	NA	NA	NA	NA
AZB22120.1|1791473_1792481_-	hypothetical protein	NA	NA	NA	NA	NA
AZB22121.1|1792486_1793389_-	pyridoxamine 5-phosphate oxidase	NA	NA	NA	NA	NA
AZB22122.1|1793393_1794242_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
AZB22123.1|1794238_1794655_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
AZB22124.1|1794664_1795489_-	hypothetical protein	NA	NA	NA	NA	NA
AZB22125.1|1795558_1796050_-	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AZB22126.1|1796176_1797541_-	mercuric reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	33.3	5.4e-63
AZB22127.1|1797554_1798997_-	hypothetical protein	NA	NA	NA	NA	NA
AZB22128.1|1799091_1799553_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AZB22129.1|1799572_1800796_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
AZB22130.1|1800805_1801261_-	DUF2007 domain-containing protein	NA	NA	NA	NA	NA
AZB22131.1|1801267_1802425_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
AZB22132.1|1802534_1803137_-	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
AZB22133.1|1803129_1803750_-	hypothetical protein	NA	NA	NA	NA	NA
AZB22134.1|1803766_1804051_-	DUF427 domain-containing protein	NA	NA	NA	NA	NA
AZB22135.1|1804050_1804497_-	hypothetical protein	NA	NA	NA	NA	NA
AZB22136.1|1804513_1805236_-	hypothetical protein	NA	NA	NA	NA	NA
AZB22137.1|1805239_1805533_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AZB22138.1|1805557_1806529_-	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AZB22139.1|1806539_1806815_-	hypothetical protein	NA	NA	NA	NA	NA
AZB22140.1|1806827_1807280_-	hypothetical protein	NA	NA	NA	NA	NA
AZB22141.1|1807837_1809037_-	DUF2813 domain-containing protein	NA	NA	NA	NA	NA
AZB22142.1|1809550_1810570_+	hypothetical protein	NA	NA	NA	NA	NA
AZB22143.1|1810572_1815732_+|protease	serine protease	protease	NA	NA	NA	NA
AZB22144.1|1815724_1815955_+	hypothetical protein	NA	NA	NA	NA	NA
AZB22145.1|1815971_1816202_+	hypothetical protein	NA	NA	NA	NA	NA
AZB22146.1|1816573_1817518_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
AZB22147.1|1817537_1817900_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AZB22148.1|1818135_1819404_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	34.3	2.6e-35
AZB22149.1|1819704_1819887_+	hypothetical protein	NA	NA	NA	NA	NA
AZB22150.1|1820155_1821112_+|integrase	integrase	integrase	S5W9T9	Leptospira_phage	31.1	1.7e-31
1828447:1828462	attR	TCGGCAATAAAAACAT	NA	NA	NA	NA
