The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP023849	Escherichia coli strain 4/0 chromosome, complete genome	5243509	132558	161093	5243509	bacteriocin,transposase	Erysipelothrix_phage(20.0%)	31	NA	NA
AZH57997.1|132558_132843_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AZH57998.1|133010_133250_+	hypothetical protein	NA	NA	NA	NA	NA
AZH57999.1|133250_133541_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AZH58000.1|133707_133896_+	HNH endonuclease	NA	NA	NA	NA	NA
AZH58001.1|133949_134240_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AZH58002.1|134407_134647_+	hypothetical protein	NA	NA	NA	NA	NA
AZH58003.1|134647_134938_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AZH58004.1|135393_136158_+	pyruvate dehydrogenase complex repressor	NA	NA	NA	NA	NA
AZH58005.1|136154_136337_-	hypothetical protein	NA	NA	NA	NA	NA
AZH58006.1|136318_138982_+	pyruvate dehydrogenase E1 component	NA	NA	NA	NA	NA
AZH58007.1|138996_140889_+	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
AZH62784.1|141096_142521_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
AZH58008.1|142591_144355_-	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
AZH58009.1|144612_144729_+	aconitate hydratase	NA	NA	NA	NA	NA
AZH58010.1|144709_147307_+	aconitate hydratase B	NA	NA	NA	NA	NA
AZH58011.1|147481_147844_+	UPF0231 family protein	NA	NA	NA	NA	NA
AZH58012.1|147881_148676_-	S-adenosylmethionine decarboxylase proenzyme	NA	NA	NA	NA	NA
AZH58013.1|148691_149558_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
AZH58014.1|149663_150011_-	hypothetical protein	NA	NA	NA	NA	NA
AZH58015.1|150176_151727_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	3.5e-18
AZH58016.1|151773_154164_-	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
AZH58017.1|154369_154906_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
AZH58018.1|154946_155609_-	carbonic anhydrase	NA	NA	NA	NA	NA
AZH58019.1|155717_156644_+	multidrug ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
AZH58020.1|156640_157411_+	inner membrane transport permease YadH	NA	NA	NA	NA	NA
AZH58021.1|157515_157956_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AZH58022.1|158019_159249_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AZH58023.1|159252_159633_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
AZH58024.1|159582_159786_+	hypothetical protein	NA	NA	NA	NA	NA
AZH58025.1|159906_160827_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	48.8	4.9e-60
AZH58026.1|160895_161093_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
CP023849	Escherichia coli strain 4/0 chromosome, complete genome	5243509	929269	1038502	5243509	capsid,terminase,tRNA,integrase,plate,head,portal,holin,tail,protease	Enterobacteria_phage(43.3%)	132	1023174:1023189	1042495:1042510
AZH58731.1|929269_929590_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AZH58732.1|929620_931897_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
AZH58733.1|932581_932800_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AZH58734.1|933084_933789_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AZH58735.1|933830_935552_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.0	1.4e-20
AZH58736.1|935552_937319_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
AZH58737.1|937441_938407_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
AZH58738.1|938950_939445_+	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AZH58739.1|939579_943686_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
AZH58740.1|943844_944456_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AZH58741.1|944466_945810_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
AZH58742.1|945900_947193_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AZH58743.1|947498_947639_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
AZH58744.1|947830_948091_-	hypothetical protein	NA	NA	NA	NA	NA
AZH58745.1|948133_949243_-	late control protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.6	2.8e-195
AZH58746.1|949400_950585_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	4.9e-222
AZH58747.1|950584_951097_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
AZH58748.1|951152_951527_+|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	72.4	2.0e-36
AZH58749.1|951454_951691_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	94.1	4.3e-21
AZH58750.1|951677_954485_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	91.4	0.0e+00
AZH58751.1|954491_954986_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	4.7e-86
AZH58752.1|955012_955612_-	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	86.3	2.0e-86
AZH58753.1|955683_956145_+|tail	phage tail protein	tail	Q9MCR6	Enterobacteria_phage	63.8	3.0e-50
AZH58754.1|956155_956668_+|tail	phage tail protein	tail	K7P7Q7	Enterobacteria_phage	47.9	9.7e-34
AZH58755.1|956667_957282_+|tail	phage tail protein	tail	Q9MCR5	Enterobacteria_phage	61.5	1.7e-61
AZH58756.1|957288_957762_-|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	52.4	8.1e-35
AZH58757.1|957833_958406_+	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
AZH58758.1|958661_959945_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AZH58759.1|960015_961104_-	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
AZH58760.1|961302_961995_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AZH58761.1|962124_963885_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
AZH58762.1|964290_965148_+	formate transporter FocA	NA	NA	NA	NA	NA
AZH58763.1|965202_967485_+	formate acetyltransferase 1	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
AZH58764.1|967676_968417_+	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
AZH58765.1|968513_969662_-	MFS transporter	NA	NA	NA	NA	NA
AZH58766.1|969975_970602_+	hydrolase	NA	NA	NA	NA	NA
AZH58767.1|970637_971501_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AZH58768.1|971502_972120_-	dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
AZH58769.1|972130_974575_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
AZH58770.1|974874_975867_-|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.2	1.3e-103
AZH62810.1|975936_976278_-	XRE family transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
AZH58771.1|976382_976904_+	transcriptional regulator	NA	NA	NA	NA	NA
AZH58772.1|976908_977331_+	hypothetical protein	NA	NA	NA	NA	NA
AZH58773.1|977337_977529_-	hypothetical protein	NA	NA	NA	NA	NA
AZH58774.1|977666_978017_+	DUF4761 domain-containing protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	8.1e-56
AZH58775.1|978027_978306_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
AZH58776.1|978317_978560_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
AZH58777.1|978763_979174_+	hypothetical protein	NA	NA	NA	NA	NA
AZH58778.1|979197_979401_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
AZH58779.1|979397_979664_+	MarR family transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
AZH58780.1|979660_979960_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	1.4e-40
AZH58781.1|980282_980513_+	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	100.0	2.8e-33
AZH58782.1|980585_980951_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	95.9	3.3e-60
AZH62811.1|981056_983780_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.2	0.0e+00
AZH58783.1|983856_984816_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	3.2e-179
AZH58784.1|984820_985135_+	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	51.9	3.5e-18
AZH58785.1|985154_985589_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	45.5	8.0e-21
AZH58786.1|985590_985854_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
AZH58787.1|986440_986965_+	hypothetical protein	NA	NA	NA	NA	NA
AZH58788.1|986979_988026_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
AZH58789.1|988025_989777_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	98.3	0.0e+00
AZH58790.1|989931_990768_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	3.0e-149
AZH58791.1|990791_991844_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	1.4e-188
AZH58792.1|991889_992690_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	93.2	1.4e-132
AZH58793.1|992791_993286_+|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
AZH58794.1|993285_993486_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
AZH58795.1|993488_993812_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
AZH58796.1|993808_994201_+	peptidase M15	NA	A0A0A7NQ86	Enterobacteria_phage	98.5	2.9e-70
AZH58797.1|994197_994605_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	9.4e-64
AZH58798.1|994743_996624_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	H6WZJ9	Escherichia_phage	81.2	1.1e-300
AZH58799.1|996647_997115_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
AZH58800.1|997107_997743_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	98.6	1.0e-112
AZH58801.1|997739_998321_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	99.0	5.0e-103
AZH58802.1|998317_998668_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	2.7e-59
AZH58803.1|998671_999568_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.1e-154
AZH58804.1|999560_1000169_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.5e-86
AZH58805.1|1000165_1001878_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	49.0	1.6e-117
AZH58806.1|1001884_1002499_-|tail	phage tail protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
AZH58807.1|1002498_1002981_-|tail	phage tail protein	tail	K7P7Q7	Enterobacteria_phage	44.7	7.5e-28
AZH58808.1|1003021_1004269_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	43.7	2.0e-40
AZH58809.1|1004271_1004850_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
AZH58810.1|1004842_1005946_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
AZH58811.1|1005936_1006284_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
AZH58812.1|1006338_1006935_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
AZH58813.1|1006931_1008086_-	phage protein D	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
AZH58814.1|1008073_1008289_-	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
AZH58815.1|1008285_1009170_-	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.9	6.8e-51
AZH58816.1|1009169_1012121_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
AZH58817.1|1012196_1012355_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AZH58818.1|1012278_1012614_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AZH58819.1|1012711_1012993_-	hypothetical protein	NA	NA	NA	NA	NA
AZH58820.1|1012995_1013517_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
AZH58821.1|1013516_1014944_-|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
AZH58822.1|1014933_1015188_-	hypothetical protein	NA	NA	NA	NA	NA
AZH58823.1|1015184_1015649_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AZH58824.1|1015648_1016095_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AZH58825.1|1016096_1016435_-	DUF2190 domain-containing protein	NA	NA	NA	NA	NA
AZH58826.1|1016444_1017398_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
AZH58827.1|1017412_1018528_-	peptidase	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
AZH58828.1|1018742_1019201_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
AZH58829.1|1019203_1020025_-|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
AZH58830.1|1020005_1021502_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
AZH58831.1|1021501_1023097_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	6.5e-185
AZH58832.1|1023093_1023639_-	DUF3486 domain-containing protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
1023174:1023189	attL	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
AZH58833.1|1023638_1023950_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AZH58834.1|1023949_1024276_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
AZH58835.1|1024272_1024923_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
AZH58836.1|1024906_1025647_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
AZH58837.1|1025649_1026000_-	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
AZH58838.1|1026130_1026859_+	hypothetical protein	NA	NA	NA	NA	NA
AZH58839.1|1026834_1027239_-	hypothetical protein	NA	NA	NA	NA	NA
AZH58840.1|1027237_1027453_+	hypothetical protein	NA	NA	NA	NA	NA
AZH58841.1|1027643_1028408_+	restriction endonuclease subunit M	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
AZH58842.1|1028524_1028881_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZH58843.1|1028974_1029163_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
AZH58844.1|1029215_1029524_+	IclR family transcriptional regulator	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
AZH58845.1|1029534_1030455_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
AZH58846.1|1030454_1030772_+	hypothetical protein	NA	NA	NA	NA	NA
AZH58847.1|1030787_1032557_+|integrase	integrase	integrase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
AZH58848.1|1032567_1033734_+	hypothetical protein	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
AZH58849.1|1033736_1034006_+	hypothetical protein	NA	NA	NA	NA	NA
AZH58850.1|1034033_1034564_+	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
AZH58851.1|1034574_1034796_-	hypothetical protein	NA	NA	NA	NA	NA
AZH58852.1|1034852_1035125_+	hypothetical protein	NA	NA	NA	NA	NA
AZH58853.1|1035134_1035431_+	hypothetical protein	NA	NA	NA	NA	NA
AZH58854.1|1035445_1035661_+	hypothetical protein	NA	NA	NA	NA	NA
AZH58855.1|1035657_1036341_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
AZH58856.1|1036337_1036568_+	hypothetical protein	NA	NA	NA	NA	NA
AZH58857.1|1036557_1036764_+	hypothetical protein	NA	NA	NA	NA	NA
AZH58858.1|1036765_1037215_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
AZH58859.1|1037186_1037576_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
AZH58860.1|1037719_1038502_+|protease	metalloprotease	protease	NA	NA	NA	NA
1042495:1042510	attR	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
>prophage 3
CP023849	Escherichia coli strain 4/0 chromosome, complete genome	5243509	1248902	1294611	5243509	capsid,terminase,tRNA,integrase,head,portal,holin,tail	Enterobacteria_phage(56.0%)	60	1247220:1247234	1275814:1275828
1247220:1247234	attL	GCTGCCAGCGGGAAA	NA	NA	NA	NA
AZH59059.1|1248902_1250009_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AZH59060.1|1250062_1250524_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AZH59061.1|1250533_1251187_-	23S rRNA pseudouridine synthase E	NA	NA	NA	NA	NA
AZH59062.1|1251358_1252609_+	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	100.0	3.8e-23
AZH59063.1|1252722_1253865_-|integrase	integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
AZH59064.1|1253854_1254091_-	excisionase	NA	NA	NA	NA	NA
AZH59065.1|1254230_1254470_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
AZH59066.1|1254453_1254780_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
AZH59067.1|1254779_1255001_-	conjugal transfer protein TraR	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
AZH59068.1|1255099_1255381_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
AZH59069.1|1255391_1255583_-	hypothetical protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
AZH59070.1|1255555_1255738_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
AZH59071.1|1255734_1256415_-	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
AZH59072.1|1256411_1257197_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AZH59073.1|1257202_1257499_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
AZH59074.1|1257574_1257781_-	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
AZH59075.1|1258376_1259132_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
AZH59076.1|1259170_1259401_+	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
AZH59077.1|1259470_1260010_+	regulator	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
AZH59078.1|1260006_1261026_+	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	64.1	8.8e-111
AZH59079.1|1261022_1261724_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.0	1.5e-125
AZH59080.1|1261973_1266239_+	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AZH59081.1|1266275_1267319_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZH59082.1|1267668_1267770_+	hypothetical protein	NA	NA	NA	NA	NA
AZH59083.1|1267766_1268222_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
AZH59084.1|1268221_1268392_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
AZH59085.1|1268384_1268675_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
AZH59086.1|1268671_1269034_+	hypothetical protein	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
AZH59087.1|1269030_1269171_+	hypothetical protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
AZH59088.1|1269167_1269857_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
AZH59089.1|1270166_1270484_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	86.1	3.3e-40
AZH59090.1|1270470_1270947_+	lysozyme	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
AZH59091.1|1271163_1271346_+	hypothetical protein	NA	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
AZH59092.1|1271436_1271730_-	lipoprotein bor	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
AZH59093.1|1272156_1272537_+	hypothetical protein	NA	H6WZK5	Escherichia_phage	72.2	2.6e-39
AZH59094.1|1272659_1273013_-	hypothetical protein	NA	NA	NA	NA	NA
AZH62824.1|1272900_1273221_-	hypothetical protein	NA	NA	NA	NA	NA
AZH59095.1|1273155_1273350_+	DNA-packaging protein	NA	NA	NA	NA	NA
AZH59096.1|1273489_1274035_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
AZH59097.1|1274009_1275935_+|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
1275814:1275828	attR	TTTCCCGCTGGCAGC	NA	NA	NA	NA
AZH59098.1|1275931_1276138_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AZH59099.1|1276134_1277736_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
AZH59100.1|1277716_1279036_+|capsid	capsid assembly protein	capsid	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
AZH59101.1|1279045_1279378_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
AZH59102.1|1279433_1280459_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
AZH59103.1|1280500_1280899_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.0e-62
AZH59104.1|1280910_1281264_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
AZH59105.1|1281275_1281854_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.7	5.9e-80
AZH59106.1|1281850_1282246_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
AZH62825.1|1282253_1282994_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
AZH59107.1|1283009_1283432_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
AZH59108.1|1283413_1283848_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AZH59109.1|1283840_1286402_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
AZH59110.1|1286398_1286728_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
AZH59111.1|1286727_1287426_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
AZH59112.1|1287430_1288174_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
AZH59113.1|1288071_1288713_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.5	2.9e-96
AZH59114.1|1288773_1292256_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
AZH59115.1|1292314_1294336_+|tail	phage tail protein	tail	A0A0E3M0V5	Enterobacteria_phage	72.3	7.2e-181
AZH59116.1|1294332_1294611_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
>prophage 4
CP023849	Escherichia coli strain 4/0 chromosome, complete genome	5243509	1432572	1502287	5243509	capsid,terminase,integrase,transposase,head,portal,holin,tail,protease,lysis	Enterobacteria_phage(27.12%)	86	1428746:1428760	1434656:1434670
1428746:1428760	attL	ACTCCTTGTTCGGGA	NA	NA	NA	NA
AZH59253.1|1432572_1433703_-|integrase	integrase	integrase	O21940	Phage_21	51.4	3.4e-103
AZH59254.1|1433680_1433929_-	excisionase	NA	NA	NA	NA	NA
AZH59255.1|1433993_1436465_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
1434656:1434670	attR	ACTCCTTGTTCGGGA	NA	NA	NA	NA
AZH59256.1|1436557_1436749_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AZH59257.1|1436745_1436934_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AZH59258.1|1437256_1437451_+	hypothetical protein	NA	NA	NA	NA	NA
AZH59259.1|1437499_1437718_-	hypothetical protein	NA	NA	NA	NA	NA
AZH59260.1|1437747_1437918_-	hypothetical protein	NA	NA	NA	NA	NA
AZH62836.1|1437877_1438033_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
AZH59261.1|1438305_1439022_-	LexA family transcriptional repressor	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
AZH59262.1|1439071_1439287_+	transcriptional regulator	NA	NA	NA	NA	NA
AZH59263.1|1439283_1439709_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AZH59264.1|1439731_1440694_+	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
AZH59265.1|1440700_1441447_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
AZH59266.1|1441468_1442239_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
AZH59267.1|1442254_1442680_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
AZH59268.1|1442854_1443520_+	hypothetical protein	NA	NA	NA	NA	NA
AZH59269.1|1443700_1443913_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
AZH59270.1|1443954_1444134_-	hypothetical protein	NA	NA	NA	NA	NA
AZH59271.1|1444080_1444353_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
AZH59272.1|1444354_1445410_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
AZH59273.1|1445410_1445791_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.9e-35
AZH59274.1|1445787_1446609_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.7e-80
AZH59275.1|1446835_1447033_+	TrmB family transcriptional regulator	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
AZH59276.1|1447184_1448234_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
AZH59277.1|1448673_1449000_+	hypothetical protein	NA	NA	NA	NA	NA
AZH59278.1|1449035_1449167_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
AZH59279.1|1449447_1449783_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
AZH59280.1|1450043_1451897_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
AZH59281.1|1452047_1452263_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
AZH59282.1|1452267_1452612_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
AZH59283.1|1452577_1452850_-	hypothetical protein	NA	NA	NA	NA	NA
AZH59284.1|1452955_1453489_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
AZH59285.1|1453566_1453779_+	hypothetical protein	NA	A0A0M4S639	Salmonella_phage	60.5	2.7e-06
AZH62837.1|1454043_1454130_+	hypothetical protein	NA	NA	NA	NA	NA
AZH59286.1|1454131_1454626_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	87.7	1.7e-72
AZH59287.1|1454622_1454838_+	hypothetical protein	NA	NA	NA	NA	NA
AZH62838.1|1454834_1454999_+	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	77.8	3.3e-12
AZH59288.1|1455036_1455237_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
AZH59289.1|1455278_1455644_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
AZH59290.1|1455934_1456498_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
AZH59291.1|1456494_1458156_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
AZH59292.1|1458219_1460157_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
AZH62839.1|1460201_1460423_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
AZH59293.1|1460368_1462954_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
AZH59294.1|1462950_1463277_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
AZH59295.1|1463286_1463637_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AZH59296.1|1463633_1464080_+	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AZH59297.1|1464076_1464421_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AZH59298.1|1464487_1465204_+|tail	phage tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
AZH59299.1|1465218_1465593_+|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
AZH59300.1|1465616_1465898_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.9	2.3e-45
AZH59301.1|1465945_1469188_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.6	0.0e+00
AZH59302.1|1469180_1469522_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
AZH59303.1|1469521_1470220_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
AZH59304.1|1470230_1470974_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	4.3e-147
AZH59305.1|1470871_1471552_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.8	3.8e-110
AZH59306.1|1471894_1475368_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
AZH59307.1|1475435_1475894_+	hypothetical protein	NA	Q9EV15	Enterobacteria_phage	89.0	9.5e-65
AZH59308.1|1476008_1477550_+|transposase	IS21 family transposase ISEc12	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
AZH59309.1|1477564_1478311_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
AZH59310.1|1478772_1481598_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	63.6	9.0e-04
AZH59311.1|1481599_1482133_+|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
AZH59312.1|1482163_1482691_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
AZH59313.1|1482706_1483675_-|tail	phage tail protein	tail	A0A0F7LDR4	Escherichia_phage	38.8	6.5e-47
AZH62840.1|1483800_1483983_+	DNA-invertase	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
AZH59314.1|1484099_1484237_+|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AZH62841.1|1484181_1484808_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZH59315.1|1484906_1485176_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
AZH59316.1|1485587_1486145_-	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
AZH59317.1|1486141_1486417_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
AZH59318.1|1486792_1487599_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AZH59319.1|1487598_1488792_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AZH59320.1|1488803_1490162_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
AZH59321.1|1490165_1491761_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
AZH59322.1|1491760_1493323_-	anthranilate synthase component I	NA	NA	NA	NA	NA
AZH62842.1|1493414_1493459_-	trp operon leader peptide	NA	NA	NA	NA	NA
AZH59323.1|1493596_1494478_+	phosphatase	NA	NA	NA	NA	NA
AZH59324.1|1494474_1495095_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AZH59325.1|1495122_1497018_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
AZH59326.1|1497230_1498106_+	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
AZH62843.1|1498311_1499298_+	hypothetical protein	NA	NA	NA	NA	NA
AZH59327.1|1499307_1499616_+	hypothetical protein	NA	NA	NA	NA	NA
AZH59328.1|1499672_1500263_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AZH59329.1|1500259_1501018_-	NAD(P)-dependent oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
AZH59330.1|1501237_1502287_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 5
CP023849	Escherichia coli strain 4/0 chromosome, complete genome	5243509	1993455	2081700	5243509	capsid,terminase,tRNA,integrase,transposase,plate,head,portal,holin,tail	Escherichia_phage(22.73%)	106	2039152:2039211	2081762:2081886
AZH59795.1|1993455_1994178_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	54.4	1.6e-69
AZH59796.1|1994282_1994804_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AZH59797.1|1994913_1995924_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
AZH59798.1|1995932_1996544_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AZH62860.1|1996682_1996748_-	hypothetical protein	NA	NA	NA	NA	NA
AZH59799.1|1996818_1997421_+	hypothetical protein	NA	NA	NA	NA	NA
AZH59800.1|1997422_1997944_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
AZH59801.1|1997978_1998719_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AZH59802.1|1998747_1999200_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
AZH59803.1|1999192_2000965_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AZH59804.1|2001274_2001841_+	hydrolase	NA	NA	NA	NA	NA
AZH59805.1|2001837_2002656_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
AZH59806.1|2002708_2003104_+	hypothetical protein	NA	NA	NA	NA	NA
AZH59807.1|2003144_2003888_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
AZH59808.1|2003884_2004856_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AZH59809.1|2004891_2007321_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	NA	NA	NA	NA
AZH59810.1|2007345_2008446_-	cytochrome C	NA	NA	NA	NA	NA
AZH59811.1|2008833_2009580_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AZH62861.1|2009593_2010160_-	VOC family protein	NA	NA	NA	NA	NA
AZH59812.1|2010375_2012109_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
AZH59813.1|2012161_2012554_-	flagellar protein FlhE	NA	NA	NA	NA	NA
AZH59814.1|2012553_2014632_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
AZH59815.1|2014624_2015773_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
AZH59816.1|2015961_2016606_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
AZH59817.1|2016616_2017006_-	two-component system response regulator	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
AZH59818.1|2017020_2018070_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
AZH59819.1|2018072_2018933_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
AZH59820.1|2019223_2020885_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
AZH59821.1|2021029_2021533_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AZH59822.1|2021553_2023518_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
AZH59823.1|2023522_2024449_-	motility protein MotB	NA	NA	NA	NA	NA
AZH59824.1|2024445_2025333_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
AZH59825.1|2025459_2026038_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
AZH59826.1|2026040_2026391_-	flagellar transcriptional activator FlhD	NA	NA	NA	NA	NA
AZH59827.1|2027170_2027599_+	universal stress protein UspC	NA	NA	NA	NA	NA
AZH59828.1|2027605_2029030_-	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
AZH59829.1|2029004_2029805_-	trehalose-phosphatase	NA	NA	NA	NA	NA
AZH59830.1|2029971_2030958_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
AZH59831.1|2030972_2032487_-	arabinose import ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
AZH59832.1|2032556_2033546_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZH59833.1|2033631_2033871_-	hypothetical protein	NA	NA	NA	NA	NA
AZH59834.1|2034340_2034844_+	non-heme ferritin	NA	NA	NA	NA	NA
AZH59835.1|2034921_2035173_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
AZH59836.1|2035284_2035431_+	hypothetical protein	NA	NA	NA	NA	NA
AZH59837.1|2035637_2035961_+	hypothetical protein	NA	NA	NA	NA	NA
AZH59838.1|2036132_2036630_+	non-heme ferritin	NA	NA	NA	NA	NA
AZH59839.1|2036667_2036907_-	DUF2492 domain-containing protein	NA	NA	NA	NA	NA
AZH59840.1|2037097_2038309_+	tyrosine transporter	NA	NA	NA	NA	NA
AZH59841.1|2038359_2039025_-	YecA family protein	NA	NA	NA	NA	NA
2039152:2039211	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
AZH59842.1|2039496_2039916_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
AZH59843.1|2041130_2041355_-|tail	phage tail protein	tail	NA	NA	NA	NA
AZH62862.1|2041516_2041906_-	hypothetical protein	NA	E5FFG4	Burkholderia_phage	37.9	1.0e-14
AZH59844.1|2041941_2043582_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
AZH59845.1|2043690_2043972_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AZH59846.1|2043984_2044497_-|tail	phage tail protein	tail	NA	NA	NA	NA
AZH59847.1|2044514_2046017_-|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
AZH59848.1|2046013_2046403_-	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
AZH59849.1|2046402_2047587_-	hypothetical protein	NA	J9QDX3	Clostridium_phage	35.2	2.5e-16
AZH59850.1|2047579_2048206_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
AZH59851.1|2048208_2049129_-|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
AZH59852.1|2049125_2049467_-|plate	baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.1e-20
AZH59853.1|2049469_2050372_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
AZH59854.1|2050352_2050889_-	hypothetical protein	NA	NA	NA	NA	NA
AZH59855.1|2050885_2051566_-	hypothetical protein	NA	NA	NA	NA	NA
AZH59856.1|2051597_2051978_-	hypothetical protein	NA	NA	NA	NA	NA
AZH59857.1|2051974_2052394_-	DNA-packaging protein	NA	NA	NA	NA	NA
AZH59858.1|2052428_2053463_-|capsid	minor capsid protein E	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
AZH59859.1|2053521_2053851_-|head	head protein	head	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
AZH59860.1|2053850_2055158_-|capsid	capsid assembly protein	capsid	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
AZH59861.1|2055157_2056732_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
AZH59862.1|2056728_2056962_-	hypothetical protein	NA	NA	NA	NA	NA
AZH59863.1|2056961_2058824_-|terminase	terminase	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
AZH59864.1|2058810_2059377_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
AZH62863.1|2059745_2059991_+	hypothetical protein	NA	NA	NA	NA	NA
AZH59865.1|2060050_2060245_-	hypothetical protein	NA	NA	NA	NA	NA
AZH59866.1|2060252_2060732_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
AZH59867.1|2060731_2061004_-|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
AZH59868.1|2061003_2061387_-	hypothetical protein	NA	NA	NA	NA	NA
AZH59869.1|2061499_2062171_-	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
AZH59870.1|2062170_2062464_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
AZH59871.1|2062460_2063057_-	DUF1367 domain-containing protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
AZH59872.1|2063134_2063314_-	hypothetical protein	NA	NA	NA	NA	NA
AZH59873.1|2063465_2064107_-	hypothetical protein	NA	NA	NA	NA	NA
AZH59874.1|2064350_2064584_+	hypothetical protein	NA	NA	NA	NA	NA
AZH59875.1|2064982_2065471_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
AZH59876.1|2065480_2066086_+	hypothetical protein	NA	NA	NA	NA	NA
AZH59877.1|2068433_2069357_+	hypothetical protein	NA	NA	NA	NA	NA
AZH62864.1|2069531_2070320_-	hypothetical protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
AZH59878.1|2070592_2070814_-	hypothetical protein	NA	NA	NA	NA	NA
AZH59879.1|2071001_2071226_-	hypothetical protein	NA	NA	NA	NA	NA
AZH59880.1|2071222_2071534_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
AZH59881.1|2071530_2071767_-	hypothetical protein	NA	NA	NA	NA	NA
AZH59882.1|2071768_2072179_-	hypothetical protein	NA	NA	NA	NA	NA
AZH59883.1|2072217_2073633_-	helicase DnaB	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
AZH59884.1|2073622_2074378_-	replication protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
AZH59885.1|2074374_2074599_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
AZH59886.1|2074638_2075115_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
AZH59887.1|2075173_2075404_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
AZH59888.1|2075502_2075916_+	transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
AZH59889.1|2076926_2077247_+	hypothetical protein	NA	NA	NA	NA	NA
AZH59890.1|2077277_2079494_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
AZH59891.1|2079490_2080060_+	hypothetical protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
AZH59892.1|2080059_2080242_+	hypothetical protein	NA	NA	NA	NA	NA
AZH59893.1|2080291_2080516_+	hypothetical protein	NA	H9C154	Pectobacterium_phage	56.3	7.3e-10
AZH59894.1|2080451_2080715_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
AZH59895.1|2080683_2081700_+|integrase	integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
2081762:2081886	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAAT	NA	NA	NA	NA
>prophage 6
CP023849	Escherichia coli strain 4/0 chromosome, complete genome	5243509	2092997	2179330	5243509	capsid,terminase,integrase,transposase,head,portal,holin,tail,protease	Escherichia_phage(36.84%)	114	2135973:2135988	2202332:2202347
AZH59908.1|2092997_2094145_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
AZH59909.1|2094517_2095933_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
AZH59910.1|2095948_2096359_+	flagella export chaperone FliS	NA	NA	NA	NA	NA
AZH59911.1|2096358_2096724_+	flagellar protein FliT	NA	NA	NA	NA	NA
AZH59912.1|2096801_2098289_+	alpha-amylase	NA	NA	NA	NA	NA
AZH59913.1|2098322_2098736_-	hypothetical protein	NA	NA	NA	NA	NA
AZH59914.1|2098922_2100128_+	hypothetical protein	NA	NA	NA	NA	NA
AZH59915.1|2100124_2100358_+	SirA-like protein	NA	NA	NA	NA	NA
AZH59916.1|2100466_2100964_+	hypothetical protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	65.2	7.7e-52
AZH59917.1|2101173_2101722_+|transposase	transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.0	1.4e-33
AZH59918.1|2101878_2102676_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZH59919.1|2102685_2103237_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AZH59920.1|2103405_2103738_-	multidrug SMR transporter	NA	NA	NA	NA	NA
AZH59921.1|2103837_2104050_+	hypothetical protein	NA	NA	NA	NA	NA
AZH59922.1|2104081_2104396_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
AZH59923.1|2104610_2106269_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
AZH59924.1|2106261_2107257_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
AZH59925.1|2107249_2107936_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
AZH59926.1|2107935_2109309_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
AZH59927.1|2109327_2109771_+	flagellar protein FliJ	NA	NA	NA	NA	NA
AZH59928.1|2109767_2110895_+	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
AZH59929.1|2110999_2111464_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
AZH59930.1|2111468_2112473_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
AZH59931.1|2112469_2112883_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
AZH59932.1|2112885_2113251_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
AZH59933.1|2113250_2113988_+	flagellar biosynthetic protein FliP	NA	NA	NA	NA	NA
AZH59934.1|2113997_2114267_+	flagellar biosynthetic protein FliQ	NA	NA	NA	NA	NA
AZH59935.1|2114275_2115061_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
AZH59936.1|2115350_2115974_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
AZH59937.1|2116017_2116260_-	DsrB protein	NA	NA	NA	NA	NA
AZH59938.1|2116192_2116381_-	hypothetical protein	NA	NA	NA	NA	NA
AZH59939.1|2116368_2116596_+	DUF2525 domain-containing protein	NA	NA	NA	NA	NA
AZH59940.1|2116891_2117707_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
AZH59941.1|2117703_2119398_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
AZH59942.1|2119318_2119507_-	hypothetical protein	NA	NA	NA	NA	NA
AZH59943.1|2119568_2119751_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AZH59944.1|2119829_2120747_-	hypothetical protein	NA	NA	NA	NA	NA
AZH59945.1|2120919_2121840_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AZH59946.1|2121828_2122299_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	5.2e-34
AZH59947.1|2122279_2123698_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.0e-101
AZH59948.1|2123764_2124460_-	phosphohydrolase	NA	S4W232	Pandoravirus	28.7	1.6e-07
AZH59949.1|2124499_2124865_-	permease	NA	NA	NA	NA	NA
AZH59950.1|2124957_2125161_+	hypothetical protein	NA	NA	NA	NA	NA
AZH59951.1|2125430_2126546_+	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	47.4	2.9e-91
AZH59952.1|2127138_2127990_+	Molecular chaperone Hsp31 and glyoxalase 3	NA	NA	NA	NA	NA
AZH59953.1|2128097_2129456_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AZH62865.1|2129455_2130127_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
AZH59954.1|2130259_2130673_+	5-hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AZH59955.1|2130781_2131786_+	mononuclear molybdenum enzyme YedY	NA	NA	NA	NA	NA
AZH59956.1|2131786_2132422_+	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
AZH59957.1|2132505_2133228_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	54.4	3.1e-70
AZH59958.1|2133332_2133854_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AZH59959.1|2134114_2134765_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
AZH59960.1|2134800_2135130_+	hypothetical protein	NA	NA	NA	NA	NA
AZH59961.1|2135848_2136136_-	hypothetical protein	NA	NA	NA	NA	NA
2135973:2135988	attL	TGCCCGAACATTTCGA	NA	NA	NA	NA
AZH59962.1|2136146_2136851_-	chaperone of endosialidase	NA	A0A1X7QGH6	Escherichia_phage	61.7	4.6e-58
AZH59963.1|2136860_2137142_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.6e-17
AZH59964.1|2137141_2139520_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	76.1	1.9e-185
AZH59965.1|2139640_2140150_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	3.2e-13
AZH59966.1|2140055_2140274_-	hypothetical protein	NA	NA	NA	NA	NA
AZH59967.1|2140295_2140895_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	92.5	3.4e-102
AZH59968.1|2140962_2144358_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.6	0.0e+00
AZH59969.1|2144418_2145066_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	6.6e-112
AZH59970.1|2144963_2145707_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	4.1e-150
AZH59971.1|2145712_2146411_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	94.8	3.8e-129
AZH59972.1|2146410_2146767_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
AZH59973.1|2146744_2149972_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.7	0.0e+00
AZH62866.1|2150018_2150279_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.7	1.6e-40
AZH59974.1|2150320_2150707_-|tail	phage tail protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
AZH59975.1|2150706_2151411_-|tail	phage tail protein	tail	A0A1B5FP82	Escherichia_phage	94.4	3.7e-116
AZH59976.1|2151471_2151816_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	97.4	1.4e-55
AZH59977.1|2151812_2152262_-	hypothetical protein	NA	S4TR46	Salmonella_phage	80.5	1.0e-63
AZH59978.1|2152258_2152597_-|head,tail	head-tail adaptor protein	head,tail	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
AZH59979.1|2152605_2152923_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
AZH59980.1|2152999_2154217_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	4.5e-162
AZH59981.1|2154231_2154831_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
AZH59982.1|2154823_2156050_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	82.6	1.5e-202
AZH59983.1|2156197_2157955_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	98.9	0.0e+00
AZH59984.1|2157954_2158437_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	96.9	7.4e-84
AZH59985.1|2158584_2158935_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	97.4	4.7e-64
AZH59986.1|2159227_2159368_-	Rz1 lytic protein	NA	U5P461	Shigella_phage	84.6	1.0e-09
AZH59987.1|2159460_2159754_+	lipoprotein bor	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
AZH59988.1|2159844_2160027_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
AZH59989.1|2160079_2160307_+	hypothetical protein	NA	NA	NA	NA	NA
AZH59990.1|2160243_2160777_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.8	1.1e-99
AZH59991.1|2160840_2161191_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.9e-36
AZH59992.1|2161195_2161411_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
AZH59993.1|2161718_2161907_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
AZH59994.1|2162166_2162502_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
AZH62867.1|2162949_2163276_-	hypothetical protein	NA	NA	NA	NA	NA
AZH59995.1|2163809_2164631_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	1.5e-76
AZH59996.1|2164645_2165008_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	9.6e-36
AZH59997.1|2165008_2166067_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.7	7.5e-89
AZH59998.1|2166068_2166341_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	4.2e-12
AZH62868.1|2166287_2166467_+	hypothetical protein	NA	NA	NA	NA	NA
AZH59999.1|2166508_2166664_-	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AZH60000.1|2166922_2167102_-	hypothetical protein	NA	NA	NA	NA	NA
AZH60001.1|2167754_2167937_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	2.0e-26
AZH60002.1|2168030_2168387_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.9e-58
AZH60003.1|2168444_2168867_-	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	1.3e-63
AZH60004.1|2168907_2169870_-	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
AZH60005.1|2169892_2170318_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AZH60006.1|2170301_2170583_-	Cro/Cl family transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
AZH60007.1|2170683_2171103_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
AZH62869.1|2171368_2171524_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
AZH60008.1|2171483_2171654_+	hypothetical protein	NA	NA	NA	NA	NA
AZH60009.1|2171683_2171902_+	hypothetical protein	NA	NA	NA	NA	NA
AZH60010.1|2172469_2172658_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AZH60011.1|2172654_2172846_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AZH60012.1|2172938_2175410_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	3.8e-59
AZH60013.1|2175468_2175672_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AZH60014.1|2175671_2176697_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
AZH62870.1|2176932_2177730_+	protein MtfA	NA	NA	NA	NA	NA
AZH60015.1|2178067_2179330_+|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.5	2.6e-72
2202332:2202347	attR	TGCCCGAACATTTCGA	NA	NA	NA	NA
>prophage 7
CP023849	Escherichia coli strain 4/0 chromosome, complete genome	5243509	2246219	2280028	5243509	transposase	Escherichia_phage(18.18%)	39	NA	NA
AZH60061.1|2246219_2247416_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZH60062.1|2247464_2247818_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AZH60063.1|2247896_2248514_+	hypothetical protein	NA	NA	NA	NA	NA
AZH60064.1|2248987_2249203_+	hypothetical protein	NA	NA	NA	NA	NA
AZH60065.1|2249539_2250235_-|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	88.4	2.3e-118
AZH60066.1|2250231_2251254_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
AZH60067.1|2251399_2251579_+|transposase	transposase	transposase	NA	NA	NA	NA
AZH62874.1|2251804_2252182_-	hypothetical protein	NA	NA	NA	NA	NA
AZH60068.1|2252138_2252369_+	hypothetical protein	NA	NA	NA	NA	NA
AZH62875.1|2252778_2253924_+	hypothetical protein	NA	NA	NA	NA	NA
AZH60069.1|2254454_2254712_-	hypothetical protein	NA	NA	NA	NA	NA
AZH60070.1|2254765_2255533_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	7.5e-14
AZH60071.1|2255529_2256588_-	iron ABC transporter permease	NA	NA	NA	NA	NA
AZH60072.1|2256606_2257596_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZH60073.1|2257606_2259772_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AZH60074.1|2260200_2260635_+	hypothetical protein	NA	NA	NA	NA	NA
AZH60075.1|2260852_2263237_+	dGTPase	NA	NA	NA	NA	NA
AZH60076.1|2263233_2264139_+	chemotaxis protein	NA	NA	NA	NA	NA
AZH60077.1|2264135_2265206_+	phospholipase	NA	NA	NA	NA	NA
AZH60078.1|2265341_2265755_+	hypothetical protein	NA	NA	NA	NA	NA
AZH60079.1|2265869_2267411_+|transposase	IS21 family transposase ISEc12	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
AZH60080.1|2267425_2268172_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
AZH60081.1|2268620_2269031_+	hypothetical protein	NA	NA	NA	NA	NA
AZH60082.1|2269251_2270070_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
AZH60083.1|2270069_2270315_+	antirestriction protein	NA	NA	NA	NA	NA
AZH60084.1|2270408_2270882_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
AZH62876.1|2270927_2271374_+	hypothetical protein	NA	NA	NA	NA	NA
AZH60085.1|2271436_2271658_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
AZH60086.1|2271676_2272321_+	antitoxin of toxin-antitoxin stability system	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
AZH60087.1|2272336_2272705_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AZH60088.1|2272793_2273168_+	toxin	NA	NA	NA	NA	NA
AZH62877.1|2273167_2273359_+	hypothetical protein	NA	NA	NA	NA	NA
AZH62878.1|2273973_2274156_+	ethanolamine utilization protein	NA	NA	NA	NA	NA
AZH60089.1|2274256_2274586_-	hypothetical protein	NA	NA	NA	NA	NA
AZH60090.1|2274757_2275816_-	FUSC family protein	NA	NA	NA	NA	NA
AZH60091.1|2276013_2276487_-	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
AZH60092.1|2276605_2277772_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
AZH60093.1|2277980_2279408_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
AZH60094.1|2279518_2280028_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.8e-11
>prophage 8
CP023849	Escherichia coli strain 4/0 chromosome, complete genome	5243509	2303124	2309427	5243509		Enterobacteria_phage(66.67%)	6	NA	NA
AZH60118.1|2303124_2303667_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
AZH60119.1|2303671_2304550_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
AZH60120.1|2304607_2305507_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
AZH62880.1|2305506_2306592_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
AZH60121.1|2306964_2307858_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
AZH60122.1|2308032_2309427_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
>prophage 9
CP023849	Escherichia coli strain 4/0 chromosome, complete genome	5243509	2356145	2396403	5243509	capsid,terminase,integrase,plate,head,portal,holin,tail,lysis	Escherichia_phage(45.65%)	50	2359742:2359760	2403531:2403549
AZH60156.1|2356145_2357549_+	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
AZH60157.1|2357545_2358268_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
AZH60158.1|2358447_2358780_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AZH60159.1|2358926_2360288_+	peptidase	NA	Q6DW11	Phage_TP	99.7	1.9e-217
2359742:2359760	attL	CGCCCATGTTGAACGCCTG	NA	NA	NA	NA
AZH60160.1|2360560_2360815_-	transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	6.1e-45
AZH60161.1|2360860_2362024_-	hypothetical protein	NA	A0A0F7LDZ2	Escherichia_phage	99.0	1.2e-204
AZH60162.1|2362023_2362503_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	2.5e-84
AZH60163.1|2362517_2364965_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.1	0.0e+00
AZH62881.1|2364957_2365077_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AZH60164.1|2365109_2365385_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	97.8	6.3e-40
AZH60165.1|2365441_2365960_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AZH60166.1|2365972_2367163_-|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
AZH60167.1|2367597_2368677_-	hypothetical protein	NA	NA	NA	NA	NA
AZH60168.1|2369005_2369584_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	65.4	6.8e-68
AZH60169.1|2369583_2372202_-|tail	phage tail protein	tail	Q858V4	Yersinia_virus	73.0	3.4e-284
AZH60170.1|2372212_2372743_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	99.4	1.3e-102
AZH60171.1|2372735_2373644_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	2.6e-162
AZH60172.1|2373648_2373996_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
AZH60173.1|2373992_2374628_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	2.6e-113
AZH60174.1|2374711_2375497_+	hypothetical protein	NA	NA	NA	NA	NA
AZH60175.1|2375568_2376021_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	97.3	1.3e-74
AZH60176.1|2376013_2376481_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	98.1	9.7e-81
AZH60177.1|2376443_2376617_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
AZH60178.1|2376588_2377014_-	protein lysB	NA	A0A0F7L9Y0	Escherichia_phage	95.0	4.0e-65
AZH60179.1|2377001_2377427_-	protein lysA	NA	U5N096	Enterobacteria_phage	98.6	1.7e-60
AZH60180.1|2377441_2377939_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
AZH60181.1|2377938_2378220_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AZH60182.1|2378223_2378427_-|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
AZH60183.1|2378426_2378936_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
AZH60184.1|2379035_2379779_-|terminase	terminase	terminase	Q858W5	Yersinia_virus	98.8	2.7e-125
AZH60185.1|2379782_2380856_-|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	99.2	1.6e-200
AZH60186.1|2380914_2381769_-|capsid	capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	88.0	2.7e-137
AZH60187.1|2381942_2383715_+	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
AZH60188.1|2383714_2384749_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	98.8	3.9e-199
AZH60189.1|2384725_2384941_-	hypothetical protein	NA	M1TAP7	Escherichia_phage	86.3	3.6e-14
AZH60190.1|2385167_2386109_+	hypothetical protein	NA	Q2P9W7	Enterobacteria_phage	81.2	2.7e-146
AZH60191.1|2386181_2386334_-	meiotically up-regulated 80 protein	NA	Q2P9X3	Enterobacteria_phage	89.8	1.7e-18
AZH60192.1|2386428_2387109_-	hypothetical protein	NA	Q2P9W8	Enterobacteria_phage	99.1	4.6e-124
AZH60193.1|2387136_2387358_-	DUF2158 domain-containing protein	NA	Q2P9W9	Enterobacteria_phage	98.6	2.9e-35
AZH60194.1|2387454_2389740_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.7	0.0e+00
AZH60195.1|2390741_2391023_-	hypothetical protein	NA	S4TP00	Salmonella_phage	71.4	3.6e-30
AZH60196.1|2391019_2391244_-	hypothetical protein	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
AZH60197.1|2391243_2391546_-	hypothetical protein	NA	A0A0F7LDT6	Escherichia_phage	99.0	2.2e-46
AZH60198.1|2391545_2391770_-	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AZH60199.1|2391833_2392334_-	replication protein B	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
AZH60200.1|2392511_2392787_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
AZH60201.1|2392908_2393208_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
AZH60202.1|2393323_2394337_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
AZH60203.1|2394771_2395089_-	hypothetical protein	NA	NA	NA	NA	NA
AZH60204.1|2395503_2396403_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.5	5.7e-13
2403531:2403549	attR	CGCCCATGTTGAACGCCTG	NA	NA	NA	NA
>prophage 10
CP023849	Escherichia coli strain 4/0 chromosome, complete genome	5243509	2437587	2447032	5243509		Enterobacteria_phage(85.71%)	10	NA	NA
AZH60235.1|2437587_2438724_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
AZH60236.1|2438720_2440724_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
AZH60237.1|2440848_2441310_+	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
AZH60238.1|2441350_2441821_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AZH60239.1|2441867_2442587_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AZH60240.1|2442583_2444269_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AZH60241.1|2444490_2445222_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
AZH60242.1|2445281_2445389_+	hypothetical protein	NA	NA	NA	NA	NA
AZH60243.1|2445369_2446101_-	ABC transporter permease	NA	NA	NA	NA	NA
AZH60244.1|2446105_2447032_-	ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 11
CP023849	Escherichia coli strain 4/0 chromosome, complete genome	5243509	2801250	2867338	5243509	terminase,tRNA,integrase,holin,tail,protease	Escherichia_phage(53.57%)	76	2824580:2824596	2864224:2864240
AZH60565.1|2801250_2803266_-|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
AZH60566.1|2803280_2804144_-	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
AZH60567.1|2804311_2805025_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
AZH60568.1|2805237_2806272_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
AZH60569.1|2806288_2807167_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
AZH60570.1|2807312_2807885_+	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
AZH60571.1|2807884_2808355_+	peroxiredoxin	NA	NA	NA	NA	NA
AZH60572.1|2808452_2809514_-	AI-2E family transporter	NA	NA	NA	NA	NA
AZH60573.1|2809726_2811190_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
AZH60574.1|2811210_2811570_+	oxidoreductase	NA	NA	NA	NA	NA
AZH60575.1|2811707_2812454_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
AZH60576.1|2812503_2813793_-	uracil/xanthine transporter	NA	Q9KX94	Enterobacteria_phage	37.1	8.6e-63
AZH60577.1|2813878_2814505_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AZH60578.1|2814625_2814811_+	hypothetical protein	NA	NA	NA	NA	NA
AZH60579.1|2814829_2815867_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.8e-71
AZH60580.1|2815866_2816505_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
AZH60581.1|2816676_2818743_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
AZH60582.1|2818747_2820289_+	exopolyphosphatase	NA	NA	NA	NA	NA
AZH60583.1|2820327_2822571_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
AZH60584.1|2822752_2822905_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	90.0	7.1e-17
AZH60585.1|2822922_2823114_+	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
AZH60586.1|2823175_2823313_+	succinate dehydrogenase	NA	NA	NA	NA	NA
AZH60587.1|2823415_2823934_+	hypothetical protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
AZH60588.1|2823949_2824489_+	hypothetical protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
2824580:2824596	attL	AATCATTCCCACTCAAT	NA	NA	NA	NA
AZH60589.1|2824706_2825189_-	DUF2514 domain-containing protein	NA	A0A0F6TK39	Escherichia_coli_O157_typing_phage	91.2	8.5e-72
AZH60590.1|2825185_2825815_-	endolysin	NA	G9L6E8	Escherichia_phage	97.1	3.4e-113
AZH60591.1|2825804_2826113_-|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	94.1	1.6e-47
AZH60592.1|2826099_2826504_-	hypothetical protein	NA	G9L6E6	Escherichia_phage	95.5	3.9e-62
AZH60593.1|2826576_2829039_-|tail	phage tail protein	tail	O09496	Escherichia_virus	48.6	7.4e-164
AZH60594.1|2829235_2829493_+	hypothetical protein	NA	G9L6E3	Escherichia_phage	98.8	4.9e-42
AZH60595.1|2829808_2830504_+	hypothetical protein	NA	G9L6E2	Escherichia_phage	100.0	5.4e-128
AZH60596.1|2830650_2831283_+	hypothetical protein	NA	NA	NA	NA	NA
AZH60597.1|2831381_2831543_+	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
AZH60598.1|2831579_2832140_-	hypothetical protein	NA	NA	NA	NA	NA
AZH60599.1|2832142_2834692_-	hypothetical protein	NA	W6MWW8	Pseudomonas_phage	45.4	1.2e-204
AZH60600.1|2834691_2836389_-	hypothetical protein	NA	NA	NA	NA	NA
AZH60601.1|2836390_2839012_-	Lytic transglycosylase, catalytic	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	39.3	9.9e-74
AZH60602.1|2839011_2839557_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	100.0	9.8e-93
AZH60603.1|2839556_2840021_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	100.0	8.4e-85
AZH60604.1|2840020_2842492_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	99.0	0.0e+00
AZH60605.1|2842491_2843097_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	99.5	6.2e-112
AZH60606.1|2843096_2843420_-	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	98.1	2.6e-53
AZH60607.1|2843470_2843806_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
AZH60608.1|2843816_2844254_-	hypothetical protein	NA	G9L6C6	Escherichia_phage	99.3	6.3e-74
AZH60609.1|2844305_2845292_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	99.4	1.6e-186
AZH60610.1|2845306_2846002_-	peptidase	NA	G9L6C4	Escherichia_phage	98.7	4.3e-93
AZH60611.1|2846004_2846301_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
AZH60612.1|2846297_2847977_-|tail	phage tail protein	tail	G9L6C2	Escherichia_phage	99.1	3.1e-302
AZH60613.1|2847991_2848198_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	80.9	1.0e-10
AZH60614.1|2848900_2849257_+	hypothetical protein	NA	Q716B1	Shigella_phage	75.4	2.7e-43
AZH60615.1|2849347_2850823_-|terminase	terminase	terminase	G9L6B8	Escherichia_phage	99.6	2.0e-297
AZH60616.1|2850819_2851494_-|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	100.0	9.0e-120
AZH60617.1|2851534_2851873_-	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	98.2	5.4e-57
AZH60618.1|2851865_2852147_-	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	95.7	6.5e-48
AZH60619.1|2852146_2852407_-	eaa protein	NA	A0A077SLR0	Escherichia_phage	95.3	4.6e-40
AZH60620.1|2852403_2853279_-	hypothetical protein	NA	A0A0N7C063	Escherichia_phage	94.0	2.8e-73
AZH60621.1|2853275_2853641_-	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	99.2	1.9e-68
AZH60622.1|2853642_2854050_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	60.4	6.1e-23
AZH60623.1|2854180_2854492_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	96.1	3.4e-58
AZH62888.1|2854484_2854733_-	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	91.0	4.1e-30
AZH60624.1|2854836_2855181_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	97.4	1.4e-60
AZH62889.1|2855298_2856084_-	replication protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	99.6	3.6e-152
AZH60625.1|2856080_2856896_-	primosomal protein	NA	Q286X4	Escherichia_phage	94.9	1.1e-116
AZH60626.1|2856911_2857112_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	6.0e-32
AZH60627.1|2857262_2857493_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
AZH60628.1|2857647_2858232_+	XRE family transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	99.5	3.5e-104
AZH60629.1|2858540_2858840_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	99.0	9.9e-47
AZH60630.1|2858836_2859736_+	endonuclease	NA	Q858E0	Salmonella_phage	90.6	1.6e-156
AZH60631.1|2859745_2860768_+	recombinase RecT	NA	Q858E1	Salmonella_phage	92.9	7.1e-177
AZH60632.1|2860817_2861066_+	transcriptional regulator	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
AZH62890.1|2861223_2861475_+	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	96.4	3.4e-40
AZH60633.1|2861467_2862118_+	adenine methylase	NA	G9L699	Escherichia_phage	98.1	4.7e-126
AZH60634.1|2862114_2862774_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	79.5	5.7e-103
AZH60635.1|2862776_2864033_-|integrase	integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.0	6.3e-236
AZH60636.1|2864225_2865803_-	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
2864224:2864240	attR	AATCATTCCCACTCAAT	NA	NA	NA	NA
AZH60637.1|2865871_2867338_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
>prophage 12
CP023849	Escherichia coli strain 4/0 chromosome, complete genome	5243509	3063256	3070396	5243509		Escherichia_phage(83.33%)	6	NA	NA
AZH60812.1|3063256_3065818_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
AZH60813.1|3065923_3066580_+	serine/threonine protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
AZH60814.1|3066630_3067398_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
AZH60815.1|3067593_3068502_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
AZH60816.1|3068498_3069761_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
AZH60817.1|3069757_3070396_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 13
CP023849	Escherichia coli strain 4/0 chromosome, complete genome	5243509	5062747	5107634	5243509	transposase,holin	Stx2-converting_phage(30.77%)	52	NA	NA
AZH62606.1|5062747_5064361_+|transposase	IS66 family transposase ISEc23	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
AZH62607.1|5064631_5065645_-	DUF4432 domain-containing protein	NA	NA	NA	NA	NA
AZH62608.1|5065656_5066973_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
AZH62609.1|5067000_5067921_-	ribokinase	NA	NA	NA	NA	NA
AZH62610.1|5068226_5069009_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AZH62611.1|5069010_5069109_-	acetolactate synthase	NA	NA	NA	NA	NA
AZH62975.1|5069236_5069437_-	hypothetical protein	NA	NA	NA	NA	NA
AZH62612.1|5069624_5069822_+	hypothetical protein	NA	NA	NA	NA	NA
AZH62613.1|5069835_5070039_+	hypothetical protein	NA	NA	NA	NA	NA
AZH62614.1|5070213_5070342_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AZH62615.1|5070360_5070465_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AZH62616.1|5070522_5071179_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZH62617.1|5071426_5072704_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AZH62618.1|5072663_5072822_-|holin	choline transporter	holin	NA	NA	NA	NA
AZH62619.1|5072766_5074770_-|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	4.4e-21
AZH62620.1|5074918_5076075_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
AZH62621.1|5076852_5077266_+	hypothetical protein	NA	NA	NA	NA	NA
AZH62622.1|5077822_5078590_-	Fe(3+) dicitrate transport ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
AZH62623.1|5078590_5079547_-	iron-dicitrate transporter subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
AZH62624.1|5079543_5080542_-	Fe3+ dicitrate ABC transporter permease	NA	NA	NA	NA	NA
AZH62625.1|5080538_5081441_-	Fe(3+)-dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
AZH62626.1|5081485_5083810_-	fe(3+) dicitrate transporter fecA	NA	NA	NA	NA	NA
AZH62627.1|5083896_5084850_-	protein FecR	NA	NA	NA	NA	NA
AZH62628.1|5084846_5085368_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
AZH62629.1|5086914_5088288_+	esterase-like activity of phytase	NA	NA	NA	NA	NA
AZH62630.1|5088526_5089912_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
AZH62631.1|5089961_5090309_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AZH62976.1|5090305_5090686_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
AZH62632.1|5090804_5091041_-	hypothetical protein	NA	NA	NA	NA	NA
AZH62633.1|5091040_5091562_-	hypothetical protein	NA	NA	NA	NA	NA
AZH62634.1|5091462_5091870_-	hypothetical protein	NA	NA	NA	NA	NA
AZH62635.1|5092123_5092729_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AZH62636.1|5092892_5093090_+	hypothetical protein	NA	NA	NA	NA	NA
AZH62637.1|5093202_5093403_-	hypothetical protein	NA	NA	NA	NA	NA
AZH62638.1|5093422_5093572_-	hemolysin activation protein	NA	NA	NA	NA	NA
AZH62639.1|5094632_5095250_+	hypothetical protein	NA	NA	NA	NA	NA
AZH62977.1|5095155_5095353_-	hypothetical protein	NA	NA	NA	NA	NA
AZH62640.1|5095421_5095619_+	hypothetical protein	NA	NA	NA	NA	NA
AZH62641.1|5096102_5096318_-	hypothetical protein	NA	NA	NA	NA	NA
AZH62642.1|5096450_5097368_+	hypothetical protein	NA	NA	NA	NA	NA
AZH62643.1|5097452_5098325_+	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
AZH62644.1|5098697_5101544_+	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
AZH62645.1|5101578_5101773_+	hypothetical protein	NA	NA	NA	NA	NA
AZH62646.1|5101772_5101907_+	cytoplasmic protein	NA	NA	NA	NA	NA
AZH62647.1|5101927_5102746_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	9.4e-47
AZH62648.1|5103087_5103561_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	8.7e-13
AZH62978.1|5103606_5104053_+	hypothetical protein	NA	NA	NA	NA	NA
AZH62649.1|5104115_5104337_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
AZH62650.1|5104499_5104868_+	antitoxin	NA	NA	NA	NA	NA
AZH62651.1|5104957_5105278_+	toxin	NA	NA	NA	NA	NA
AZH62652.1|5105331_5106078_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
AZH62653.1|5106092_5107634_-|transposase	IS21 family transposase ISEc12	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
>prophage 1
CP023850	Escherichia coli strain 4/0 plasmid p4_0.1, complete sequence	138672	57929	109095	138672	integrase,transposase	Escherichia_phage(23.08%)	57	100481:100540	113142:113962
AZH63047.1|57929_58736_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
AZH63048.1|58736_59042_-	toxin CcdB	NA	NA	NA	NA	NA
AZH63049.1|59043_59262_-	antitoxin CcdA	NA	NA	NA	NA	NA
AZH63050.1|59807_60320_+	hypothetical protein	NA	NA	NA	NA	NA
AZH63051.1|60353_61505_-	hypothetical protein	NA	NA	NA	NA	NA
AZH63052.1|61566_61992_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AZH63053.1|61988_62339_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AZH63054.1|62369_63983_+|transposase	IS66 family transposase ISEc23	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
AZH63055.1|64193_64967_-	hypothetical protein	NA	NA	NA	NA	NA
AZH63056.1|64979_65480_-	hypothetical protein	NA	NA	NA	NA	NA
AZH63057.1|65744_65975_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AZH63058.1|65971_66388_+	PIN domain-containing protein	NA	NA	NA	NA	NA
AZH63059.1|66432_70257_-	pcar	NA	NA	NA	NA	NA
AZH63060.1|70607_70838_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AZH63061.1|70834_71251_+	PIN domain-containing protein	NA	NA	NA	NA	NA
AZH63062.1|71325_72891_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AZH63063.1|72875_73898_+	DNA helicase UvrD	NA	NA	NA	NA	NA
AZH63064.1|75446_75641_-	hypothetical protein	NA	NA	NA	NA	NA
AZH63065.1|75937_77107_+	hypothetical protein	NA	NA	NA	NA	NA
AZH63066.1|77302_77596_-	hypothetical protein	NA	NA	NA	NA	NA
AZH63067.1|77701_77977_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AZH63068.1|77976_78261_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
AZH63069.1|78865_79618_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AZH63070.1|79663_80629_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
AZH63071.1|80661_81042_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
AZH63072.1|81066_81957_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
AZH63129.1|82189_82384_-	hypothetical protein	NA	NA	NA	NA	NA
AZH63130.1|82940_83807_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
AZH63073.1|83796_84684_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
AZH63074.1|84694_85519_+	phosphodiesterase	NA	NA	NA	NA	NA
AZH63075.1|85524_86598_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	2.6e-28
AZH63076.1|86590_87901_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZH63077.1|89716_90421_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZH63078.1|91130_91616_-	hypothetical protein	NA	NA	NA	NA	NA
AZH63079.1|91640_92195_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
AZH63080.1|92112_92808_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
AZH63081.1|92812_93973_-	ABC transporter permease	NA	NA	NA	NA	NA
AZH63082.1|93932_95216_-	ABC transporter permease	NA	NA	NA	NA	NA
AZH63083.1|95218_96598_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
AZH63084.1|96701_97229_-	iron transporter	NA	NA	NA	NA	NA
AZH63085.1|97269_99216_-	iron permease	NA	NA	NA	NA	NA
AZH63131.1|99158_99344_-	hypothetical protein	NA	NA	NA	NA	NA
AZH63086.1|99502_100318_-	NADH:ubiquinone reductase (Na(+)-transporting) subunit C	NA	NA	NA	NA	NA
100481:100540	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
AZH63087.1|100543_101248_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZH63132.1|101138_101468_-	hypothetical protein	NA	M9Q1K0	Clostridium_phage	55.6	6.9e-09
AZH63088.1|101593_102208_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AZH63089.1|102146_103160_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AZH63133.1|103317_103791_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
AZH63090.1|103921_104710_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
AZH63091.1|104915_105263_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AZH63092.1|105256_106096_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AZH63093.1|106025_106205_-	hypothetical protein	NA	NA	NA	NA	NA
AZH63094.1|106223_106427_+	hypothetical protein	NA	NA	NA	NA	NA
AZH63095.1|106582_107788_+	chromate transporter	NA	NA	NA	NA	NA
AZH63096.1|107798_108104_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AZH63097.1|108119_108302_-	resolvase	NA	NA	NA	NA	NA
AZH63134.1|108330_109095_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
113142:113962	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCTCTCGATAGGTATAGTGTTTTGCAGTTTAGAGGAGATATCGCGATGCATACGCGGAAGGCAATAACGGAGGCAATTCGAAAATTAGGAGTCCAAACCGGTGACCTGTTGATGGTGCATGCCTCACTTAAAGCGATTGGTCCGGTCGAAGGAGGAGCGGAGACGGTCGTTGCCGCGTTACGCTCCGCGGTTGGGCCGACTGGCACTGTGATGGGATACGCGTCGTGGGACCGATCACCCTACGAGGAGACTCTGAATGGCGCTCGGTTGGATGACAAAGCCCGCCGTACCTGGCCGCCGTTCGATCCCGCAACGGCCGGGACTTACCGTGGGTTCGGCCTGCTGAATCAATTTCTGGTTCAAGCCCCCGGCGCGCGGCGCAGCGCGCACCCCGATGCATCGATGGTCGCGGTTGGTCCGCTAGCTGAAACGCTGACGGAGCCTCACGAACTCGGTCACGCCTTGGGGGAAGGGTCGCCCGTCGAGCGGTTCGTCCGCCTTGGCGGGAAGGCCCTGCTGTTGGGTGCGCCGCTAAACTCCGTTACCGCATTGCACTACGCCGAGGCGGTTGCGGATATCCCCAACAAACGATGGGTGACGTATGAGATGCCGATGCTTGGAAGAAACGGTGAAGTCGCCTGGAAAACGGCATCAGAATACGATTCAAACGGCATTCTCGATTGCTTTGCTATCGAAGGAAAGCCGGATGCGGTCGAAACTATAGCAAATGCTTACGTGAAGCTCGGTCGCCATCGAGAAGGTG	NA	NA	NA	NA
>prophage 1
CP023851	Escherichia coli strain 4/0 plasmid p4_0.2, complete sequence	110452	245	110443	110452	capsid,transposase,protease,terminase,integrase,tRNA,tail	Salmonella_phage(82.91%)	133	15844:15863	24698:24717
AZH63142.1|245_890_-	hypothetical protein	NA	J9Q739	Salmonella_phage	86.3	2.9e-107
AZH63143.1|1211_2306_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	45.4	1.3e-75
AZH63144.1|2911_3124_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	3.4e-33
AZH63145.1|3123_3459_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	73.9	8.6e-39
AZH63146.1|3455_3635_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	67.8	4.0e-11
AZH63147.1|3674_3950_-	hypothetical protein	NA	J9Q738	Salmonella_phage	73.6	9.8e-33
AZH63266.1|4005_4422_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	76.9	1.5e-61
AZH63148.1|4417_4717_-	hypothetical protein	NA	A0A220IH96	Escherichia_phage	29.2	6.5e-06
AZH63149.1|4716_5133_-	DUF2591 domain-containing protein	NA	A0A088CQ65	Enterobacteria_phage	62.7	4.6e-42
AZH63150.1|5296_5686_-	hypothetical protein	NA	K7PJK0	Enterobacteria_phage	85.7	1.1e-58
AZH63151.1|5706_6447_-	hypothetical protein	NA	G4KK93	Yersinia_phage	32.2	1.3e-26
AZH63152.1|6493_7318_-	hypothetical protein	NA	A0A0U4IID7	Pseudomonas_phage	25.3	4.1e-18
AZH63153.1|7413_8244_-|protease	serine protease	protease	J9Q7Z4	Salmonella_phage	94.9	3.1e-122
AZH63154.1|8247_8448_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	60.6	3.2e-09
AZH63155.1|8540_9614_-	recombinase	NA	J9Q736	Salmonella_phage	95.2	1.4e-196
AZH63156.1|9616_9883_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	77.3	2.6e-30
AZH63157.1|9882_10827_-	exonuclease	NA	J9Q7S6	Salmonella_phage	90.8	2.3e-166
AZH63158.1|10887_11916_-	regulator	NA	J9Q7Z3	Salmonella_phage	84.6	4.8e-141
AZH63159.1|12033_12465_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	86.7	1.5e-64
AZH63160.1|12590_16109_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	94.3	0.0e+00
15844:15863	attL	AATGATTCCATACATCTCAT	NA	NA	NA	NA
AZH63161.1|16083_16287_-	hypothetical protein	NA	J9Q6I7	Salmonella_phage	91.0	2.0e-30
AZH63162.1|16289_17525_-	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	81.3	6.7e-198
AZH63163.1|17620_19729_-	cobalamin biosynthesis protein CobT	NA	J9Q7G6	Salmonella_phage	66.5	3.3e-229
AZH63164.1|19827_20040_-	hypothetical protein	NA	NA	NA	NA	NA
AZH63165.1|20291_20678_+	transcriptional regulator	NA	NA	NA	NA	NA
AZH63166.1|20672_21776_-|integrase	integrase	integrase	A0A1P8DTG6	Proteus_phage	33.8	1.3e-27
AZH63167.1|21986_22232_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	44.9	4.5e-13
AZH63168.1|22228_22579_-	hypothetical protein	NA	Q716B1	Shigella_phage	51.7	7.9e-27
AZH63169.1|24276_24567_-	C-type natriuretic protein	NA	J9Q7S1	Salmonella_phage	78.1	6.9e-37
AZH63170.1|24563_24716_-	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	74.0	2.1e-13
AZH63171.1|24712_24928_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	72.5	3.3e-20
24698:24717	attR	ATGAGATGTATGGAATCATT	NA	NA	NA	NA
AZH63267.1|24911_25088_-	hypothetical protein	NA	J9Q729	Salmonella_phage	72.4	1.1e-16
AZH63172.1|25087_26410_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	90.9	2.0e-240
AZH63173.1|26406_26664_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	60.2	3.9e-15
AZH63174.1|26944_27727_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	41.1	3.4e-54
AZH63175.1|27802_28984_-	DNA primase	NA	J9Q720	Salmonella_phage	93.8	2.1e-209
AZH63176.1|29065_30406_-	DNA helicase	NA	J9Q7G4	Salmonella_phage	93.3	1.3e-234
AZH63177.1|30449_31190_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	89.6	2.2e-127
AZH63178.1|31472_32240_+	hypothetical protein	NA	NA	NA	NA	NA
AZH63179.1|32292_32652_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.5e-44
AZH63180.1|32651_33320_-	plasmid stability protein	NA	J9Q7R7	Salmonella_phage	91.4	1.7e-110
AZH63181.1|33638_33908_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AZH63182.1|33915_34437_+	N-acetyltransferase	NA	NA	NA	NA	NA
AZH63183.1|34468_34654_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	75.0	4.9e-20
AZH63184.1|34604_34856_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	78.0	1.1e-25
AZH63185.1|34857_35550_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	93.9	1.4e-123
AZH63186.1|35563_35887_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	88.8	2.9e-44
AZH63268.1|35965_36199_-	hypothetical protein	NA	J9Q714	Salmonella_phage	59.2	2.5e-21
AZH63187.1|36209_36818_-	hypothetical protein	NA	J9Q7G0	Salmonella_phage	74.3	2.6e-78
AZH63188.1|36817_37072_-	hypothetical protein	NA	J9Q7R5	Salmonella_phage	67.9	3.0e-28
AZH63269.1|37132_39202_-	chaperone of endosialidase	NA	Q71TP5	Escherichia_phage	69.7	3.4e-61
AZH63189.1|40046_40742_+	hypothetical protein	NA	NA	NA	NA	NA
AZH63190.1|41377_46102_-	host specificity protein J	NA	J9Q713	Salmonella_phage	75.2	0.0e+00
AZH63191.1|46119_46710_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	95.4	8.4e-106
AZH63192.1|46697_47495_-|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	94.0	1.3e-154
AZH63193.1|47487_48219_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	97.0	5.3e-134
AZH63194.1|48268_48604_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	86.4	3.0e-52
AZH63195.1|48646_53215_-|tail	phage tail tape measure protein	tail	J9Q712	Salmonella_phage	86.7	0.0e+00
AZH63196.1|53222_53492_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	94.8	1.7e-34
AZH63197.1|53572_53890_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	96.2	8.6e-49
AZH63198.1|53945_54692_-	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	91.9	6.9e-121
AZH63199.1|54766_55150_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	81.9	4.7e-57
AZH63200.1|55151_55625_-	hypothetical protein	NA	J9Q711	Salmonella_phage	90.4	3.3e-76
AZH63201.1|55615_55960_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	95.6	2.3e-55
AZH63202.1|56039_56873_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	92.1	1.3e-141
AZH63203.1|56872_57307_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	82.6	1.1e-59
AZH63204.1|57351_58272_-	hypothetical protein	NA	J9Q6D6	Salmonella_phage	83.6	6.3e-132
AZH63205.1|58345_59221_-|capsid	phage major capsid protein	capsid	J9Q710	Salmonella_phage	94.5	5.0e-155
AZH63206.1|59246_60134_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	87.9	1.6e-132
AZH63207.1|60155_61730_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	93.1	2.2e-286
AZH63208.1|61756_63013_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	96.9	3.4e-245
AZH63209.1|63012_63645_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	83.8	1.8e-90
AZH63210.1|63840_64107_-	hypothetical protein	NA	J9Q757	Salmonella_phage	88.6	1.4e-36
AZH63211.1|64116_65007_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	98.6	2.6e-167
AZH63212.1|65003_65669_-	ABC transporter	NA	J9Q807	Salmonella_phage	98.6	2.8e-110
AZH63213.1|65665_66334_-	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	89.6	5.6e-106
AZH63214.1|66333_67032_-	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	87.1	5.1e-110
AZH63215.1|67096_68656_+	ATP-dependent helicase	NA	J9Q7I4	Salmonella_phage	93.3	2.3e-280
AZH63216.1|68658_68937_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	62.6	2.2e-24
AZH63270.1|69005_69428_+	hypothetical protein	NA	J9Q806	Salmonella_phage	77.1	4.8e-55
AZH63217.1|69432_69957_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	82.4	2.8e-68
AZH63271.1|70089_70269_+	hypothetical protein	NA	NA	NA	NA	NA
AZH63218.1|70552_71203_+	hypothetical protein	NA	J9Q754	Salmonella_phage	83.8	1.1e-98
AZH63219.1|71251_71455_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	89.6	1.7e-26
AZH63220.1|71476_71707_+	hypothetical protein	NA	NA	NA	NA	NA
AZH63221.1|72088_72298_+	hypothetical protein	NA	NA	NA	NA	NA
AZH63222.1|72324_72807_-	hypothetical protein	NA	J9Q805	Salmonella_phage	69.8	1.0e-61
AZH63223.1|73157_73568_-	hypothetical protein	NA	NA	NA	NA	NA
AZH63224.1|73649_74045_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	54.6	3.1e-32
AZH63225.1|74171_74483_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	63.1	5.7e-29
AZH63226.1|74636_74966_-	hypothetical protein	NA	NA	NA	NA	NA
AZH63227.1|76426_76609_+	hypothetical protein	NA	NA	NA	NA	NA
AZH63228.1|77238_77424_-	hypothetical protein	NA	NA	NA	NA	NA
AZH63272.1|77460_77682_-	hypothetical protein	NA	J9Q750	Salmonella_phage	58.2	1.9e-18
AZH63229.1|77921_79955_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	24.1	2.2e-44
AZH63230.1|80112_81213_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
AZH63231.1|81250_81640_-	DNA repair protein	NA	A0A077SK24	Escherichia_phage	93.0	8.6e-67
AZH63273.1|82435_83104_-	hypothetical protein	NA	A0A0F6TJ66	Escherichia_coli_O157_typing_phage	94.8	1.2e-23
AZH63232.1|83103_83757_-	hypothetical protein	NA	K7P7E4	Enterobacteria_phage	79.6	2.4e-45
AZH63233.1|83756_83942_-	hypothetical protein	NA	NA	NA	NA	NA
AZH63234.1|83938_84469_-	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	65.8	1.7e-33
AZH63235.1|84465_84789_-	carboxylate--amine ligase	NA	A0A222YZB4	Escherichia_phage	88.2	4.2e-43
AZH63236.1|84790_85513_-	hypothetical protein	NA	A0A077SLK5	Escherichia_phage	78.7	1.8e-89
AZH63237.1|85514_85814_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	97.0	4.8e-57
AZH63238.1|85810_86317_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	53.8	5.3e-16
AZH63239.1|86316_86859_-	hypothetical protein	NA	J9Q748	Salmonella_phage	86.3	1.4e-86
AZH63240.1|86855_87497_-	HD domain-containing protein	NA	J9Q7H7	Salmonella_phage	87.3	2.8e-99
AZH63241.1|87616_87997_-	hypothetical protein	NA	J9Q801	Salmonella_phage	68.6	1.3e-27
AZH63242.1|87996_88701_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	77.4	1.5e-88
AZH63243.1|88761_90447_-	DNA modification methylase	NA	J9Q747	Salmonella_phage	92.0	0.0e+00
AZH63244.1|90588_91155_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	64.2	7.7e-56
AZH63245.1|91294_91453_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
AZH63246.1|91452_91878_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	78.7	5.7e-56
AZH63247.1|91971_92160_-	hypothetical protein	NA	J9Q800	Salmonella_phage	53.2	7.2e-11
AZH63248.1|92169_92664_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	56.2	3.0e-24
AZH63249.1|92812_93403_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	83.8	3.7e-93
AZH63250.1|93985_94216_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.2	5.9e-31
AZH63251.1|94401_94995_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	86.3	2.0e-99
AZH63252.1|95178_95988_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	53.2	3.4e-65
AZH63253.1|96146_96704_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	83.1	1.7e-87
AZH63254.1|96713_97133_-	hypothetical protein	NA	J9Q743	Salmonella_phage	71.9	3.2e-51
AZH63255.1|97194_97839_-	hypothetical protein	NA	J9Q7H4	Salmonella_phage	80.8	1.7e-96
AZH63256.1|97838_98315_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	90.5	2.0e-81
AZH63257.1|98311_98725_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	84.7	2.3e-62
AZH63258.1|98726_99857_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	86.6	3.3e-191
AZH63259.1|100948_102091_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	88.7	2.6e-196
AZH63260.1|102197_103781_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	82.1	4.1e-248
AZH63261.1|103746_104960_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.3	1.6e-167
AZH63262.1|105899_106469_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	86.8	1.1e-91
AZH63263.1|106478_107222_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	46.4	9.7e-51
AZH63264.1|107211_109128_-	exonuclease	NA	J9Q741	Salmonella_phage	73.2	4.5e-249
AZH63274.1|109124_109316_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	74.6	8.3e-23
AZH63265.1|109357_110443_-	exonuclease	NA	J9Q7S9	Salmonella_phage	87.3	6.8e-186
