The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034067	Shigella sonnei strain FDAARGOS_524 chromosome, complete genome	4828074	214131	302630	4828074	integrase,head,tail,terminase,transposase	Salmonella_phage(12.82%)	84	253367:253426	293888:293902
AZG53320.1|214131_215460_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
AZG53321.1|217504_218182_+	Fe2+-dependent dioxygenase	NA	Q5GQB0	Synechococcus_phage	29.7	5.8e-18
AZG53322.1|218255_218522_+	DksA/TraR family C4-type zinc finger protein	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
AZG53323.1|218786_219047_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AZG53324.1|219275_220361_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
AZG53325.1|220501_221464_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
AZG57101.1|221491_223642_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	6.3e-42
AZG53326.1|223761_224244_+	NADAR family protein	NA	A0A0H3TLU0	Faustovirus	52.0	1.7e-35
AZG53327.1|224475_225840_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	1.9e-52
AZG57102.1|226068_226740_+	transcriptional regulator	NA	NA	NA	NA	NA
AZG53328.1|226742_227738_+	secretion protein HlyD	NA	NA	NA	NA	NA
AZG53329.1|227730_229467_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	1.8e-18
AZG53330.1|229459_230593_+	inner membrane transport permease YbhS	NA	NA	NA	NA	NA
AZG53331.1|230603_231710_+	inner membrane transport permease YbhR	NA	NA	NA	NA	NA
AZG53332.1|231671_232082_-	hypothetical protein	NA	NA	NA	NA	NA
AZG53333.1|232214_232976_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
AZG53334.1|232972_234214_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
AZG53335.1|235907_236612_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
AZG53336.1|236748_237201_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
AZG53337.1|237202_237448_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
AZG53338.1|237440_237926_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
AZG53339.1|237928_238441_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
AZG53340.1|238462_239452_-	cyclic pyranopterin monophosphate synthase	NA	NA	NA	NA	NA
AZG53341.1|239848_240757_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
AZG53342.1|240948_242970_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AZG53343.1|243548_244226_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
AZG53344.1|244218_244974_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
AZG53345.1|244960_246115_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
AZG53346.1|246111_247152_-	biotin synthase	NA	NA	NA	NA	NA
AZG53347.1|247238_248528_+	adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
AZG53348.1|248586_249063_+	kinase inhibitor	NA	NA	NA	NA	NA
AZG53349.1|249644_251408_+	invasion plasmid antigen	NA	NA	NA	NA	NA
AZG53350.1|251408_251588_-	hypothetical protein	NA	NA	NA	NA	NA
AZG53351.1|251587_252211_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	76.5	5.4e-79
AZG53352.1|252161_253415_-|tail	phage tail protein	tail	Q8W611	Enterobacteria_phage	40.2	1.3e-63
253367:253426	attL	TGAGGTAGCCTGAGTTTAACGGACACTCCTTCCTGAAATAGAATGGCATCAGAAGGAGCT	NA	NA	NA	NA
AZG53353.1|253430_254586_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
253367:253426	attL	TGAGGTAGCCTGAGTTTAACGGACACTCCTTCCTGAAATAGAATGGCATCAGAAGGAGCT	NA	NA	NA	NA
AZG53354.1|254656_255427_+|integrase	integrase	integrase	K7P6P6	Enterobacteria_phage	99.2	5.8e-139
AZG53355.1|255561_256845_+	putative acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
AZG53356.1|257078_259259_-	hydratase	NA	NA	NA	NA	NA
AZG53357.1|260213_261167_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZG53358.1|261207_262203_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
AZG53359.1|262462_262594_-	DNA invertase	NA	A0A0C4UR34	Shigella_phage	84.4	8.8e-08
AZG53360.1|263393_263900_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	79.9	3.7e-70
AZG53361.1|263903_265124_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	86.1	4.5e-194
AZG53362.1|265127_265871_-|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	84.4	5.3e-89
AZG53363.1|267227_268631_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	1.2e-187
AZG53364.1|268581_269346_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	53.8	5.9e-11
AZG53365.1|269543_270053_+	DedA family protein	NA	NA	NA	NA	NA
AZG53366.1|270185_270392_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	4.0e-31
AZG53367.1|270608_271106_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	96.4	3.9e-88
AZG53368.1|272893_274090_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZG53369.1|274316_274613_-	hypothetical protein	NA	NA	NA	NA	NA
AZG53370.1|274726_275894_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.7	5.8e-183
AZG53371.1|276621_276777_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	1.8e-07
AZG53372.1|276979_277387_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	1.7e-28
276550:277255	attR	AGCTCCTTCTGATGCCATTCTATTTCAGGAAGGAGTGTCCGTTAAACTCAGGCTACCTCAGTCTCGTTCATTTTACTCACCTGAATGTCTTCCCAACCAACGACGTGCGCCAGCTTCGGTTTTAAACGTTTTGCTTTTGGTATACGTCATGGCGGTGAATGTGCCGTCCTGGTTGGGGAACACGCCGTACACCAGAGATTCGTTGTTGCCAAGATCGATAGTATTCATGTTGACCCCATTTCCCCTTAACGCCGGGGTAGCGGAACTGTTTGCTGAGAACACCGTGCGGTGTCTTGATGAATGAAATTTAGAATAACCTAAGGTGGGCGGTCAAGATTTTTGTGTAGAAAAACCTAAGTTTTTTGATGTAAAAAACACAAGTGTTTGAAAGTTTGTGCTTTTTATTACAGGGTGTGGAGAAAAAAGGGGATTATTTGTTTGCGCTTCTTTTGCGAGCTTTGAGTAGTTCTTCAAAAAGTTTGTTGAAATTTTCAACTCGAGCACGCATCTCTGACAACAGGGCCTTTTGCTCTGACTCAGGCAGTGCGTCGAACAGTTGAAGTAACTCTTTTTGATCTTCTGTCAGAATGGCTGGCTGATTATCCGGGATCGGTTCGCCTGGTTGTTTATCTTCATCCCCAAAAAGAAGCCAAGTCGGTGAGCACTGAAGCGCTTGGCTCAGTGCGAATAATCTTTTCCCCGCCGG	NA	NA	NA	NA
AZG53373.1|277463_277691_+	transcriptional regulator	NA	NA	NA	NA	NA
276550:277255	attR	AGCTCCTTCTGATGCCATTCTATTTCAGGAAGGAGTGTCCGTTAAACTCAGGCTACCTCAGTCTCGTTCATTTTACTCACCTGAATGTCTTCCCAACCAACGACGTGCGCCAGCTTCGGTTTTAAACGTTTTGCTTTTGGTATACGTCATGGCGGTGAATGTGCCGTCCTGGTTGGGGAACACGCCGTACACCAGAGATTCGTTGTTGCCAAGATCGATAGTATTCATGTTGACCCCATTTCCCCTTAACGCCGGGGTAGCGGAACTGTTTGCTGAGAACACCGTGCGGTGTCTTGATGAATGAAATTTAGAATAACCTAAGGTGGGCGGTCAAGATTTTTGTGTAGAAAAACCTAAGTTTTTTGATGTAAAAAACACAAGTGTTTGAAAGTTTGTGCTTTTTATTACAGGGTGTGGAGAAAAAAGGGGATTATTTGTTTGCGCTTCTTTTGCGAGCTTTGAGTAGTTCTTCAAAAAGTTTGTTGAAATTTTCAACTCGAGCACGCATCTCTGACAACAGGGCCTTTTGCTCTGACTCAGGCAGTGCGTCGAACAGTTGAAGTAACTCTTTTTGATCTTCTGTCAGAATGGCTGGCTGATTATCCGGGATCGGTTCGCCTGGTTGTTTATCTTCATCCCCAAAAAGAAGCCAAGTCGGTGAGCACTGAAGCGCTTGGCTCAGTGCGAATAATCTTTTCCCCGCCGG	NA	NA	NA	NA
AZG53374.1|277700_278096_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.2	1.6e-60
AZG53375.1|278323_279480_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AZG53376.1|280227_280974_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	81.7	2.0e-112
AZG53377.1|280988_281411_+	DUF977 family protein	NA	A0A2I6TCA7	Escherichia_phage	76.6	5.9e-53
AZG53378.1|281411_281825_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.6e-58
AZG53379.1|281993_282659_+	hypothetical protein	NA	NA	NA	NA	NA
AZG53380.1|282829_283042_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	90.0	4.0e-26
AZG53381.1|283291_283579_+	hypothetical protein	NA	NA	NA	NA	NA
AZG53382.1|283967_285124_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AZG53383.1|285201_285645_+|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	49.3	9.9e-35
AZG53384.1|285821_285950_+	hydrolase	NA	NA	NA	NA	NA
AZG53385.1|285950_287009_-	molybdenum import ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
AZG53386.1|287011_287701_-	molybdenum ABC transporter permease	NA	NA	NA	NA	NA
AZG53387.1|287700_288474_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZG53388.1|288639_288789_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
AZG53389.1|288917_289706_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
AZG53390.1|289773_291246_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
AZG53391.1|291506_292523_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
AZG53392.1|292532_293579_+	galactose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
AZG53393.1|293582_294731_+	galactokinase	NA	NA	NA	NA	NA
AZG53394.1|294724_295765_+	galactose-1-epimerase	NA	NA	NA	NA	NA
AZG53395.1|295967_296720_+	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
AZG53396.1|296878_297931_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	8.9e-82
AZG53397.1|298246_298627_+	hypothetical protein	NA	NA	NA	NA	NA
AZG53398.1|298740_299682_+	zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.4	7.5e-24
AZG53399.1|299678_300398_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
AZG53400.1|300660_301458_-	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	100.0	6.6e-146
AZG53401.1|301457_302630_-|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	100.0	2.2e-230
>prophage 2
CP034067	Shigella sonnei strain FDAARGOS_524 chromosome, complete genome	4828074	532516	600058	4828074	tRNA,transposase,protease	Bacillus_phage(16.67%)	58	NA	NA
AZG57107.1|532516_533143_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
AZG53583.1|533132_533942_+	short-chain dehydrogenase/reductase	NA	NA	NA	NA	NA
AZG53584.1|534002_534857_+	co-chaperone YbbN	NA	NA	NA	NA	NA
AZG53585.1|534919_535699_-	iron export permease FetB	NA	NA	NA	NA	NA
AZG53586.1|535685_536363_-	iron export ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	1.4e-27
AZG53587.1|536508_537426_+	paraslipin	NA	NA	NA	NA	NA
AZG53588.1|537422_537881_+	NfeD family protein	NA	NA	NA	NA	NA
AZG53589.1|537881_538289_-	transcriptional regulator	NA	NA	NA	NA	NA
AZG53590.1|538413_539706_-	amino acid permease	NA	NA	NA	NA	NA
AZG53591.1|539708_540641_-	glutaminase 1	NA	NA	NA	NA	NA
AZG53592.1|540902_543407_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.2	3.8e-115
AZG53593.1|543621_543963_-	addiction module antidote protein, HigA family	NA	A0A222YWD7	Escherichia_phage	74.5	1.8e-39
AZG53594.1|544100_544895_+	hypothetical protein	NA	NA	NA	NA	NA
AZG53595.1|545098_545578_+|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
AZG53596.1|545614_547267_-	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
AZG53597.1|547484_548627_+	MFS transporter	NA	NA	NA	NA	NA
AZG53598.1|548678_549834_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	2.3e-67
AZG53599.1|550209_551886_+	Kef family K(+) transporter	NA	NA	NA	NA	NA
AZG53600.1|552018_553323_-	inosine/guanosine kinase	NA	NA	NA	NA	NA
AZG53601.1|553474_554434_+	acetylesterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.7	2.9e-15
AZG53602.1|554430_555393_-	ferrochelatase	NA	NA	NA	NA	NA
AZG53603.1|555524_556169_-	adenylate kinase	NA	NA	NA	NA	NA
AZG53604.1|556349_558224_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
AZG53605.1|558333_558939_-	recombination protein RecR	NA	NA	NA	NA	NA
AZG53606.1|558938_559268_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AZG53607.1|559320_561246_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
AZG53608.1|561374_561926_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
AZG53609.1|562078_562456_-	DUF454 family protein	NA	NA	NA	NA	NA
AZG53610.1|562525_563053_+	primosomal replication protein N''	NA	NA	NA	NA	NA
AZG53611.1|563066_563228_+	DUF2496 domain-containing protein	NA	NA	NA	NA	NA
AZG53612.1|563439_566802_-	mechanosensitive channel MscK	NA	NA	NA	NA	NA
AZG53613.1|566929_567577_-	multidrug efflux transporter transcriptional repressor AcrR	NA	NA	NA	NA	NA
AZG53614.1|567718_568912_+	MexE family multidrug efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AZG53615.1|568934_572084_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
AZG53616.1|572629_573004_+	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
AZG53617.1|573029_573248_+	hemolysin expression-modulating protein Hha	NA	NA	NA	NA	NA
AZG53618.1|573418_573970_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
AZG53619.1|574085_574556_+	hypothetical protein	NA	NA	NA	NA	NA
AZG53620.1|576309_576663_-	DUF1428 domain-containing protein	NA	NA	NA	NA	NA
AZG53621.1|576963_577353_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
AZG53622.1|577383_577956_-	hypothetical protein	NA	NA	NA	NA	NA
AZG53623.1|578173_579034_+	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
AZG53624.1|579082_580369_-	ammonia channel	NA	NA	NA	NA	NA
AZG53625.1|580398_580737_-	nitrogen regulatory protein P-II 2	NA	NA	NA	NA	NA
AZG53626.1|580917_582699_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.2	5.2e-42
AZG53627.1|582691_584464_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	2.0e-49
AZG53628.1|584493_584952_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AZG53629.1|585103_585922_-	HMP-PP phosphatase	NA	NA	NA	NA	NA
AZG53630.1|586021_587722_+	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
AZG53631.1|587786_588482_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
AZG53632.1|588533_588932_-	long-chain acyl-CoA thioesterase FadM	NA	NA	NA	NA	NA
AZG53633.1|589645_590818_+|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	100.0	2.2e-230
AZG53634.1|590817_591615_+	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	100.0	6.6e-146
AZG53635.1|592948_594820_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
AZG53636.1|595011_595284_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
AZG53637.1|595492_597847_-|protease	Lon protease	protease	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
AZG53638.1|598034_599309_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
AZG53639.1|599434_600058_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 3
CP034067	Shigella sonnei strain FDAARGOS_524 chromosome, complete genome	4828074	676388	785590	4828074	plate,transposase	Acinetobacter_phage(16.67%)	85	NA	NA
AZG53708.1|676388_677661_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AZG53709.1|678161_678833_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
AZG57110.1|680062_680599_+	acetyltransferase	NA	NA	NA	NA	NA
AZG53710.1|680600_681374_+	YaiO family outer membrane beta-barrel protein	NA	NA	NA	NA	NA
AZG53711.1|681561_681837_+	transcriptional regulator	NA	NA	NA	NA	NA
AZG53712.1|681871_682981_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
AZG53713.1|683073_683907_+	S-formylglutathione hydrolase FrmB	NA	NA	NA	NA	NA
AZG53714.1|684132_684672_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
AZG53715.1|684773_685985_-	3-(3-hydroxy-phenyl)propionate transporter MhpT	NA	NA	NA	NA	NA
AZG53716.1|686271_687285_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	30.8	7.1e-44
AZG53717.1|687281_688232_-	acetaldehyde dehydrogenase (acetylating)	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
AZG53718.1|688228_689038_-	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
AZG53719.1|689620_690776_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AZG53720.1|690821_692049_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
AZG53721.1|692310_693180_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	1.2e-52
AZG53722.1|693339_693933_-	protein RclC	NA	NA	NA	NA	NA
AZG53723.1|693944_694181_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AZG53724.1|694289_695615_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
AZG53725.1|695840_696695_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZG53726.1|697222_697942_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
AZG53727.1|697952_699380_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
AZG53728.1|699372_700068_+	lactate utilization protein C	NA	NA	NA	NA	NA
AZG53729.1|700949_701183_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
AZG53730.1|701222_702086_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
AZG53731.1|702075_703623_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
AZG53732.1|703622_704981_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
AZG53733.1|705123_706074_+	carbamate kinase family protein	NA	NA	NA	NA	NA
AZG53734.1|706083_707466_+	deaminase	NA	NA	NA	NA	NA
AZG53735.1|707842_708892_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.0	1.4e-71
AZG53736.1|709911_710727_+	hypothetical protein	NA	NA	NA	NA	NA
AZG53737.1|710935_712092_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.0e-67
AZG53738.1|712406_712652_+	hypothetical protein	NA	NA	NA	NA	NA
AZG53739.1|712668_713301_-	hypothetical protein	NA	NA	NA	NA	NA
AZG53740.1|714414_717489_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	97.9	0.0e+00
AZG57111.1|717611_718694_-	lactose operon repressor	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
AZG53741.1|719645_721310_+	bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase	NA	NA	NA	NA	NA
AZG53742.1|721311_722256_+	2,3-dihydroxyphenylpropionate/2, 3-dihydroxicinnamic acid 1,2-dioxygenase	NA	NA	NA	NA	NA
AZG53743.1|722677_723834_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AZG53744.1|723988_724960_-	hypothetical protein	NA	I7HJD8	Enterobacteria_phage	32.7	5.6e-14
AZG53745.1|725910_726942_-|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
AZG53746.1|727693_728849_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AZG53747.1|729165_729501_-	hypothetical protein	NA	NA	NA	NA	NA
AZG53748.1|730232_730547_+	hypothetical protein	NA	NA	NA	NA	NA
AZG53749.1|730795_732049_-	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
AZG53750.1|732060_733164_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AZG53751.1|733451_734507_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
AZG53752.1|734545_734947_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
AZG53753.1|735004_736249_-	esterase FrsA	NA	NA	NA	NA	NA
AZG53754.1|736340_736799_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AZG53755.1|737059_738517_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
AZG53756.1|738573_739188_-	peptide chain release factor H	NA	NA	NA	NA	NA
AZG53757.1|740030_741227_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZG53758.1|741205_741799_-	RNA ligase RtcB family protein	NA	A0A0A0RRX9	Bacillus_phage	31.1	1.6e-08
AZG53759.1|742017_742470_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZG53760.1|742466_743522_-	DNA polymerase IV	NA	NA	NA	NA	NA
AZG57112.1|743592_744363_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
AZG53761.1|744322_746062_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
AZG53762.1|746184_746682_-|transposase	transposase	transposase	NA	NA	NA	NA
AZG53763.1|747921_748695_-	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
AZG53764.1|748880_749141_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
AZG53765.1|749143_749422_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
AZG53766.1|749577_750318_+	transpeptidase	NA	NA	NA	NA	NA
AZG53767.1|750288_751056_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
AZG53768.1|751261_751840_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
AZG53769.1|752079_754524_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AZG53770.1|754566_755040_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
AZG53771.1|755193_755964_+	amidohydrolase	NA	NA	NA	NA	NA
AZG53772.1|756005_757142_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AZG53773.1|757610_757988_-	hypothetical protein	NA	NA	NA	NA	NA
AZG57113.1|759833_760283_-	hypothetical protein	NA	NA	NA	NA	NA
AZG53774.1|760294_764503_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	44.2	1.1e-21
AZG53775.1|764578_766720_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.2	2.8e-26
AZG53776.1|766929_767448_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
AZG53777.1|768144_768645_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AZG53778.1|768679_768904_+	hypothetical protein	NA	NA	NA	NA	NA
AZG53779.1|770436_770850_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AZG53780.1|770853_772704_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AZG53781.1|772667_773750_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AZG53782.1|773774_775055_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AZG53783.1|775051_775576_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AZG53784.1|776912_777674_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AZG53785.1|780462_781206_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
AZG53786.1|781210_782623_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AZG53787.1|782641_784321_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AZG53788.1|784317_785590_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 4
CP034067	Shigella sonnei strain FDAARGOS_524 chromosome, complete genome	4828074	815550	885255	4828074	tRNA,transposase,protease	Shigella_phage(20.0%)	58	NA	NA
AZG53813.1|815550_816849_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
AZG53814.1|816913_817303_-	VOC family protein	NA	NA	NA	NA	NA
AZG53815.1|817359_819501_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
AZG53816.1|819661_820990_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
AZG53817.1|821038_821998_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
AZG53818.1|822010_825493_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.0	7.4e-210
AZG53819.1|825529_826126_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
AZG53820.1|826122_827271_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AZG53821.1|827270_828059_-	acyl-[acyl-carrier-protein]--UDP-N- acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AZG53822.1|828062_828518_-	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AZG53823.1|828622_829648_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AZG53824.1|829651_830137_-	chaperone protein Skp	NA	NA	NA	NA	NA
AZG53825.1|830258_832691_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
AZG53826.1|832720_834073_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
AZG53827.1|834084_834942_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AZG53828.1|834954_835713_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
AZG53829.1|835901_837098_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
AZG53830.1|837189_837747_-	ribosome recycling factor	NA	NA	NA	NA	NA
AZG53831.1|838038_838764_-	UMP kinase	NA	NA	NA	NA	NA
AZG53832.1|838910_839762_-	elongation factor Ts	NA	NA	NA	NA	NA
AZG53833.1|840019_840745_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
AZG53834.1|841112_841907_+	methionine aminopeptidase	NA	NA	NA	NA	NA
AZG53835.1|841968_844641_+	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
AZG53836.1|844671_845496_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
AZG53837.1|845550_846363_+	phosphodiesterase YaeI	NA	NA	NA	NA	NA
AZG53838.1|846281_846479_-	hypothetical protein	NA	NA	NA	NA	NA
AZG53839.1|846524_846911_+	DUF3461 family protein	NA	NA	NA	NA	NA
AZG53840.1|846999_848157_-	CdaR family transcriptional regulator	NA	NA	NA	NA	NA
AZG53841.1|848311_849736_-|protease	periplasmic serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
AZG53842.1|851299_852160_-	dGTPase	NA	NA	NA	NA	NA
AZG53843.1|852243_852942_+	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
AZG53844.1|852934_853735_+	cobalamin-binding protein	NA	NA	NA	NA	NA
AZG53845.1|853772_854396_+	TRIC cation channel family protein	NA	NA	NA	NA	NA
AZG53846.1|854442_854787_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
AZG57115.1|854779_854845_-	hypothetical protein	NA	NA	NA	NA	NA
AZG53847.1|854868_856290_-	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
AZG53848.1|856514_857795_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
AZG53849.1|857952_859935_-	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
AZG53850.1|859931_860822_-	Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD	NA	NA	NA	NA	NA
AZG53851.1|860821_861619_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
AZG53852.1|861669_863859_-	ferrichrome porin FhuA	NA	NA	NA	NA	NA
AZG53853.1|864078_866613_-	bifunctional glycosyl transferase/transpeptidase	NA	NA	NA	NA	NA
AZG53854.1|866599_866806_-	hypothetical protein	NA	NA	NA	NA	NA
AZG53855.1|866808_869238_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	29.1	1.0e-40
AZG53856.1|869311_869842_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
AZG53857.1|869856_870561_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AZG53858.1|870738_871194_+	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
AZG53859.1|871230_872157_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AZG53860.1|872195_873614_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
AZG53861.1|873610_874090_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AZG53862.1|874459_875044_+	fimbrial protein	NA	NA	NA	NA	NA
AZG53863.1|875148_875889_+	fimbrial chaperone	NA	NA	NA	NA	NA
AZG53864.1|879171_880203_+|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
AZG53865.1|880252_881480_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
AZG53866.1|881487_881961_+	fimbrial protein	NA	NA	NA	NA	NA
AZG53867.1|881975_882578_+	fimbrial-like protein YadL	NA	NA	NA	NA	NA
AZG53868.1|882604_883201_+	fimbrial protein StaF	NA	NA	NA	NA	NA
AZG53869.1|883981_885255_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 5
CP034067	Shigella sonnei strain FDAARGOS_524 chromosome, complete genome	4828074	1104483	1142783	4828074	transposase	Shigella_phage(25.0%)	27	NA	NA
AZG54041.1|1104483_1105639_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AZG54042.1|1106580_1108143_+	4-hydroxyphenylacetate 3-monooxygenase, oxygenase component	NA	NA	NA	NA	NA
AZG54043.1|1108160_1108673_+	4-hydroxyphenylacetate 3-monooxygenase reductase component	NA	NA	NA	NA	NA
AZG54044.1|1109065_1111216_+	carbon starvation protein A	NA	NA	NA	NA	NA
AZG54045.1|1111265_1111469_+	YbdD/YjiX family protein	NA	NA	NA	NA	NA
AZG54046.1|1111479_1112436_+	GTPase	NA	NA	NA	NA	NA
AZG54047.1|1113637_1114834_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZG54048.1|1116494_1117325_+	DUF2686 family protein	NA	NA	NA	NA	NA
AZG54049.1|1117465_1118239_-	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
AZG54050.1|1118237_1118432_+	hypothetical protein	NA	NA	NA	NA	NA
AZG54051.1|1118453_1119914_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	9.5e-50
AZG54052.1|1119994_1121179_-	mannonate dehydratase	NA	NA	NA	NA	NA
AZG54053.1|1123591_1124623_-|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
AZG54054.1|1125481_1126198_+	N-acetylneuraminic acid outer membrane channel protein NanC	NA	NA	NA	NA	NA
AZG54055.1|1126217_1127324_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
AZG54056.1|1127388_1128369_+	sialate O-acetylesterase	NA	Q08JA2	Stx2-converting_phage	56.6	2.7e-101
AZG54057.1|1129433_1129691_-	biofilm development YmgB/AriR family protein	NA	NA	NA	NA	NA
AZG54058.1|1130206_1131478_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AZG54059.1|1131773_1132471_-|transposase	IS1-like element IS1A family transposase	transposase	A0A077SLN4	Escherichia_phage	98.3	4.0e-131
AZG54060.1|1133553_1134075_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
AZG54061.1|1134071_1135025_+	fec operon regulator FecR	NA	NA	NA	NA	NA
AZG54062.1|1135111_1137436_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AZG54063.1|1137480_1138383_+	Fe(3+)-dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
AZG54064.1|1138379_1139378_+	Fe3+ dicitrate ABC transporter permease	NA	NA	NA	NA	NA
AZG54065.1|1139374_1140331_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.8e-17
AZG54066.1|1140331_1141099_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.3	1.4e-12
AZG54067.1|1141614_1142783_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.7	5.8e-183
>prophage 6
CP034067	Shigella sonnei strain FDAARGOS_524 chromosome, complete genome	4828074	1240772	1309341	4828074	tRNA,transposase,protease	Acinetobacter_phage(21.43%)	56	NA	NA
AZG54152.1|1240772_1241777_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
AZG54153.1|1241779_1243039_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
AZG54154.1|1243124_1244405_-	GTPase HflX	NA	NA	NA	NA	NA
AZG54155.1|1244481_1244790_-	RNA-binding protein Hfq	NA	NA	NA	NA	NA
AZG54156.1|1244875_1245826_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AZG54157.1|1245818_1247666_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
AZG54158.1|1247675_1249013_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
AZG54159.1|1249031_1249493_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
AZG54160.1|1249464_1251012_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
AZG54161.1|1251010_1252150_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
AZG57127.1|1252132_1252186_-	hypothetical protein	NA	NA	NA	NA	NA
AZG54162.1|1253049_1253595_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
AZG54163.1|1253689_1254742_+	ribosome small subunit-dependent GTPase	NA	NA	NA	NA	NA
AZG54164.1|1254838_1255807_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
AZG54165.1|1255828_1259152_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
AZG54166.1|1259302_1260670_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
AZG54167.1|1261393_1261582_-	transporter	NA	NA	NA	NA	NA
AZG54168.1|1261800_1262778_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
AZG54169.1|1263102_1264911_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
AZG54170.1|1264903_1265638_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
AZG54171.1|1265648_1266044_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
AZG54172.1|1266054_1266414_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
AZG54173.1|1266476_1267610_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
AZG54174.1|1267698_1268232_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
AZG54175.1|1268228_1268546_-	quaternary ammonium compound-resistance protein SugE	NA	NA	NA	NA	NA
AZG54176.1|1268720_1268867_-	entericidin B	NA	NA	NA	NA	NA
AZG54177.1|1268977_1269103_-	entericidin A	NA	NA	NA	NA	NA
AZG54178.1|1269154_1269721_-	elongation factor P	NA	NA	NA	NA	NA
AZG54179.1|1269762_1270791_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
AZG54180.1|1272068_1272827_+	hypothetical protein	NA	NA	NA	NA	NA
AZG54181.1|1273029_1273383_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
AZG54182.1|1273520_1275167_-	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
AZG54183.1|1275210_1275504_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
AZG54184.1|1275779_1277036_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
AZG54185.1|1277057_1277528_-	membrane protein FxsA	NA	NA	NA	NA	NA
AZG54186.1|1277864_1279301_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
AZG54187.1|1279418_1280720_+	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
AZG54188.1|1280835_1281174_+	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
AZG54189.1|1281149_1282847_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
AZG54190.1|1282883_1283459_+	transcriptional regulator	NA	NA	NA	NA	NA
AZG54191.1|1288580_1289737_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AZG54192.1|1289848_1290196_+	calcium-binding protein	NA	NA	NA	NA	NA
AZG54193.1|1291334_1292607_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AZG54194.1|1293566_1294722_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AZG54195.1|1295084_1296542_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.4	5.2e-48
AZG54196.1|1296778_1298296_+|tRNA	lysine--tRNA ligase heat inducible	tRNA	A0A1V0SAC0	Catovirus	38.0	1.6e-87
AZG54197.1|1298414_1298588_-	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
AZG54198.1|1298615_1298912_-	endoribonuclease GhoS	NA	NA	NA	NA	NA
AZG54199.1|1299138_1299411_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZG54200.1|1299422_1299653_-	4Fe-4S mono-cluster protein YjdI	NA	NA	NA	NA	NA
AZG54201.1|1299833_1301465_+	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
AZG54202.1|1301461_1302181_+	two-component system response regulator DcuR	NA	NA	NA	NA	NA
AZG54203.1|1302751_1304092_+	anaerobic C4-dicarboxylate transporter DcuB	NA	NA	NA	NA	NA
AZG54204.1|1304169_1305816_+	fumarate hydratase class I, anaerobic	NA	NA	NA	NA	NA
AZG54205.1|1307349_1307529_+	hypothetical protein	NA	NA	NA	NA	NA
AZG54206.1|1308067_1309341_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	4.0e-177
>prophage 7
CP034067	Shigella sonnei strain FDAARGOS_524 chromosome, complete genome	4828074	1701072	1770510	4828074	transposase	Shigella_phage(18.18%)	55	NA	NA
AZG54509.1|1701072_1702345_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AZG54510.1|1702330_1702669_+	growth inhibitor PemK	NA	NA	NA	NA	NA
AZG54511.1|1702867_1703149_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
AZG54512.1|1703235_1704711_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
AZG54513.1|1704860_1705754_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZG54514.1|1705805_1707350_-	threonine ammonia-lyase, biosynthetic	NA	NA	NA	NA	NA
AZG54515.1|1707352_1709203_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AZG54516.1|1709267_1710197_-	branched-chain-amino-acid transaminase	NA	NA	NA	NA	NA
AZG54517.1|1710216_1710480_-	acetolactate synthase isozyme 2 small subunit	NA	NA	NA	NA	NA
AZG54518.1|1710476_1712123_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	6.3e-66
AZG57141.1|1712125_1712176_-	hypothetical protein	NA	NA	NA	NA	NA
AZG54519.1|1712262_1712361_-	IlvGMEDA operon leader peptide	NA	NA	NA	NA	NA
AZG54520.1|1714361_1714640_+	magnesium chelatase	NA	NA	NA	NA	NA
AZG54521.1|1714726_1715899_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.7	8.3e-230
AZG54522.1|1715898_1716696_+	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	100.0	6.6e-146
AZG54523.1|1717170_1717509_-	DUF413 domain-containing protein	NA	NA	NA	NA	NA
AZG54524.1|1717627_1718467_+	transcriptional regulator	NA	NA	NA	NA	NA
AZG54525.1|1724259_1724952_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
AZG54526.1|1724974_1726402_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
AZG54527.1|1726367_1727360_-	ribose operon repressor	NA	NA	NA	NA	NA
AZG57142.1|1727363_1728293_-	ribokinase	NA	NA	NA	NA	NA
AZG54528.1|1729329_1730295_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
AZG54529.1|1730299_1731805_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	26.7	3.0e-14
AZG57143.1|1731812_1732232_-	D-ribose pyranase	NA	NA	NA	NA	NA
AZG54530.1|1732398_1734267_-	low affinity potassium transport system protein kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
AZG54531.1|1734425_1735754_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
AZG54532.1|1735835_1736060_-	xylanase	NA	NA	NA	NA	NA
AZG54533.1|1736059_1737676_-	carbohydrate porin	NA	NA	NA	NA	NA
AZG54534.1|1737761_1738850_-	glycosyl hydrolase family protein	NA	NA	NA	NA	NA
AZG54535.1|1740228_1740444_+	hypothetical protein	NA	NA	NA	NA	NA
AZG54536.1|1740691_1742569_-	PTS beta-glucoside transporter subunit IIABC	NA	NA	NA	NA	NA
AZG54537.1|1742702_1743539_-	transcriptional antiterminator BglG	NA	NA	NA	NA	NA
AZG54538.1|1743824_1744550_-	phosphate-specific transport system accessory protein PhoU	NA	NA	NA	NA	NA
AZG54539.1|1744564_1745338_-	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	31.6	1.3e-18
AZG54540.1|1745428_1746319_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
AZG54541.1|1746318_1747278_-	phosphate ABC transporter permease	NA	NA	NA	NA	NA
AZG54542.1|1747364_1748405_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	4.7e-51
AZG54543.1|1748652_1749726_-	fimbrial protein	NA	NA	NA	NA	NA
AZG54544.1|1751364_1752532_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.7	5.8e-183
AZG54545.1|1753535_1753961_-	pilus assembly protein	NA	NA	NA	NA	NA
AZG54546.1|1754741_1755044_-	fimbrial protein	NA	NA	NA	NA	NA
AZG54547.1|1755091_1755664_-	fimbrial protein	NA	NA	NA	NA	NA
AZG54548.1|1755955_1757284_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
AZG54549.1|1757894_1758134_+	DUF1819 family protein	NA	NA	NA	NA	NA
AZG54550.1|1759630_1760104_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
AZG54551.1|1760198_1760723_+	streptothricin N-acetyltransferase Sat2	NA	E4ZFP7	Streptococcus_phage	38.9	4.2e-16
AZG54552.1|1760780_1761569_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AZG54553.1|1761644_1762142_+	hypothetical protein	NA	NA	NA	NA	NA
AZG54554.1|1762202_1762574_+	hypothetical protein	NA	NA	NA	NA	NA
AZG54555.1|1762606_1762930_+	hypothetical protein	NA	NA	NA	NA	NA
AZG54556.1|1762983_1763361_+	hypothetical protein	NA	NA	NA	NA	NA
AZG54557.1|1763591_1765208_-	transcriptional antiterminator	NA	NA	NA	NA	NA
AZG54558.1|1765208_1766735_-	transcriptional antiterminator	NA	NA	NA	NA	NA
AZG54559.1|1766737_1768405_-	AAA family ATPase	NA	NA	NA	NA	NA
AZG54560.1|1768401_1770510_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
CP034067	Shigella sonnei strain FDAARGOS_524 chromosome, complete genome	4828074	1943271	1951663	4828074	transposase	Enterobacteria_phage(50.0%)	8	NA	NA
AZG54702.1|1943271_1944456_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	69.9	3.4e-162
AZG54703.1|1944867_1945911_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AZG54704.1|1946657_1947455_-	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	99.6	1.9e-145
AZG54705.1|1947454_1948627_-|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	100.0	2.2e-230
AZG54706.1|1949098_1949395_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AZG54707.1|1949528_1949954_-	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
AZG54708.1|1949966_1951256_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
AZG54709.1|1951309_1951663_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
>prophage 9
CP034067	Shigella sonnei strain FDAARGOS_524 chromosome, complete genome	4828074	2030915	2093731	4828074	tRNA,transposase,protease	Escherichia_phage(30.77%)	57	NA	NA
AZG54777.1|2030915_2032244_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
AZG57145.1|2032432_2033941_+	PstS family phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZG54778.1|2033956_2034667_+	hypothetical protein	NA	NA	NA	NA	NA
AZG54779.1|2034669_2035437_+	hypothetical protein	NA	NA	NA	NA	NA
AZG54780.1|2035439_2036045_+	hypothetical protein	NA	NA	NA	NA	NA
AZG54781.1|2036096_2037602_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AZG54782.1|2037791_2038118_+	thiosulfate sulfurtransferase	NA	NA	NA	NA	NA
AZG54783.1|2038162_2038993_+|protease	rhomboid family intramembrane serine protease GlpG	protease	NA	NA	NA	NA
AZG54784.1|2039009_2039768_+	DeoR/GlpR family transcriptional regulator	NA	NA	NA	NA	NA
AZG54785.1|2042439_2043804_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
AZG54786.1|2043909_2045556_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
AZG54787.1|2045558_2045816_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
AZG54788.1|2045779_2046139_-	ribonuclease P protein component	NA	NA	NA	NA	NA
AZG54789.1|2046155_2046296_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
AZG54790.1|2046525_2046606_-	hypothetical protein	NA	NA	NA	NA	NA
AZG54791.1|2046902_2048306_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AZG54792.1|2048310_2049411_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
AZG54793.1|2049410_2050484_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
AZG54794.1|2050512_2052927_+	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
AZG54795.1|2053157_2053565_+	DUF937 domain-containing protein	NA	NA	NA	NA	NA
AZG54796.1|2053679_2054492_+	sugar phosphatase YidA	NA	NA	NA	NA	NA
AZG54797.1|2055138_2055828_+	transcriptional regulator	NA	NA	NA	NA	NA
AZG54798.1|2055824_2056703_+	2-dehydro-3-deoxygalactonokinase	NA	NA	NA	NA	NA
AZG54799.1|2056686_2057304_+	2-dehydro-3-deoxy-6-phosphogalactonate aldolase	NA	NA	NA	NA	NA
AZG54800.1|2058568_2059861_+	MFS transporter	NA	NA	NA	NA	NA
AZG57146.1|2059857_2060922_-	protein CbrA	NA	NA	NA	NA	NA
AZG54801.1|2060989_2062237_+	DUF3748 domain-containing protein	NA	NA	NA	NA	NA
AZG54802.1|2062238_2062571_-	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
AZG54803.1|2062876_2063290_+	heat-shock protein IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
AZG54804.1|2063401_2063830_+	heat-shock protein IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
AZG54805.1|2064025_2065687_+	putative transporter	NA	NA	NA	NA	NA
AZG54806.1|2065683_2066400_-	transcriptional regulator	NA	NA	NA	NA	NA
AZG54807.1|2066695_2068312_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
AZG54808.1|2070204_2071413_+|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	92.8	1.6e-207
AZG54809.1|2071661_2072111_-	hypothetical protein	NA	NA	NA	NA	NA
AZG54810.1|2072219_2072567_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
AZG54811.1|2072556_2072919_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
AZG54812.1|2072915_2073413_+	radical SAM protein	NA	NA	NA	NA	NA
AZG54813.1|2073420_2074605_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	6.8e-14
AZG54814.1|2074884_2074974_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
AZG54815.1|2075538_2075637_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
AZG54816.1|2075742_2077431_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.4	4.6e-56
AZG54817.1|2077434_2077725_+	acetolactate synthase 1 small subunit	NA	NA	NA	NA	NA
AZG54818.1|2077799_2078390_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AZG54819.1|2078389_2079892_+	signal transduction histidine-protein kinase/phosphatase UhpB	NA	NA	NA	NA	NA
AZG54820.1|2079901_2081221_+	MFS transporter family glucose-6-phosphate receptor UhpC	NA	NA	NA	NA	NA
AZG54821.1|2081358_2082750_+	hexose phosphate transporter	NA	NA	NA	NA	NA
AZG54822.1|2082794_2084561_-	adenine deaminase	NA	NA	NA	NA	NA
AZG54823.1|2084657_2084846_+	sulfate permease	NA	NA	NA	NA	NA
AZG54824.1|2086522_2086975_+	DUF1198 domain-containing protein	NA	NA	NA	NA	NA
AZG54825.1|2088406_2088700_-	hypothetical protein	NA	NA	NA	NA	NA
AZG54826.1|2088921_2089689_+	lipoprotein NlpA	NA	NA	NA	NA	NA
AZG54827.1|2090451_2090658_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	91.2	9.3e-28
AZG54828.1|2090673_2091072_-	hypothetical protein	NA	A0A0N7C1X7	Escherichia_phage	97.6	9.1e-64
AZG54829.1|2091157_2091433_-	hypothetical protein	NA	A0A0N7C1Z2	Escherichia_phage	94.5	3.6e-43
AZG57147.1|2091573_2092293_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	49.3	7.7e-61
AZG54830.1|2092563_2093731_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.7	5.8e-183
>prophage 10
CP034067	Shigella sonnei strain FDAARGOS_524 chromosome, complete genome	4828074	2105694	2142685	4828074	transposase	Acinetobacter_phage(28.57%)	24	NA	NA
AZG54839.1|2105694_2106198_-|transposase	transposase	transposase	NA	NA	NA	NA
AZG54840.1|2107713_2108870_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.0e-67
AZG54841.1|2112083_2113256_+|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	100.0	2.2e-230
AZG54842.1|2113255_2114053_+	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	100.0	6.6e-146
AZG54843.1|2115116_2116272_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AZG54844.1|2116463_2117736_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AZG57149.1|2120268_2120835_+	outer membrane lipoprotein Slp	NA	NA	NA	NA	NA
AZG54845.1|2120990_2121521_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AZG57150.1|2121562_2122210_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
AZG54846.1|2122273_2122600_-	acid stress chaperone HdeB	NA	NA	NA	NA	NA
AZG54847.1|2122715_2123048_-	acid stress chaperone HdeA	NA	NA	NA	NA	NA
AZG54848.1|2123302_2123875_+	protein HdeD	NA	NA	NA	NA	NA
AZG54849.1|2124673_2125201_+	transcriptional regulator GadE	NA	NA	NA	NA	NA
AZG54850.1|2125201_2125480_-	hypothetical protein	NA	NA	NA	NA	NA
AZG54851.1|2125539_2126697_+	multidrug resistance protein MdtE	NA	NA	NA	NA	NA
AZG54852.1|2126721_2129835_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AZG54853.1|2130197_2130926_-	acid resistance transcriptional activator GadW	NA	NA	NA	NA	NA
AZG54854.1|2131293_2132118_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZG54855.1|2132487_2133888_-	glutamate decarboxylase alpha	NA	NA	NA	NA	NA
AZG54856.1|2134098_2135496_-	cytochrome-c peroxidase	NA	NA	NA	NA	NA
AZG54857.1|2135900_2137550_+	trehalase	NA	NA	NA	NA	NA
AZG54858.1|2139042_2140023_+	esterase family protein	NA	NA	NA	NA	NA
AZG54859.1|2141171_2141564_+	hypothetical protein	NA	NA	NA	NA	NA
AZG54860.1|2141987_2142685_-|transposase	IS1-like element IS1A family transposase	transposase	A0A077SLN4	Escherichia_phage	98.3	4.0e-131
>prophage 11
CP034067	Shigella sonnei strain FDAARGOS_524 chromosome, complete genome	4828074	2315212	2376017	4828074	transposase,protease	Staphylococcus_phage(11.11%)	60	NA	NA
AZG55021.1|2315212_2316541_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
AZG55022.1|2316591_2317659_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
AZG55023.1|2317748_2319116_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.6e-21
AZG57155.1|2319269_2319668_-	DUF1043 family protein	NA	NA	NA	NA	NA
AZG55024.1|2319861_2320989_+	cell division protein ZapE	NA	NA	NA	NA	NA
AZG55025.1|2321207_2321636_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AZG55026.1|2321651_2322044_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
AZG55027.1|2322438_2323077_+	stringent starvation protein A	NA	NA	NA	NA	NA
AZG55028.1|2323082_2323580_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
AZG55029.1|2323622_2324945_-	C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
AZG55030.1|2325324_2326116_+	transcriptional regulator NanR	NA	NA	NA	NA	NA
AZG55031.1|2326237_2327131_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
AZG55032.1|2327240_2328731_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
AZG55033.1|2328778_2329468_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
AZG55034.1|2329464_2330340_+	ROK family protein	NA	NA	NA	NA	NA
AZG55035.1|2330336_2330801_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
AZG55036.1|2330876_2331182_-|transposase	transposase	transposase	NA	NA	NA	NA
AZG55037.1|2331198_2331678_-	DUF1016 family protein	NA	NA	NA	NA	NA
AZG55038.1|2331861_2333280_-	glutamate synthase	NA	NA	NA	NA	NA
AZG55039.1|2333292_2337753_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
AZG57156.1|2338427_2339357_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
AZG55040.1|2339452_2341789_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
AZG55041.1|2342018_2342672_+	glutamine amidotransferase	NA	NA	NA	NA	NA
AZG55042.1|2342668_2343397_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AZG55043.1|2343393_2344026_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
AZG55044.1|2344239_2344512_-	phosphocarrier protein NPr	NA	NA	NA	NA	NA
AZG55045.1|2344508_2345363_-	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
AZG55046.1|2345408_2345900_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AZG55047.1|2346017_2346305_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
AZG55048.1|2346327_2347761_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
AZG55049.1|2347808_2348534_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
AZG55050.1|2348540_2349098_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AZG55051.1|2349066_2349642_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AZG55052.1|2349638_2350205_-	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
AZG55053.1|2350225_2351212_-	arabinose 5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
AZG55054.1|2351225_2352203_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
AZG55055.1|2352412_2353222_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
AZG55056.1|2353229_2354012_+	phospholipid ABC transporter permease	NA	NA	NA	NA	NA
AZG57157.1|2354016_2354568_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
AZG55057.1|2354586_2355222_+	phospholipid-binding protein	NA	NA	NA	NA	NA
AZG55058.1|2355221_2355515_+	phospholipid ABC transporter-binding protein	NA	NA	NA	NA	NA
AZG57158.1|2355674_2355929_+	acid stress protein IbaG	NA	NA	NA	NA	NA
AZG55059.1|2355983_2357243_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AZG55060.1|2357290_2357569_-	sugar fermentation stimulation protein B	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
AZG55061.1|2357797_2358769_-	octaprenyl-diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
AZG55062.1|2359027_2359339_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
AZG55063.1|2359359_2359617_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
AZG55064.1|2359743_2360709_+	EamA family transporter	NA	NA	NA	NA	NA
AZG57159.1|2360724_2361897_+	GTPase ObgE	NA	NA	NA	NA	NA
AZG55065.1|2362082_2363516_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	NA	NA	NA	NA
AZG55066.1|2363763_2364240_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AZG55067.1|2364395_2364689_-	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
AZG55068.1|2364814_2365444_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
AZG55069.1|2365543_2367478_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
AZG55070.1|2367567_2368416_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
AZG55071.1|2368408_2369746_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AZG55072.1|2369973_2370306_+	protein-export membrane protein SecG	NA	NA	NA	NA	NA
AZG55073.1|2370884_2372492_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
AZG55074.1|2372499_2373843_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
AZG55075.1|2374844_2376017_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.7	8.3e-230
>prophage 12
CP034067	Shigella sonnei strain FDAARGOS_524 chromosome, complete genome	4828074	2458657	2533130	4828074	tRNA,transposase,protease	Enterobacterial_phage(10.0%)	55	NA	NA
AZG55142.1|2458657_2459377_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AZG55143.1|2459537_2460590_+	adenine DNA glycosylase	NA	NA	NA	NA	NA
AZG55144.1|2460617_2460893_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AZG55145.1|2460957_2462037_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
AZG55146.1|2462238_2463495_+	nucleoside permease NupG	NA	NA	NA	NA	NA
AZG55147.1|2465251_2467189_-	ornithine decarboxylase	NA	NA	NA	NA	NA
AZG55148.1|2467599_2468307_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
AZG55149.1|2469794_2470814_+|transposase	IS110 family transposase ISEc11	transposase	NA	NA	NA	NA
AZG55150.1|2470916_2471150_-	hypothetical protein	NA	NA	NA	NA	NA
AZG55151.1|2471489_2471753_-	hypothetical protein	NA	NA	NA	NA	NA
AZG55152.1|2471841_2475357_+	DNA helicase	NA	NA	NA	NA	NA
AZG55153.1|2476429_2477467_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
AZG55154.1|2477456_2477663_-	hypothetical protein	NA	NA	NA	NA	NA
AZG55155.1|2477827_2481685_+|protease	serine protease autotransporter toxin SigA	protease	Q9LA58	Enterobacterial_phage	38.4	3.5e-224
AZG55156.1|2481731_2482313_+	hypothetical protein	NA	NA	NA	NA	NA
AZG55157.1|2483295_2484654_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AZG55158.1|2484699_2485458_-	hypothetical protein	NA	NA	NA	NA	NA
AZG55159.1|2485489_2486203_-	thymidylate kinase	NA	NA	NA	NA	NA
AZG55160.1|2486376_2486616_+	hypothetical protein	NA	NA	NA	NA	NA
AZG55161.1|2486631_2487663_-|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
AZG55162.1|2488413_2488863_-	evolved beta-galactosidase subunit beta	NA	NA	NA	NA	NA
AZG55163.1|2492185_2493514_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
AZG55164.1|2493573_2494557_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
AZG55165.1|2494775_2495108_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
AZG55166.1|2495149_2496640_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.4	3.1e-32
AZG55167.1|2496946_2498467_+	PAS domain S-box protein	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
AZG55168.1|2498573_2499197_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AZG55169.1|2499484_2500249_+	siderophore-interacting protein	NA	NA	NA	NA	NA
AZG55170.1|2500502_2501009_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
AZG55171.1|2501113_2501329_+	hypothetical protein	NA	NA	NA	NA	NA
AZG55172.1|2501288_2502086_-	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	100.0	6.6e-146
AZG55173.1|2504659_2506501_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
AZG55174.1|2506695_2508441_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
AZG55175.1|2508551_2508767_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AZG55176.1|2509003_2510017_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
AZG55177.1|2510059_2511523_-	L-tartrate/succinate antiporter	NA	NA	NA	NA	NA
AZG55178.1|2511571_2512177_-	L(+)-tartrate dehydratase subunit beta	NA	NA	NA	NA	NA
AZG55179.1|2512173_2513085_-	L+-tartrate dehydratase subunit alpha	NA	NA	NA	NA	NA
AZG55180.1|2514236_2514854_-	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AZG55181.1|2514958_2515327_+	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
AZG55182.1|2515417_2516239_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
AZG55183.1|2516401_2517640_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	51.0	6.5e-92
AZG55184.1|2517703_2518324_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
AZG55185.1|2518565_2519867_+	inorganic triphosphatase	NA	NA	NA	NA	NA
AZG55186.1|2519889_2522730_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
AZG55187.1|2522777_2524211_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
AZG57162.1|2524330_2524390_-	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
AZG57163.1|2524706_2524766_-	small toxic protein IbsD	NA	NA	NA	NA	NA
AZG55188.1|2525004_2526666_-	flotillin family protein	NA	NA	NA	NA	NA
AZG55189.1|2526692_2527322_-	DUF1449 family protein	NA	NA	NA	NA	NA
AZG55190.1|2527590_2527791_+	glycogen synthase	NA	NA	NA	NA	NA
AZG55191.1|2527937_2528969_+|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
AZG55192.1|2528988_2530053_-	hypothetical protein	NA	NA	NA	NA	NA
AZG55193.1|2530054_2530804_-	molecular chaperone	NA	NA	NA	NA	NA
AZG55194.1|2531857_2533130_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 13
CP034067	Shigella sonnei strain FDAARGOS_524 chromosome, complete genome	4828074	2839807	2847748	4828074		uncultured_Mediterranean_phage(33.33%)	8	NA	NA
AZG55449.1|2839807_2840569_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
AZG55450.1|2840562_2841189_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.1	2.2e-35
AZG55451.1|2841328_2842468_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AZG55452.1|2842530_2843523_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AZG55453.1|2843616_2844981_-	GntP family transporter	NA	NA	NA	NA	NA
AZG55454.1|2845069_2845846_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AZG55455.1|2845850_2846489_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AZG55456.1|2846485_2847748_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	1.4e-134
>prophage 14
CP034067	Shigella sonnei strain FDAARGOS_524 chromosome, complete genome	4828074	2890625	2989809	4828074	head,plate,portal,tail,tRNA,holin,terminase,transposase,protease	Enterobacteria_phage(53.33%)	101	NA	NA
AZG55494.1|2890625_2893256_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
AZG55495.1|2893490_2893676_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
AZG55496.1|2894999_2895566_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
AZG55497.1|2895562_2895991_+	DedA family protein	NA	NA	NA	NA	NA
AZG55498.1|2896063_2897620_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AZG55499.1|2897769_2898285_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
AZG55500.1|2898348_2899887_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
AZG55501.1|2899903_2901076_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
AZG55502.1|2901202_2901733_-	multidrug efflux transporter EmrAB transcriptional repressor EmrR	NA	NA	NA	NA	NA
AZG55503.1|2901823_2902159_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
AZG55504.1|2902148_2902886_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AZG55505.1|2903009_2904194_-	MFS transporter	NA	NA	NA	NA	NA
AZG55506.1|2904484_2905477_-	proline/glycine betaine ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
AZG55507.1|2905534_2906599_-	proline/glycine betaine ABC transporter permease ProW	NA	NA	NA	NA	NA
AZG55508.1|2906591_2907794_-	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
AZG55509.1|2907783_2908032_-	hypothetical protein	NA	NA	NA	NA	NA
AZG55510.1|2908149_2909109_-	ribonucleoside-diphosphate reductase 2 subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
AZG55511.1|2909118_2911263_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.1	2.4e-195
AZG55512.1|2911642_2911888_-	NrdH-redoxin	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
AZG55513.1|2912135_2912465_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
AZG55514.1|2912616_2912961_+	DUF2002 family protein	NA	NA	NA	NA	NA
AZG55515.1|2912997_2913447_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
AZG55516.1|2913855_2915052_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZG55517.1|2915566_2915971_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
AZG55518.1|2916017_2916542_-	rhodanese-like domain-containing protein YgaP	NA	NA	NA	NA	NA
AZG55519.1|2916551_2916851_-	transcriptional regulator	NA	NA	NA	NA	NA
AZG55520.1|2917033_2917192_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
AZG55521.1|2917275_2917725_+	peptidoglycan-binding protein LysM	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
AZG55522.1|2917725_2918388_-	transcriptional regulator	NA	NA	NA	NA	NA
AZG55523.1|2918408_2919725_-	GABA permease	NA	NA	NA	NA	NA
AZG55524.1|2920035_2921316_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	3.2e-33
AZG55525.1|2921329_2922778_-	NADP-dependent succinate-semialdehyde dehydrogenase I	NA	NA	NA	NA	NA
AZG55526.1|2922800_2924069_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
AZG55527.1|2924088_2925066_-	protein CsiD	NA	NA	NA	NA	NA
AZG55528.1|2925401_2926955_-	alpha-amylase	NA	NA	NA	NA	NA
AZG55529.1|2930360_2931839_+	hypothetical protein	NA	NA	NA	NA	NA
AZG55530.1|2932222_2932411_+	DNA invertase	NA	A0A1S6L009	Salmonella_phage	69.2	1.6e-05
AZG55531.1|2932565_2932685_+	ATPase	NA	NA	NA	NA	NA
AZG55532.1|2932749_2934129_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AZG55533.1|2934204_2935432_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.3	6.3e-172
AZG55534.1|2935548_2936940_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	96.8	7.0e-260
AZG55535.1|2936951_2937194_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	95.0	3.9e-33
AZG55536.1|2937193_2937565_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.0	8.0e-38
AZG55537.1|2937554_2937941_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.9	1.1e-58
AZG55538.1|2937945_2938170_+	hypothetical protein	NA	NA	NA	NA	NA
AZG55539.1|2938421_2938985_+	ORF6N domain-containing protein	NA	Q8HA19	Enterobacteria_phage	56.9	2.6e-40
AZG55540.1|2940165_2940381_+|holin	holin	holin	M1FN85	Enterobacteria_phage	91.5	4.2e-31
AZG55541.1|2940380_2940878_+	lysozyme	NA	A5LH83	Enterobacteria_phage	98.2	2.4e-90
AZG55542.1|2941094_2941277_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	75.4	1.4e-16
AZG55543.1|2941381_2941732_+	HNH endonuclease	NA	Q8W633	Enterobacteria_phage	99.1	4.7e-64
AZG55544.1|2941853_2942348_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	8.6e-88
AZG57176.1|2942581_2944078_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	99.4	3.7e-299
AZG55545.1|2944089_2944272_+	hypothetical protein	NA	Q8W630	Enterobacteria_phage	98.3	2.9e-25
AZG55546.1|2944396_2945428_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	97.6	1.1e-193
AZG55547.1|2946543_2947817_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AZG55548.1|2948217_2948559_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AZG55549.1|2948707_2950369_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AZG55550.1|2950454_2951333_-	NAD(+) kinase	NA	NA	NA	NA	NA
AZG57177.1|2951264_2951459_+	molecular chaperone GrpE	NA	NA	NA	NA	NA
AZG55551.1|2951455_2952049_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AZG57178.1|2952103_2953345_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AZG57179.1|2953410_2954202_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AZG55552.1|2954368_2955730_+	signal recognition particle protein	NA	NA	NA	NA	NA
AZG55553.1|2955978_2956227_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AZG55554.1|2956245_2956794_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AZG55555.1|2956824_2957592_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AZG55556.1|2957633_2957981_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AZG55557.1|2958057_2958540_-	OmpA family protein	NA	NA	NA	NA	NA
AZG55558.1|2959666_2960464_-	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	100.0	6.6e-146
AZG55559.1|2960463_2961636_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.7	2.8e-230
AZG55560.1|2961709_2961901_-	diguanylate cyclase	NA	NA	NA	NA	NA
AZG55561.1|2961916_2962120_+|transposase	transposase	transposase	NA	NA	NA	NA
AZG55562.1|2962171_2963327_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.2e-66
AZG55563.1|2963427_2963946_-	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AZG55564.1|2964860_2965238_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
AZG55565.1|2965446_2966517_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
AZG55566.1|2966527_2967649_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AZG55567.1|2967691_2968852_-	P-protein	NA	NA	NA	NA	NA
AZG57180.1|2968951_2968999_-	hypothetical protein	NA	NA	NA	NA	NA
AZG55568.1|2969102_2969444_-	ribosome-associated inhibitor A	NA	NA	NA	NA	NA
AZG55569.1|2969704_2971033_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
AZG55570.1|2971144_2971435_-	RnfH family protein	NA	NA	NA	NA	NA
AZG55571.1|2971424_2971901_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
AZG55572.1|2972032_2972515_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
AZG55573.1|2973290_2973914_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	77.4	1.3e-80
AZG55574.1|2973864_2975133_-|tail	phage tail protein	tail	Q8W611	Enterobacteria_phage	43.7	3.2e-78
AZG57181.1|2975156_2975645_-|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	77.9	6.0e-65
AZG55575.1|2975704_2976745_-|tail	phage tail protein	tail	Q8W613	Enterobacteria_phage	83.5	1.5e-158
AZG55576.1|2976731_2977322_-	DUF2313 domain-containing protein	NA	Q8W614	Enterobacteria_phage	98.0	1.4e-113
AZG55577.1|2977321_2977825_-|plate	baseplate J/gp47 family protein	plate	Q8W615	Enterobacteria_phage	95.8	3.7e-86
AZG55578.1|2979173_2979584_-	hypothetical protein	NA	Q8W616	Enterobacteria_phage	94.9	1.5e-69
AZG55579.1|2979589_2980123_-|plate	phage baseplate assembly protein V	plate	Q8W617	Enterobacteria_phage	96.0	3.7e-92
AZG55580.1|2980100_2981183_-|plate	baseplate protein	plate	Q8W618	Enterobacteria_phage	98.8	8.0e-195
AZG55581.1|2981179_2982571_-	DNA circularization protein	NA	Q8W619	Enterobacteria_phage	95.7	1.4e-247
AZG57182.1|2982617_2982824_-	hypothetical protein	NA	NA	NA	NA	NA
AZG55582.1|2983944_2985894_-|tail	phage tail tape measure protein	tail	Q8W620	Enterobacteria_phage	97.8	0.0e+00
AZG57183.1|2985978_2986308_-|tail	phage tail assembly protein	tail	Q8W621	Enterobacteria_phage	98.2	8.7e-52
AZG55583.1|2986313_2986670_-|tail	phage tail protein	tail	Q8W622	Enterobacteria_phage	98.3	5.3e-63
AZG55584.1|2986669_2988166_-|tail	phage tail protein	tail	Q8W623	Enterobacteria_phage	97.2	6.5e-272
AZG55585.1|2988228_2989385_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	5.7e-66
AZG55586.1|2989446_2989809_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	1.1e-63
>prophage 15
CP034067	Shigella sonnei strain FDAARGOS_524 chromosome, complete genome	4828074	3015402	3073187	4828074	tRNA,transposase,tail	Stx2-converting_phage(33.33%)	57	NA	NA
AZG57184.1|3015402_3016140_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase	tRNA	NA	NA	NA	NA
AZG55603.1|3017093_3018250_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.2e-66
AZG55604.1|3019269_3019425_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
AZG55605.1|3019421_3019997_+	ECF RNA polymerase sigma-E factor	NA	NA	NA	NA	NA
AZG55606.1|3020029_3020680_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
AZG55607.1|3020679_3021636_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
AZG55608.1|3021632_3022112_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
AZG55609.1|3022309_3024109_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
AZG55610.1|3024124_3025099_+	signal peptidase I	NA	NA	NA	NA	NA
AZG55611.1|3025371_3026052_+	ribonuclease 3	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
AZG55612.1|3026048_3026954_+	GTPase Era	NA	NA	NA	NA	NA
AZG55613.1|3026965_3027694_+	DNA repair protein RecO	NA	NA	NA	NA	NA
AZG55614.1|3027705_3028437_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AZG55615.1|3028436_3028817_+	holo-ACP synthase	NA	NA	NA	NA	NA
AZG55616.1|3029038_3029119_+	small toxic protein ShoB	NA	NA	NA	NA	NA
AZG55617.1|3029312_3029573_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
AZG55618.1|3029787_3030990_+	recombinase	NA	NA	NA	NA	NA
AZG55619.1|3031162_3032350_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AZG55620.1|3032790_3033963_+|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	100.0	2.2e-230
AZG55621.1|3033962_3034760_+	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	100.0	6.6e-146
AZG55622.1|3035140_3036353_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	2.7e-167
AZG55623.1|3036764_3037076_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
AZG55624.1|3037260_3038532_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
AZG55625.1|3038528_3038915_+	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
AZG55626.1|3038911_3040216_+	DNA helicase	NA	NA	NA	NA	NA
AZG55627.1|3041037_3041598_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
AZG55628.1|3041727_3041940_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
AZG55629.1|3042306_3043463_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AZG55630.1|3043593_3044721_+|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
AZG57185.1|3045848_3046229_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	4.2e-66
AZG55631.1|3046225_3046573_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	98.3	5.3e-60
AZG55632.1|3046622_3048161_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	94.3	1.0e-283
AZG55633.1|3049185_3050361_-	enterotoxin production-related protein TieB	NA	NA	NA	NA	NA
AZG57186.1|3050299_3050521_+	hypothetical protein	NA	NA	NA	NA	NA
AZG55634.1|3050429_3052691_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AZG55635.1|3052859_3053636_-	energy transducer TonB	NA	NA	NA	NA	NA
AZG55636.1|3053643_3054519_-	iron-regulated protein	NA	NA	NA	NA	NA
AZG55637.1|3055959_3057233_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AZG55638.1|3057990_3058173_-	hypothetical protein	NA	NA	NA	NA	NA
AZG55639.1|3058176_3058386_+	hypothetical protein	NA	NA	NA	NA	NA
AZG55640.1|3058403_3058739_-	colicin transporter	NA	NA	NA	NA	NA
AZG55641.1|3058867_3059215_+	hypothetical protein	NA	NA	NA	NA	NA
AZG55642.1|3059234_3059825_-	hypothetical protein	NA	NA	NA	NA	NA
AZG55643.1|3059821_3060082_-	hypothetical protein	NA	NA	NA	NA	NA
AZG55644.1|3060179_3061392_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.9e-168
AZG55645.1|3061767_3062895_+|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
AZG55646.1|3063221_3063440_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	100.0	2.4e-34
AZG55647.1|3063491_3064647_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.2e-66
AZG57187.1|3064728_3064890_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	96.2	8.6e-21
AZG55648.1|3064886_3065234_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	98.3	5.3e-60
AZG55649.1|3065801_3066968_+|tail	phage tail protein	tail	Q8W611	Enterobacteria_phage	38.9	4.9e-57
AZG55650.1|3067540_3067720_+	hypothetical protein	NA	NA	NA	NA	NA
AZG55651.1|3067720_3069547_-	invasion protein	NA	NA	NA	NA	NA
AZG55652.1|3070646_3070829_+	hypothetical protein	NA	NA	NA	NA	NA
AZG55653.1|3070933_3071782_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AZG55654.1|3071990_3072626_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
AZG55655.1|3072650_3073187_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
>prophage 16
CP034067	Shigella sonnei strain FDAARGOS_524 chromosome, complete genome	4828074	3241247	3367977	4828074	capsid,head,portal,tail,tRNA,holin,terminase,lysis,transposase	Enterobacteria_phage(56.0%)	108	NA	NA
AZG55795.1|3241247_3242663_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
AZG55796.1|3242714_3243107_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZG55797.1|3243108_3243468_-	hypothetical protein	NA	NA	NA	NA	NA
AZG55798.1|3246325_3247528_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
AZG55799.1|3247863_3249102_+	divalent metal cation transporter	NA	NA	NA	NA	NA
AZG55800.1|3249242_3249569_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
AZG55801.1|3249683_3250940_-	ion channel protein	NA	NA	NA	NA	NA
AZG55802.1|3251143_3252109_+	glucokinase	NA	NA	NA	NA	NA
AZG55803.1|3252328_3252655_+	fructose-like phosphotransferase enzyme IIB component 1	NA	NA	NA	NA	NA
AZG55804.1|3252676_3253924_+	fructose-like permease IIC component	NA	NA	NA	NA	NA
AZG55805.1|3255023_3256061_+	aminopeptidase	NA	NA	NA	NA	NA
AZG55806.1|3258583_3259441_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZG55807.1|3259453_3260188_-	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
AZG55808.1|3263053_3264292_+	glutamate--pyruvate aminotransferase AlaC	NA	NA	NA	NA	NA
AZG57193.1|3264356_3264428_-	membrane protein YpdK	NA	NA	NA	NA	NA
AZG55809.1|3264783_3265704_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	1.1e-75
AZG55810.1|3266056_3266299_+	DUF2545 family protein	NA	NA	NA	NA	NA
AZG55811.1|3266375_3266651_-	lipoprotein	NA	NA	NA	NA	NA
AZG55812.1|3266947_3267571_+	hypothetical protein	NA	NA	NA	NA	NA
AZG55813.1|3268083_3269334_+	formyl-CoA--oxalate CoA-transferase	NA	NA	NA	NA	NA
AZG55814.1|3269387_3271082_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.4e-23
AZG55815.1|3271151_3272096_+	transporter YfdV	NA	NA	NA	NA	NA
AZG55816.1|3272169_3273315_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
AZG55817.1|3273370_3276964_-	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	6.0e-37
AZG55818.1|3276968_3277583_-	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
AZG55819.1|3277998_3279162_+	multidrug efflux MFS transporter periplasmic adaptor subunit EmrK	NA	NA	NA	NA	NA
AZG55820.1|3279161_3280700_+	multidrug efflux MFS transporter permease subunit EmrY	NA	NA	NA	NA	NA
AZG55821.1|3280807_3282136_-	D-serine dehydratase	NA	NA	NA	NA	NA
AZG57194.1|3282602_3283598_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AZG55822.1|3283605_3285039_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	5.3e-29
AZG55823.1|3285283_3286612_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
AZG55824.1|3287175_3288343_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.7	5.8e-183
AZG57195.1|3288300_3288648_+	fructokinase	NA	NA	NA	NA	NA
AZG55825.1|3289559_3290162_-	hypothetical protein	NA	NA	NA	NA	NA
AZG55826.1|3290403_3290748_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	97.4	1.9e-57
AZG55827.1|3290870_3291071_+	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
AZG55828.1|3291599_3292847_-	MFS transporter	NA	NA	NA	NA	NA
AZG55829.1|3293580_3294378_-	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	100.0	6.6e-146
AZG55830.1|3294377_3295550_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.7	6.3e-230
AZG55831.1|3296413_3296791_-	hypothetical protein	NA	NA	NA	NA	NA
AZG55832.1|3297055_3297511_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.2	2.7e-59
AZG55833.1|3297510_3297681_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
AZG55834.1|3297673_3297964_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	3.0e-48
AZG55835.1|3297960_3298323_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	7.3e-60
AZG55836.1|3298319_3298460_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
AZG55837.1|3298545_3298929_+	antitermination protein	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
AZG55838.1|3299117_3300200_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	76.3	8.9e-154
AZG55839.1|3301548_3301764_+|holin	holin	holin	A5LH82	Enterobacteria_phage	100.0	2.6e-33
AZG55840.1|3301763_3302261_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	94.5	2.1e-86
AZG55841.1|3302257_3302716_+|lysis	lysis protein	lysis	K7PJW6	Enterobacteria_phage	80.9	1.2e-56
AZG55842.1|3302917_3303415_+	DNA-binding protein	NA	A0A220NRM9	Escherichia_phage	100.0	1.1e-93
AZG55843.1|3303411_3303669_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	98.8	1.5e-38
AZG55844.1|3303672_3303861_-	hypothetical protein	NA	NA	NA	NA	NA
AZG55845.1|3305337_3305547_-	hypothetical protein	NA	NA	NA	NA	NA
AZG55846.1|3305592_3306003_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
AZG55847.1|3306060_3306294_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	9.5e-21
AZG55848.1|3306682_3307228_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
AZG55849.1|3307202_3309128_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
AZG55850.1|3309124_3309331_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AZG55851.1|3309327_3310929_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	2.2e-310
AZG55852.1|3310909_3312229_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
AZG55853.1|3312238_3312571_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
AZG55854.1|3312626_3313652_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	4.3e-190
AZG55855.1|3313693_3314092_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	83.3	1.2e-50
AZG55856.1|3314103_3314457_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	99.1	4.4e-62
AZG55857.1|3314468_3315047_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	89.6	2.0e-80
AZG55858.1|3315043_3315439_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
AZG57196.1|3315446_3316187_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.6	1.0e-129
AZG55859.1|3316202_3316625_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
AZG55860.1|3316606_3317041_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	2.0e-64
AZG55861.1|3317033_3319595_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	89.2	0.0e+00
AZG55862.1|3319591_3319921_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	97.2	3.1e-57
AZG55863.1|3319920_3320619_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	8.1e-132
AZG55864.1|3320624_3321368_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	99.2	7.5e-152
AZG55865.1|3321304_3321937_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	97.6	1.6e-94
AZG55866.1|3321997_3325495_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.6	0.0e+00
AZG55867.1|3326146_3329230_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	7.3e-68
AZG55868.1|3329229_3329811_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	8.0e-101
AZG55869.1|3332789_3333947_-	DUF4102 domain-containing protein	NA	A5VW56	Enterobacteria_phage	99.5	1.4e-221
AZG55870.1|3334258_3335191_-	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
AZG55871.1|3335484_3336240_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AZG55872.1|3338419_3339616_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZG55873.1|3340081_3341422_-	long-chain fatty acid transporter	NA	NA	NA	NA	NA
AZG55874.1|3341793_3342078_+	DUF406 family protein	NA	NA	NA	NA	NA
AZG55875.1|3342257_3343568_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AZG55876.1|3343567_3345712_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AZG55877.1|3345914_3346400_+	phosphohistidine phosphatase	NA	NA	NA	NA	NA
AZG55878.1|3347083_3347647_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AZG55879.1|3347728_3350371_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AZG55880.1|3351158_3351665_+	fimbrial protein	NA	NA	NA	NA	NA
AZG55881.1|3351636_3351753_+	fimbrial protein	NA	NA	NA	NA	NA
AZG55882.1|3351703_3352132_+	fimbrial protein	NA	NA	NA	NA	NA
AZG55883.1|3352128_3352653_+	fimbrial protein	NA	NA	NA	NA	NA
AZG55884.1|3352654_3353512_+	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
AZG55885.1|3353633_3354185_-	endonuclease SmrB	NA	NA	NA	NA	NA
AZG55886.1|3354350_3355283_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AZG55887.1|3355317_3356403_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
AZG55888.1|3356406_3357231_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AZG55889.1|3357230_3358040_+	hypothetical protein	NA	NA	NA	NA	NA
AZG55890.1|3358039_3358588_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AZG55891.1|3358621_3358900_+	YfcL family protein	NA	NA	NA	NA	NA
AZG55892.1|3359020_3361027_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AZG55893.1|3361185_3362406_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
AZG55894.1|3362680_3363859_+	MFS transporter	NA	NA	NA	NA	NA
AZG55895.1|3363855_3364851_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
AZG55896.1|3364949_3366086_+	erythronate-4-phosphate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
AZG55897.1|3366151_3367165_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AZG55898.1|3367164_3367977_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 17
CP034067	Shigella sonnei strain FDAARGOS_524 chromosome, complete genome	4828074	3595830	3603269	4828074		Enterobacteria_phage(100.0%)	7	NA	NA
AZG56083.1|3595830_3596079_-	DNA damage-inducible protein DinI	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
AZG57200.1|3596593_3598279_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.5	9.5e-304
AZG56084.1|3598275_3598995_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AZG56085.1|3599041_3599512_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AZG56086.1|3599552_3600014_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AZG56087.1|3600135_3602136_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.5	0.0e+00
AZG56088.1|3602132_3603269_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	8.5e-163
>prophage 18
CP034067	Shigella sonnei strain FDAARGOS_524 chromosome, complete genome	4828074	3737507	3796101	4828074	transposase	Shigella_phage(27.27%)	49	NA	NA
AZG56199.1|3737507_3738539_-|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
AZG56200.1|3739721_3740889_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
AZG57207.1|3747340_3748138_-	protein MtfA	NA	NA	NA	NA	NA
AZG56201.1|3749375_3750648_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AZG56202.1|3751099_3751771_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
AZG56203.1|3752006_3752642_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
AZG56204.1|3752642_3753647_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
AZG56205.1|3753755_3754169_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AZG56206.1|3754301_3754973_+	DNA-binding response regulator HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
AZG56207.1|3754972_3756331_+	HAMP domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	8.7e-05
AZG56208.1|3757515_3758367_-	Molecular chaperone Hsp31 and glyoxalase 3	NA	NA	NA	NA	NA
AZG56209.1|3761464_3761830_+	permease	NA	NA	NA	NA	NA
AZG56210.1|3761869_3762526_+	phosphohydrolase	NA	NA	NA	NA	NA
AZG56211.1|3762592_3764011_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	4.0e-101
AZG56212.1|3763991_3764462_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	4.4e-33
AZG56213.1|3765544_3766462_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AZG56214.1|3766540_3766723_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AZG56215.1|3766893_3768588_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
AZG56216.1|3768584_3769400_-	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
AZG56217.1|3769697_3769925_-	DUF2525 domain-containing protein	NA	NA	NA	NA	NA
AZG56218.1|3770033_3770276_+	protein DsrB	NA	NA	NA	NA	NA
AZG56219.1|3770319_3770943_-	transcriptional regulator RcsA	NA	NA	NA	NA	NA
AZG56220.1|3771227_3772013_-	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
AZG56221.1|3772021_3772291_-	flagellar biosynthetic protein FliQ	NA	NA	NA	NA	NA
AZG56222.1|3772300_3773038_-	flagellar biosynthetic protein FliP	NA	NA	NA	NA	NA
AZG56223.1|3773037_3773403_-	flagellar protein FliO	NA	NA	NA	NA	NA
AZG56224.1|3773405_3773819_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
AZG56225.1|3773815_3774820_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
AZG56226.1|3774824_3775289_-	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
AZG56227.1|3775393_3776521_-	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
AZG56228.1|3776517_3776961_-	flagellar protein FliJ	NA	NA	NA	NA	NA
AZG56229.1|3776979_3778353_-	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
AZG56230.1|3778352_3779039_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
AZG56231.1|3779031_3780027_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
AZG56232.1|3780019_3781678_-	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
AZG57208.1|3781893_3782208_+	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
AZG56233.1|3782541_3782874_+	multidrug SMR transporter	NA	NA	NA	NA	NA
AZG56234.1|3783042_3783594_+	kinase inhibitor	NA	NA	NA	NA	NA
AZG56235.1|3783603_3784401_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZG56236.1|3784920_3786194_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.1e-170
AZG56237.1|3787906_3789115_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	91.5	8.9e-211
AZG56238.1|3789154_3789826_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	4.8e-81
AZG56239.1|3789932_3790166_-	SirA-like protein	NA	NA	NA	NA	NA
AZG56240.1|3790162_3791368_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
AZG56241.1|3791554_3791968_+	lipoprotein	NA	NA	NA	NA	NA
AZG56242.1|3792001_3793489_-	alpha-amylase	NA	NA	NA	NA	NA
AZG56243.1|3793566_3793932_-	flagellar protein FliT	NA	NA	NA	NA	NA
AZG56244.1|3793931_3794342_-	flagella export chaperone FliS	NA	NA	NA	NA	NA
AZG56245.1|3794945_3796101_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
>prophage 19
CP034067	Shigella sonnei strain FDAARGOS_524 chromosome, complete genome	4828074	3850140	3905921	4828074	capsid,tail,holin,transposase,protease	Escherichia_phage(25.81%)	57	NA	NA
AZG56288.1|3850140_3851296_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AZG56289.1|3851398_3851695_-	YciI family protein	NA	NA	NA	NA	NA
AZG56290.1|3852493_3853045_+	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	40.9	1.5e-27
AZG56291.1|3854608_3855166_+	hypothetical protein	NA	NA	NA	NA	NA
AZG56292.1|3855166_3855445_+	hypothetical protein	NA	NA	NA	NA	NA
AZG56293.1|3855447_3855720_+	HNH endonuclease	NA	NA	NA	NA	NA
AZG56294.1|3855719_3855920_+	hypothetical protein	NA	NA	NA	NA	NA
AZG56295.1|3856983_3857199_+	hypothetical protein	NA	NA	NA	NA	NA
AZG56296.1|3857714_3858425_+|transposase	transposase	transposase	NA	NA	NA	NA
AZG56297.1|3858447_3858657_+	hypothetical protein	NA	NA	NA	NA	NA
AZG56298.1|3860096_3861128_-|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
AZG56299.1|3861702_3862858_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AZG56300.1|3863881_3865155_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AZG56301.1|3865617_3867138_-	recombinase family protein	NA	NA	NA	NA	NA
AZG57212.1|3867228_3867948_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
AZG56302.1|3867987_3868386_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
AZG56303.1|3868490_3869030_-	septation protein A	NA	NA	NA	NA	NA
AZG56304.1|3869059_3869803_-	UPF0259 family protein	NA	NA	NA	NA	NA
AZG56305.1|3870159_3870798_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
AZG56306.1|3871218_3871437_-	DUF4014 domain-containing protein	NA	A0A1I9LJM2	Stx_converting_phage	91.7	5.2e-29
AZG56307.1|3871469_3871682_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	90.0	4.4e-33
AZG56308.1|3872565_3872952_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.0	9.5e-58
AZG56309.1|3873019_3874175_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AZG56310.1|3874187_3874418_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	76.9	5.0e-22
AZG56311.1|3874428_3874596_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
AZG56312.1|3874592_3874937_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	99.1	3.8e-58
AZG56313.1|3875171_3875384_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
AZG57213.1|3875687_3875960_+	hypothetical protein	NA	NA	NA	NA	NA
AZG56314.1|3875961_3877020_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.4	1.3e-88
AZG56315.1|3877020_3877401_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.5e-34
AZG56316.1|3877397_3878219_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.7	1.4e-79
AZG56317.1|3878443_3878641_+	TrmB family transcriptional regulator	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
AZG56318.1|3878791_3879850_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	94.6	2.3e-199
AZG56319.1|3880627_3881784_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.8e-67
AZG56320.1|3882382_3884236_+	DUF1737 domain-containing protein	NA	Q08JA2	Stx2-converting_phage	90.2	0.0e+00
AZG56321.1|3884386_3884602_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
AZG56322.1|3884606_3884921_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	99.0	8.3e-52
AZG56323.1|3885354_3886511_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AZG56324.1|3886865_3887393_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	84.0	7.1e-80
AZG56325.1|3887421_3887955_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	85.9	3.4e-82
AZG57214.1|3888946_3889129_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
AZG56326.1|3889245_3889383_+|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AZG56327.1|3889327_3889996_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZG56328.1|3890733_3891291_-	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
AZG57215.1|3891287_3891563_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
AZG56329.1|3892737_3893544_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AZG56330.1|3893543_3894737_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AZG57216.1|3894748_3896107_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
AZG56331.1|3896110_3897706_-	bifunctional glutamine amidotransferase/anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
AZG56332.1|3897705_3899268_-	anthranilate synthase component I	NA	NA	NA	NA	NA
AZG57217.1|3899359_3899404_-	trp operon leader peptide	NA	NA	NA	NA	NA
AZG56333.1|3899541_3900423_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
AZG56334.1|3900419_3901040_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AZG56335.1|3902394_3903267_+	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
AZG56336.1|3903306_3903897_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AZG56337.1|3903893_3904652_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	2.6e-06
AZG56338.1|3904871_3905921_+|protease	protease	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 20
CP034067	Shigella sonnei strain FDAARGOS_524 chromosome, complete genome	4828074	3975677	4084211	4828074	tRNA,transposase,protease,tail	Escherichia_phage(29.27%)	87	NA	NA
AZG56393.1|3975677_3976374_+|transposase	IS1-like element IS1A family transposase	transposase	A0A077SLN4	Escherichia_phage	98.3	4.0e-131
AZG56394.1|3976818_3977076_+	DUF2534 family protein	NA	NA	NA	NA	NA
AZG56395.1|3977125_3978076_-	universal stress protein E	NA	NA	NA	NA	NA
AZG56396.1|3978227_3978980_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
AZG56397.1|3979174_3979690_-	methylated-DNA--protein-cysteine methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	2.4e-24
AZG56398.1|3980175_3981332_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AZG56399.1|3982530_3983976_-	amidohydrolase	NA	NA	NA	NA	NA
AZG56400.1|3983975_3985286_-	amidohydrolase	NA	NA	NA	NA	NA
AZG56401.1|3985461_3986370_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZG56402.1|3986699_3987263_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
AZG56403.1|3987283_3988516_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
AZG56404.1|3988770_3989754_+	zinc transporter ZntB	NA	NA	NA	NA	NA
AZG56405.1|3990231_3991605_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
AZG56406.1|3991733_3992669_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
AZG56407.1|3993254_3994411_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AZG56408.1|3995399_3995723_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.1	3.8e-52
AZG56409.1|3995815_3996034_+	DUF4014 domain-containing protein	NA	A0A1I9LJM2	Stx_converting_phage	91.7	6.8e-29
AZG56410.1|3996035_3996401_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	100.0	5.1e-69
AZG56411.1|3996397_3997063_+	hypothetical protein	NA	A0A076G611	Escherichia_phage	44.9	4.6e-36
AZG56412.1|3997062_3997428_+	DUF551 domain-containing protein	NA	Q08J61	Stx2-converting_phage	53.0	2.3e-29
AZG56413.1|3997825_3998038_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	91.4	6.8e-26
AZG56414.1|3998892_3999162_+	hypothetical protein	NA	NA	NA	NA	NA
AZG56415.1|3999233_3999833_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	91.5	2.9e-106
AZG56416.1|3999832_4000123_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	89.6	1.5e-47
AZG56417.1|4000119_4000674_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	6.5e-68
AZG56418.1|4001399_4002556_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AZG56419.1|4002732_4003035_-|transposase	transposase	transposase	NA	NA	NA	NA
AZG56420.1|4003438_4003768_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	97.2	1.4e-57
AZG56421.1|4003777_4004476_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	94.0	1.0e-126
AZG56422.1|4004480_4005224_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	90.7	2.8e-138
AZG56423.1|4005160_4005763_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.1	7.3e-89
AZG56424.1|4005823_4009303_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	87.3	0.0e+00
AZG56425.1|4009370_4009970_+	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	93.5	2.7e-104
AZG56426.1|4010816_4011973_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AZG56427.1|4012687_4013843_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AZG56428.1|4013871_4014558_+|tail	phage tail protein	tail	NA	NA	NA	NA
AZG56429.1|4014508_4015132_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	78.1	3.1e-82
AZG56430.1|4015332_4016190_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AZG56431.1|4016186_4017044_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AZG56432.1|4017040_4017868_-	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	3.8e-11
AZG56433.1|4017867_4018782_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZG56434.1|4019367_4019802_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
AZG56435.1|4019942_4021076_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	5.4e-117
AZG56436.1|4021441_4024966_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
AZG56437.1|4025239_4025506_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AZG56438.1|4025502_4025925_-	heat-shock protein HslJ	NA	NA	NA	NA	NA
AZG56439.1|4026035_4027025_-	2-hydroxyacid dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
AZG56440.1|4027232_4029872_+	YdbH family protein	NA	NA	NA	NA	NA
AZG56441.1|4029868_4030054_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
AZG56442.1|4030061_4030388_+	DUF1318 domain-containing protein	NA	NA	NA	NA	NA
AZG56443.1|4030559_4030772_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZG56444.1|4030746_4032020_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AZG56445.1|4032690_4033846_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AZG56446.1|4034778_4036536_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
AZG56447.1|4036525_4037842_+	hypothetical protein	NA	NA	NA	NA	NA
AZG56448.1|4037892_4038498_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AZG56449.1|4038698_4042601_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
AZG56450.1|4042872_4043553_+	YdcF family protein	NA	NA	NA	NA	NA
AZG56451.1|4047570_4048101_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	4.1e-19
AZG56452.1|4048345_4048519_+	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
AZG56453.1|4048590_4048740_-	protein HokB	NA	NA	NA	NA	NA
AZG56454.1|4049138_4050779_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
AZG57220.1|4050816_4051740_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZG56455.1|4051956_4053300_+	VOC family protein	NA	NA	NA	NA	NA
AZG56456.1|4053524_4055180_+	glucan biosynthesis protein D	NA	NA	NA	NA	NA
AZG56457.1|4055319_4055544_+	DUF465 domain-containing protein	NA	NA	NA	NA	NA
AZG56458.1|4055606_4056143_+	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
AZG56459.1|4056137_4057118_-	LbetaH domain-containing protein	NA	NA	NA	NA	NA
AZG56460.1|4057241_4058234_+	TDT family transporter	NA	NA	NA	NA	NA
AZG56461.1|4058230_4058824_+	tellurite methyltransferase	NA	NA	NA	NA	NA
AZG56462.1|4061098_4062307_+|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	92.0	2.1e-204
AZG56463.1|4065645_4066182_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZG56464.1|4066254_4068216_+|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	28.9	9.2e-24
AZG56465.1|4068307_4068538_-	DUF2554 family protein	NA	NA	NA	NA	NA
AZG56466.1|4068637_4069794_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AZG57221.1|4070226_4070643_+	antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
AZG56467.1|4070721_4072128_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
AZG56468.1|4072372_4073518_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
AZG56469.1|4073535_4074549_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
AZG56470.1|4075439_4076234_+	ABC transporter permease	NA	NA	NA	NA	NA
AZG56471.1|4076255_4077680_+	aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
AZG56472.1|4078762_4078858_-	stress response membrane protein YncL	NA	NA	NA	NA	NA
AZG57222.1|4079052_4079226_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
AZG56473.1|4079311_4079545_+	DUF2526 domain-containing protein	NA	NA	NA	NA	NA
AZG56474.1|4079545_4079995_-	DMT family transporter	NA	NA	NA	NA	NA
AZG56475.1|4079991_4080510_-	L-methionine sulfoximine/L-methionine sulfone acetyltransferase	NA	NA	NA	NA	NA
AZG56476.1|4083054_4084211_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
>prophage 21
CP034067	Shigella sonnei strain FDAARGOS_524 chromosome, complete genome	4828074	4210917	4216640	4828074		Escherichia_phage(57.14%)	11	NA	NA
AZG56554.1|4210917_4211274_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	6.3e-56
AZG56555.1|4211331_4211754_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.5	2.1e-66
AZG56556.1|4211769_4212495_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	70.5	9.7e-88
AZG56557.1|4212516_4213263_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	82.1	4.0e-113
AZG56558.1|4213269_4214334_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.2	7.1e-63
AZG56559.1|4214405_4214831_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AZG56560.1|4214827_4215091_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZG56561.1|4215202_4215703_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	34.9	1.5e-15
AZG56562.1|4215722_4215917_+	antitoxin	NA	NA	NA	NA	NA
AZG56563.1|4215916_4216207_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AZG57227.1|4216487_4216640_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.7e-07
>prophage 22
CP034067	Shigella sonnei strain FDAARGOS_524 chromosome, complete genome	4828074	4429236	4490714	4828074	tRNA,transposase,protease,integrase	Acinetobacter_phage(25.0%)	59	4473363:4473377	4494528:4494542
AZG56747.1|4429236_4429740_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AZG56748.1|4429740_4429845_-	hypothetical protein	NA	NA	NA	NA	NA
AZG56749.1|4430014_4430461_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AZG56750.1|4430417_4431239_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZG56751.1|4431335_4432517_+	MFS transporter	NA	NA	NA	NA	NA
AZG56752.1|4432571_4432919_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AZG56753.1|4432940_4433195_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AZG56754.1|4433377_4434403_+	diguanylate cyclase	NA	NA	NA	NA	NA
AZG57237.1|4434435_4434534_+	hypothetical protein	NA	NA	NA	NA	NA
AZG57236.1|4434536_4434611_+	protein YoaJ	NA	NA	NA	NA	NA
AZG56755.1|4434669_4434918_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AZG56756.1|4435065_4435248_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
AZG56757.1|4435251_4435611_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
AZG56758.1|4435783_4436422_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
AZG57238.1|4436548_4437472_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZG56759.1|4437574_4438660_+	tartrate dehydrogenase	NA	NA	NA	NA	NA
AZG56760.1|4438910_4440521_+	BCCT family transporter YeaV	NA	NA	NA	NA	NA
AZG56761.1|4440552_4441677_+	ring-hydroxylating oxygenase subunit alpha	NA	NA	NA	NA	NA
AZG56762.1|4441732_4442698_+	oxidoreductase	NA	NA	NA	NA	NA
AZG56763.1|4442751_4443867_-	ribonuclease D	NA	NA	NA	NA	NA
AZG57239.1|4443948_4445634_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.2e-35
AZG56764.1|4445838_4446420_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
AZG56765.1|4446459_4447155_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AZG56766.1|4447212_4449123_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.7	6.5e-91
AZG57240.1|4449254_4449599_+	RidA family protein	NA	NA	NA	NA	NA
AZG56767.1|4450772_4451096_+	DUF1889 family protein	NA	NA	NA	NA	NA
AZG56768.1|4451215_4451395_-	YoaH family protein	NA	NA	NA	NA	NA
AZG56769.1|4451468_4452830_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
AZG56770.1|4452833_4453412_+	coenzyme A pyrophosphatase	NA	NA	NA	NA	NA
AZG56771.1|4453595_4454960_+	L-serine dehydratase 1	NA	NA	NA	NA	NA
AZG56772.1|4455090_4456689_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AZG56773.1|4456692_4458243_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
AZG56774.1|4458705_4459677_+	PTS mannose transporter subunit EIIAB	NA	NA	NA	NA	NA
AZG56775.1|4459739_4460540_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
AZG56776.1|4460552_4461404_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
AZG56777.1|4461458_4461917_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
AZG56778.1|4462345_4462912_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
AZG56779.1|4462908_4463718_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
AZG56780.1|4463883_4464093_-	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
AZG56781.1|4464105_4464249_-	DUF2627 domain-containing protein	NA	NA	NA	NA	NA
AZG56782.1|4464918_4465206_-	hypothetical protein	NA	NA	NA	NA	NA
AZG56783.1|4465280_4465424_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
AZG56784.1|4465582_4465822_+	hypothetical protein	NA	NA	NA	NA	NA
AZG56785.1|4465964_4466756_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
AZG56786.1|4468041_4468923_-|protease	protease HtpX	protease	NA	NA	NA	NA
AZG56787.1|4469114_4471163_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.8e-86
AZG56788.1|4471182_4471881_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AZG56789.1|4471977_4472475_-	GAF domain-containing protein	NA	NA	NA	NA	NA
AZG56790.1|4472604_4473888_+	paraquat-inducible membrane protein A	NA	NA	NA	NA	NA
4473363:4473377	attL	CCCGCTACGCCTGCG	NA	NA	NA	NA
AZG56791.1|4473856_4476490_+	PqiB family protein	NA	NA	NA	NA	NA
AZG57241.1|4476570_4478010_+	ribosomal RNA small subunit methyltransferase F	NA	NA	NA	NA	NA
AZG57242.1|4479245_4479437_+	DUF1482 family protein	NA	NA	NA	NA	NA
AZG56792.1|4479679_4480836_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.0e-67
AZG56793.1|4482788_4483944_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AZG56794.1|4484155_4485862_+	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
AZG56795.1|4485977_4487134_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
AZG57243.1|4487278_4487539_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	50.9	5.9e-11
AZG56796.1|4488071_4489344_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AZG56797.1|4489637_4490714_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	1.2e-97
4494528:4494542	attR	CGCAGGCGTAGCGGG	NA	NA	NA	NA
>prophage 23
CP034067	Shigella sonnei strain FDAARGOS_524 chromosome, complete genome	4828074	4530160	4541893	4828074	transposase	Enterobacteria_phage(45.45%)	12	NA	NA
AZG56829.1|4530160_4530784_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	76.5	3.2e-79
AZG56830.1|4533763_4535067_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AZG56831.1|4534953_4536090_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.7	7.3e-223
AZG56832.1|4536089_4536887_+	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	100.0	6.6e-146
AZG56833.1|4537236_4537479_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	95.0	3.5e-34
AZG56834.1|4537478_4537853_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.2	2.9e-35
AZG56835.1|4537849_4538704_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	9.7e-79
AZG56836.1|4539196_4539523_+	hypothetical protein	NA	NA	NA	NA	NA
AZG56837.1|4539558_4539690_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
AZG56838.1|4539970_4540306_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	73.8	3.4e-43
AZG56839.1|4540566_4540740_+	DUF1737 domain-containing protein	NA	Q5MBW4	Stx1-converting_phage	95.3	2.1e-17
AZG56840.1|4540736_4541893_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
>prophage 24
CP034067	Shigella sonnei strain FDAARGOS_524 chromosome, complete genome	4828074	4720750	4781100	4828074	transposase,tail	Enterobacteria_phage(25.0%)	52	NA	NA
AZG57008.1|4720750_4722023_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AZG57009.1|4722911_4724447_+|transposase	IS21-like element ISSso4 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.6	4.3e-101
AZG57010.1|4724463_4725219_+	AAA family ATPase	NA	K4HZD4	Acidithiobacillus_phage	43.4	2.4e-44
AZG57011.1|4725576_4726773_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZG57012.1|4727069_4727645_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	39.3	9.6e-22
AZG57013.1|4727972_4729022_+	multidrug transporter MdtG	NA	NA	NA	NA	NA
AZG57014.1|4729104_4729479_+	secY/secA suppressor protein	NA	NA	NA	NA	NA
AZG57015.1|4729479_4729707_-	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
AZG57016.1|4731316_4733860_-	glucan biosynthesis protein H	NA	NA	NA	NA	NA
AZG57254.1|4733852_4735388_-	glucan biosynthesis protein G	NA	NA	NA	NA	NA
AZG57017.1|4735782_4736940_+	glucan biosynthesis protein C	NA	NA	NA	NA	NA
AZG57018.1|4736947_4738429_-	phospholipase D family protein	NA	NA	NA	NA	NA
AZG57019.1|4738370_4738904_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
AZG57020.1|4738998_4739310_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AZG57021.1|4739430_4739763_-	curli assembly protein CsgC	NA	NA	NA	NA	NA
AZG57022.1|4740665_4741838_-|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	100.0	2.2e-230
AZG57023.1|4741953_4742406_-	major curlin subunit CsgA	NA	NA	NA	NA	NA
AZG57024.1|4742446_4742902_-	minor curlin subunit	NA	NA	NA	NA	NA
AZG57025.1|4745346_4745859_+	transcriptional regulator CsgD	NA	NA	NA	NA	NA
AZG57026.1|4745863_4746253_+	curli production assembly/transport component CsgE	NA	NA	NA	NA	NA
AZG57027.1|4746277_4746694_+	curli production assembly/transport component CsgF	NA	NA	NA	NA	NA
AZG57028.1|4746720_4747554_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	39.7	4.3e-39
AZG57255.1|4747618_4748110_-	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
AZG57029.1|4748211_4748766_-	molecular chaperone	NA	NA	NA	NA	NA
AZG57030.1|4748789_4749527_-	phosphatase	NA	NA	NA	NA	NA
AZG57031.1|4749581_4750520_-	glyoxylate/hydroxypyruvate reductase GhrA	NA	NA	NA	NA	NA
AZG57032.1|4751112_4751568_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
AZG57033.1|4751695_4751911_+	hypothetical protein	NA	NA	NA	NA	NA
AZG57034.1|4752379_4753444_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.2	3.4e-89
AZG57035.1|4753788_4755060_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
AZG57036.1|4755065_4756193_-	iron uptake system component EfeO	NA	NA	NA	NA	NA
AZG57037.1|4756250_4757081_-	ferrous iron permease EfeU	NA	NA	NA	NA	NA
AZG57038.1|4757746_4759255_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
AZG57039.1|4759676_4763639_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AZG57040.1|4763678_4764317_-	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
AZG57041.1|4764495_4764675_-	hypothetical protein	NA	NA	NA	NA	NA
AZG57256.1|4766472_4767165_+	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
AZG57042.1|4768346_4769147_+	pyrimidine utilization protein D	NA	NA	NA	NA	NA
AZG57043.1|4769156_4769747_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
AZG57044.1|4769757_4771365_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX94	Enterobacteria_phage	99.2	6.9e-203
AZG57045.1|4771622_4771796_-	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
AZG57046.1|4772522_4773092_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	37.1	3.1e-20
AZG57047.1|4773607_4774270_+	DNA methylase	NA	NA	NA	NA	NA
AZG57048.1|4774652_4775606_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZG57049.1|4775605_4775902_+	hypothetical protein	NA	NA	NA	NA	NA
AZG57257.1|4776225_4776516_+	hypothetical protein	NA	NA	NA	NA	NA
AZG57050.1|4776515_4776737_+	hypothetical protein	NA	NA	NA	NA	NA
AZG57051.1|4776736_4776952_+	hypothetical protein	NA	NA	NA	NA	NA
AZG57052.1|4777098_4777404_+	hypothetical protein	NA	NA	NA	NA	NA
AZG57053.1|4777879_4778590_+|transposase	transposase	transposase	NA	NA	NA	NA
AZG57054.1|4778614_4778821_+	hypothetical protein	NA	NA	NA	NA	NA
AZG57055.1|4778919_4781100_+|tail	phage tail tape measure protein	tail	D2K036	Staphylococcus_phage	28.0	4.4e-59
>prophage 1
CP034066	Shigella sonnei strain FDAARGOS_524 plasmid unnamed1, complete sequence	109082	374	13989	109082		Salmonella_phage(93.75%)	19	NA	NA
AZG53029.1|374_665_-	C-type natriuretic protein	NA	J9Q7S1	Salmonella_phage	78.1	6.9e-37
AZG53030.1|810_1026_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	72.1	9.7e-20
AZG53031.1|1022_2345_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	91.4	3.1e-241
AZG53032.1|2341_2599_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	60.2	3.9e-15
AZG53033.1|2879_3656_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	41.1	1.4e-52
AZG53034.1|3734_4913_-	DNA primase	NA	J9Q720	Salmonella_phage	93.8	2.1e-209
AZG53035.1|4994_6335_-	DNA helicase	NA	J9Q7G4	Salmonella_phage	93.5	3.4e-235
AZG53036.1|6378_7119_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	89.2	2.4e-126
AZG53037.1|7491_8169_+	hypothetical protein	NA	NA	NA	NA	NA
AZG53038.1|8207_8567_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	96.8	2.8e-43
AZG53039.1|8566_9235_-	plasmid stability protein	NA	J9Q7R7	Salmonella_phage	91.0	2.9e-110
AZG53149.1|9553_9823_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AZG53040.1|9830_10352_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZG53041.1|10384_10570_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	75.0	2.9e-20
AZG53042.1|10520_10772_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	75.6	9.0e-25
AZG53043.1|10773_11466_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	94.3	1.0e-123
AZG53044.1|11479_11803_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	88.8	2.9e-44
AZG53045.1|11877_12660_-	receptor-recognizing protein	NA	C4MYP9	Escherichia_phage	82.6	2.4e-52
AZG53150.1|12726_13989_-	hypothetical protein	NA	J9Q6E3	Salmonella_phage	58.3	7.6e-96
>prophage 2
CP034066	Shigella sonnei strain FDAARGOS_524 plasmid unnamed1, complete sequence	109082	17877	51694	109082	capsid,tail,terminase	Salmonella_phage(100.0%)	39	NA	NA
AZG53049.1|17877_22605_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	74.2	0.0e+00
AZG53050.1|22623_23217_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	90.9	2.0e-99
AZG53051.1|23204_24002_-|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	94.0	1.3e-154
AZG53052.1|23994_24726_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	96.6	1.5e-133
AZG53053.1|24775_25111_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	87.3	8.0e-53
AZG53054.1|25153_29725_-|tail	phage tail tape measure protein	tail	J9Q712	Salmonella_phage	85.4	0.0e+00
AZG53055.1|29732_30002_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	94.8	1.7e-34
AZG53056.1|30082_30400_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	96.2	8.6e-49
AZG53057.1|30455_31202_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	93.1	1.1e-121
AZG53058.1|31276_31660_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	82.7	1.2e-57
AZG53059.1|31661_32135_-	hypothetical protein	NA	J9Q711	Salmonella_phage	90.4	3.3e-76
AZG53060.1|32125_32470_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	95.6	2.3e-55
AZG53061.1|32549_33383_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	92.1	1.3e-141
AZG53062.1|33382_33817_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	82.6	1.1e-59
AZG53063.1|33861_34782_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	78.6	1.6e-124
AZG53064.1|34855_35731_-|capsid	phage major capsid protein	capsid	J9Q710	Salmonella_phage	93.8	4.2e-154
AZG53065.1|35756_36644_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	89.3	7.1e-133
AZG53066.1|36665_38240_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	93.1	2.2e-286
AZG53067.1|38266_39523_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	96.4	7.5e-245
AZG53068.1|39522_40155_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	83.8	8.2e-91
AZG53069.1|40351_40618_-	hypothetical protein	NA	J9Q757	Salmonella_phage	88.6	1.4e-36
AZG53070.1|40627_41527_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	98.3	1.3e-166
AZG53071.1|41523_41778_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
AZG53072.1|41770_42409_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.6	1.2e-110
AZG53073.1|42405_43074_-	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	89.6	5.6e-106
AZG53074.1|43073_43772_-	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	87.1	5.1e-110
AZG53075.1|43836_45396_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.9	4.4e-279
AZG53076.1|45398_45677_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	62.6	2.2e-24
AZG53151.1|45745_46168_+	hypothetical protein	NA	J9Q806	Salmonella_phage	77.1	4.8e-55
AZG53077.1|46172_46697_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	82.4	2.8e-68
AZG53152.1|46829_47009_+	hypothetical protein	NA	NA	NA	NA	NA
AZG53078.1|47292_47943_+	hypothetical protein	NA	J9Q754	Salmonella_phage	84.7	8.4e-99
AZG53079.1|47991_48195_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	91.0	5.9e-27
AZG53080.1|48216_48447_+	hypothetical protein	NA	NA	NA	NA	NA
AZG53081.1|49064_49547_-	hypothetical protein	NA	J9Q805	Salmonella_phage	69.8	7.9e-62
AZG53082.1|49751_50039_-	ABC transporter	NA	J9Q753	Salmonella_phage	80.6	9.6e-39
AZG53083.1|50368_50779_-	hypothetical protein	NA	NA	NA	NA	NA
AZG53084.1|50860_51256_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	54.6	2.8e-33
AZG53085.1|51382_51694_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	64.1	3.3e-29
>prophage 3
CP034066	Shigella sonnei strain FDAARGOS_524 plasmid unnamed1, complete sequence	109082	54972	107803	109082	integrase,tRNA	Salmonella_phage(80.7%)	63	101068:101083	108870:108885
AZG53089.1|54972_57006_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	23.9	8.3e-44
AZG53090.1|57163_58264_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
AZG53091.1|58301_58691_-	DNA repair protein	NA	A0A077SK24	Escherichia_phage	93.0	8.6e-67
AZG53154.1|58863_59388_-	hypothetical protein	NA	A0A2D2W4T4	Escherichia_phage	48.5	2.2e-33
AZG53092.1|59401_60217_-	hypothetical protein	NA	C6ZR26	Salmonella_phage	52.5	5.6e-07
AZG53093.1|60593_61247_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	77.8	1.7e-43
AZG53094.1|61246_61432_-	hypothetical protein	NA	NA	NA	NA	NA
AZG53095.1|61428_61851_-	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	50.0	1.4e-14
AZG53096.1|61850_62393_-	hypothetical protein	NA	J9Q748	Salmonella_phage	87.4	2.5e-88
AZG53097.1|62389_63031_-	HD domain-containing protein	NA	J9Q7H7	Salmonella_phage	87.8	1.7e-99
AZG53098.1|63150_63531_-	hypothetical protein	NA	J9Q801	Salmonella_phage	67.4	1.7e-27
AZG53099.1|63530_64235_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	76.4	2.1e-87
AZG53100.1|64295_65981_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	92.0	0.0e+00
AZG53101.1|66084_66699_-	hypothetical protein	NA	A0A0E3GMH9	Enterobacteria_phage	82.8	1.2e-99
AZG53102.1|66701_66983_-	hypothetical protein	NA	A0A0E3JPT1	Enterobacteria_phage	76.3	3.2e-39
AZG53103.1|67038_67608_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	61.4	1.4e-52
AZG53104.1|67747_67906_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
AZG53105.1|67905_68331_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	83.0	2.8e-58
AZG53106.1|68423_68612_-	hypothetical protein	NA	J9Q800	Salmonella_phage	53.2	7.2e-11
AZG53107.1|68608_68860_-	hypothetical protein	NA	NA	NA	NA	NA
AZG53108.1|69261_69855_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	83.2	8.2e-93
AZG53109.1|70439_70670_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	85.5	2.0e-31
AZG53110.1|70856_71450_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	86.3	2.0e-99
AZG53111.1|71633_72443_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	53.2	3.4e-65
AZG53112.1|72601_73159_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	83.1	1.7e-87
AZG53113.1|73168_73588_-	hypothetical protein	NA	J9Q743	Salmonella_phage	71.9	3.2e-51
AZG53114.1|73649_74294_-	hypothetical protein	NA	J9Q7H4	Salmonella_phage	81.8	4.6e-97
AZG53115.1|74293_74770_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	89.2	1.3e-80
AZG53116.1|74766_75180_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	87.6	2.5e-64
AZG53117.1|75181_76309_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	93.2	9.5e-207
AZG53118.1|76455_77325_-	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	80.6	7.0e-133
AZG53119.1|77402_78545_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	88.7	2.6e-196
AZG53120.1|78645_80961_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	84.3	0.0e+00
AZG53121.1|81034_81604_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	86.8	1.1e-91
AZG53122.1|81613_82357_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	47.2	2.0e-51
AZG53123.1|82346_84263_-	exonuclease	NA	J9Q741	Salmonella_phage	73.0	4.9e-248
AZG53155.1|84259_84451_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	76.2	3.7e-23
AZG53124.1|84492_85578_-	exonuclease SbcCD subunit D	NA	J9Q7S9	Salmonella_phage	87.5	8.0e-187
AZG53125.1|85832_86477_-	hypothetical protein	NA	J9Q739	Salmonella_phage	86.3	2.9e-107
AZG53126.1|87220_88276_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	91.0	5.4e-172
AZG53127.1|88764_88977_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	3.4e-33
AZG53128.1|88976_89312_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	73.9	6.6e-39
AZG53129.1|89308_89488_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	67.8	4.0e-11
AZG53130.1|89527_89803_-	hypothetical protein	NA	J9Q738	Salmonella_phage	74.7	2.0e-33
AZG53156.1|89858_90275_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	76.1	1.3e-60
AZG53131.1|90375_91206_-	SPFH/Band 7/PHB domain protein	NA	J9Q7Z4	Salmonella_phage	94.9	3.1e-122
AZG53132.1|91209_91410_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	59.1	7.2e-09
AZG53133.1|91502_93842_-	recombinase RecA	NA	J9Q736	Salmonella_phage	85.1	1.8e-29
AZG53134.1|93844_94111_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	77.3	2.6e-30
AZG53135.1|94110_95055_-	exonuclease	NA	J9Q7S6	Salmonella_phage	88.9	2.7e-162
AZG53136.1|95115_96144_-	regulator	NA	J9Q7Z3	Salmonella_phage	86.3	1.4e-143
AZG53137.1|96261_96693_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	83.9	9.9e-64
AZG53138.1|96947_97172_+	hypothetical protein	NA	J9Q735	Salmonella_phage	56.9	2.2e-14
AZG53139.1|97232_97796_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	68.2	3.3e-67
AZG53140.1|97826_101333_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	88.6	0.0e+00
101068:101083	attL	AATGATTCCATACATC	NA	NA	NA	NA
AZG53141.1|101307_101511_-	hypothetical protein	NA	J9Q6I7	Salmonella_phage	91.0	1.2e-30
AZG53142.1|101513_102749_-	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	81.0	6.7e-198
AZG53143.1|102844_104953_-	cobalamin biosynthesis protein CobT	NA	J9Q7G6	Salmonella_phage	67.0	2.5e-229
AZG53144.1|105051_105264_-	hypothetical protein	NA	NA	NA	NA	NA
AZG53145.1|105515_105902_+	transcriptional regulator	NA	NA	NA	NA	NA
AZG53146.1|105896_107000_-|integrase	integrase	integrase	A0A1P8DTG6	Proteus_phage	33.8	1.3e-27
AZG53147.1|107210_107456_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	44.9	4.5e-13
AZG53148.1|107452_107803_-	hypothetical protein	NA	Q716B1	Shigella_phage	51.7	4.6e-27
108870:108885	attR	GATGTATGGAATCATT	NA	NA	NA	NA
