The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP023844	Escherichia coli strain 4/1-1 chromosome, complete genome	5144480	132558	161093	5144480	transposase,bacteriocin	Erysipelothrix_phage(20.0%)	31	NA	NA
AZH52735.1|132558_132843_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AZH52736.1|133010_133250_+	hypothetical protein	NA	NA	NA	NA	NA
AZH52737.1|133250_133541_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AZH52738.1|133707_133896_+	HNH endonuclease	NA	NA	NA	NA	NA
AZH52739.1|133949_134240_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AZH52740.1|134407_134647_+	hypothetical protein	NA	NA	NA	NA	NA
AZH52741.1|134647_134938_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AZH52742.1|135393_136158_+	pyruvate dehydrogenase complex repressor	NA	NA	NA	NA	NA
AZH52743.1|136154_136337_-	hypothetical protein	NA	NA	NA	NA	NA
AZH52744.1|136318_138982_+	pyruvate dehydrogenase E1 component	NA	NA	NA	NA	NA
AZH52745.1|138996_140889_+	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
AZH52746.1|141096_142521_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
AZH52747.1|142591_144355_-	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
AZH52748.1|144612_144729_+	aconitate hydratase	NA	NA	NA	NA	NA
AZH52749.1|144709_147307_+	aconitate hydratase B	NA	NA	NA	NA	NA
AZH52750.1|147481_147844_+	UPF0231 family protein	NA	NA	NA	NA	NA
AZH52751.1|147881_148676_-	S-adenosylmethionine decarboxylase proenzyme	NA	NA	NA	NA	NA
AZH52752.1|148691_149558_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
AZH52753.1|149663_150011_-	hypothetical protein	NA	NA	NA	NA	NA
AZH52754.1|150176_151727_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	3.5e-18
AZH52755.1|151773_154164_-	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
AZH52756.1|154369_154906_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
AZH52757.1|154946_155609_-	carbonic anhydrase	NA	NA	NA	NA	NA
AZH52758.1|155717_156644_+	multidrug ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
AZH52759.1|156640_157411_+	inner membrane transport permease YadH	NA	NA	NA	NA	NA
AZH52760.1|157515_157956_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AZH52761.1|158019_159249_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AZH52762.1|159252_159633_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
AZH52763.1|159582_159786_+	hypothetical protein	NA	NA	NA	NA	NA
AZH52764.1|159906_160827_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	48.8	4.9e-60
AZH52765.1|160895_161093_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
CP023844	Escherichia coli strain 4/1-1 chromosome, complete genome	5144480	929390	1040108	5144480	plate,holin,portal,capsid,integrase,protease,head,tail,tRNA	Enterobacteria_phage(42.55%)	132	1024780:1024795	1044101:1044116
AZH53470.1|929390_929711_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AZH53471.1|929741_932018_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
AZH53472.1|932702_932921_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AZH53473.1|933205_933910_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AZH53474.1|933951_935673_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
AZH53475.1|935673_937440_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
AZH53476.1|937562_938528_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
AZH53477.1|939071_939566_+	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AZH53478.1|939700_943807_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
AZH53479.1|943965_944577_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AZH53480.1|944587_945931_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
AZH53481.1|946021_947314_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AZH53482.1|947619_947760_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
AZH53483.1|947951_948212_-	hypothetical protein	NA	NA	NA	NA	NA
AZH53484.1|948252_949362_-	late control protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
AZH53485.1|949519_950704_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	8.4e-222
AZH53486.1|950703_951216_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
AZH53487.1|951271_951646_+|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	9.9e-36
AZH53488.1|951573_951810_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	94.1	4.3e-21
AZH53489.1|951796_954604_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.1	0.0e+00
AZH53490.1|954610_955105_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	2.1e-86
AZH53491.1|955133_955733_-	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
AZH53492.1|955951_956509_+|tail	phage tail protein	tail	A0A0A7NPY7	Enterobacteria_phage	88.5	5.0e-84
AZH53493.1|956511_957045_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	4.2e-96
AZH53494.1|957073_957601_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.7	2.6e-90
AZH53495.1|957602_959825_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	65.0	3.8e-183
AZH53496.1|959827_960358_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	3.6e-92
AZH53497.1|960350_961247_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
AZH53498.1|961250_961601_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	3.5e-59
AZH53499.1|961597_962179_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	3.3e-102
AZH53500.1|962175_962811_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	1.5e-113
AZH53501.1|962803_963271_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
AZH53502.1|963294_965172_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	H6WZJ9	Escherichia_phage	80.2	2.7e-299
AZH53503.1|965310_965706_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	1.0e-59
AZH53504.1|965702_966095_-	peptidase M15	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	1.9e-69
AZH53505.1|966091_966415_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
AZH53506.1|966417_966618_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
AZH53507.1|966617_967112_-|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
AZH53508.1|968059_969112_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	1.4e-188
AZH53509.1|969135_969972_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
AZH53510.1|970126_971878_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
AZH53511.1|971877_972924_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
AZH53512.1|972938_973463_-	hypothetical protein	NA	NA	NA	NA	NA
AZH53513.1|974186_974684_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
AZH53514.1|974723_975566_+	hypothetical protein	NA	NA	NA	NA	NA
AZH53515.1|975649_975964_-	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.3	4.1e-19
AZH53516.1|975968_976928_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	4.2e-179
AZH57463.1|977004_979689_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.4	0.0e+00
AZH53517.1|979833_980199_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
AZH53518.1|980271_980502_-	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	97.4	9.1e-32
AZH53519.1|980558_980774_+	hypothetical protein	NA	NA	NA	NA	NA
AZH53520.1|980824_981124_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	2.4e-40
AZH53521.1|981120_981387_-	MarR family transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
AZH53522.1|981383_981587_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
AZH53523.1|981610_982021_-	hypothetical protein	NA	NA	NA	NA	NA
AZH53524.1|982224_982467_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
AZH53525.1|982478_982757_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
AZH53526.1|982767_983118_-	DUF4761 domain-containing protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	8.1e-56
AZH53527.1|983255_983447_+	hypothetical protein	NA	NA	NA	NA	NA
AZH53528.1|983453_983876_-	hypothetical protein	NA	NA	NA	NA	NA
AZH53529.1|983880_984402_-	transcriptional regulator	NA	NA	NA	NA	NA
AZH53530.1|984506_984848_+	XRE family transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
AZH53531.1|984917_985910_+|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.2	1.3e-103
AZH53532.1|986209_988654_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
AZH53533.1|988664_989282_+	dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
AZH53534.1|989283_990147_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AZH53535.1|990182_990809_-	hydrolase	NA	NA	NA	NA	NA
AZH53536.1|991122_992271_+	MFS transporter	NA	NA	NA	NA	NA
AZH53537.1|992367_993108_-	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
AZH53538.1|993299_995582_-	formate acetyltransferase 1	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
AZH53539.1|995636_996494_-	formate transporter FocA	NA	NA	NA	NA	NA
AZH53540.1|996899_998660_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
AZH53541.1|998789_999482_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AZH53542.1|999680_1000769_+	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
AZH53543.1|1000839_1002123_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AZH53544.1|1002378_1002951_-	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
AZH53545.1|1003010_1003451_+|tail	phage tail protein	tail	K7PH60	Enterobacterial_phage	55.6	7.1e-41
AZH53546.1|1003461_1003923_+|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	50.0	3.9e-34
AZH53547.1|1003929_1004544_-|tail	phage tail protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
AZH53548.1|1004543_1005875_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	44.4	4.8e-40
AZH53549.1|1005877_1006456_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
AZH53550.1|1006448_1007552_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
AZH53551.1|1007542_1007890_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
AZH53552.1|1007944_1008541_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
AZH53553.1|1008537_1009692_-	phage protein D	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
AZH53554.1|1009679_1009895_-	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
AZH53555.1|1009891_1010776_-	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.9	6.8e-51
AZH53556.1|1010775_1013727_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
AZH53557.1|1013802_1013961_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AZH53558.1|1013884_1014220_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AZH53559.1|1014317_1014599_-	hypothetical protein	NA	NA	NA	NA	NA
AZH53560.1|1014601_1015123_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
AZH53561.1|1015122_1016550_-|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
AZH53562.1|1016539_1016794_-	hypothetical protein	NA	NA	NA	NA	NA
AZH53563.1|1016790_1017255_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AZH53564.1|1017254_1017701_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AZH53565.1|1017702_1018041_-	DUF2190 domain-containing protein	NA	NA	NA	NA	NA
AZH53566.1|1018050_1019004_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
AZH53567.1|1019018_1020134_-	peptidase	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
AZH53568.1|1020348_1020807_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
AZH53569.1|1020809_1021631_-|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
AZH53570.1|1021611_1023108_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
AZH53571.1|1023107_1024703_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	6.5e-185
AZH53572.1|1024699_1025245_-	DUF3486 domain-containing protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
1024780:1024795	attL	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
AZH53573.1|1025244_1025556_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AZH53574.1|1025555_1025882_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
AZH53575.1|1025878_1026529_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
AZH53576.1|1026512_1027253_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
AZH53577.1|1027255_1027606_-	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
AZH53578.1|1027736_1028465_+	hypothetical protein	NA	NA	NA	NA	NA
AZH53579.1|1028440_1028845_-	hypothetical protein	NA	NA	NA	NA	NA
AZH53580.1|1028843_1029059_+	hypothetical protein	NA	NA	NA	NA	NA
AZH53581.1|1029249_1030014_+	restriction endonuclease subunit M	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
AZH53582.1|1030130_1030487_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZH53583.1|1030580_1030769_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
AZH53584.1|1030821_1031130_+	IclR family transcriptional regulator	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
AZH53585.1|1031140_1032061_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
AZH53586.1|1032060_1032378_+	hypothetical protein	NA	NA	NA	NA	NA
AZH53587.1|1032393_1034163_+|integrase	integrase	integrase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
AZH53588.1|1034173_1035340_+	hypothetical protein	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
AZH53589.1|1035342_1035612_+	hypothetical protein	NA	NA	NA	NA	NA
AZH53590.1|1035639_1036170_+	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
AZH53591.1|1036180_1036402_-	hypothetical protein	NA	NA	NA	NA	NA
AZH53592.1|1036458_1036731_+	hypothetical protein	NA	NA	NA	NA	NA
AZH53593.1|1036740_1037037_+	hypothetical protein	NA	NA	NA	NA	NA
AZH53594.1|1037051_1037267_+	hypothetical protein	NA	NA	NA	NA	NA
AZH53595.1|1037263_1037947_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
AZH53596.1|1037943_1038174_+	hypothetical protein	NA	NA	NA	NA	NA
AZH53597.1|1038163_1038370_+	hypothetical protein	NA	NA	NA	NA	NA
AZH53598.1|1038371_1038821_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
AZH53599.1|1038792_1039182_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
AZH53600.1|1039325_1040108_+|protease	metalloprotease	protease	NA	NA	NA	NA
1044101:1044116	attR	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
>prophage 3
CP023844	Escherichia coli strain 4/1-1 chromosome, complete genome	5144480	1250508	1296217	5144480	terminase,holin,portal,capsid,integrase,head,tail,tRNA	Enterobacteria_phage(56.0%)	60	1248826:1248840	1277420:1277434
1248826:1248840	attL	GCTGCCAGCGGGAAA	NA	NA	NA	NA
AZH53798.1|1250508_1251615_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AZH53799.1|1251668_1252130_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AZH53800.1|1252139_1252793_-	23S rRNA pseudouridine synthase E	NA	NA	NA	NA	NA
AZH53801.1|1252964_1254215_+	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	100.0	3.8e-23
AZH53802.1|1254328_1255471_-|integrase	integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
AZH53803.1|1255460_1255697_-	excisionase	NA	NA	NA	NA	NA
AZH53804.1|1255836_1256076_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
AZH53805.1|1256059_1256386_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
AZH53806.1|1256385_1256607_-	conjugal transfer protein TraR	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
AZH53807.1|1256705_1256987_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
AZH53808.1|1256997_1257189_-	hypothetical protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
AZH53809.1|1257161_1257344_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
AZH53810.1|1257340_1258021_-	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
AZH53811.1|1258017_1258803_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AZH53812.1|1258808_1259105_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
AZH53813.1|1259180_1259387_-	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
AZH53814.1|1259982_1260738_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
AZH53815.1|1260776_1261007_+	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
AZH53816.1|1261076_1261616_+	regulator	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
AZH53817.1|1261612_1262632_+	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	64.1	8.8e-111
AZH53818.1|1262628_1263330_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.0	1.5e-125
AZH53819.1|1263579_1267845_+	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AZH53820.1|1267881_1268925_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZH53821.1|1269274_1269376_+	hypothetical protein	NA	NA	NA	NA	NA
AZH53822.1|1269372_1269828_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
AZH53823.1|1269827_1269998_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
AZH53824.1|1269990_1270281_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
AZH53825.1|1270277_1270640_+	hypothetical protein	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
AZH53826.1|1270636_1270777_+	hypothetical protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
AZH53827.1|1270773_1271463_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
AZH53828.1|1271772_1272090_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	86.1	3.3e-40
AZH53829.1|1272076_1272553_+	lysozyme	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
AZH53830.1|1272769_1272952_+	hypothetical protein	NA	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
AZH53831.1|1273042_1273336_-	lipoprotein bor	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
AZH53832.1|1273762_1274143_+	hypothetical protein	NA	H6WZK5	Escherichia_phage	72.2	2.6e-39
AZH53833.1|1274265_1274619_-	hypothetical protein	NA	NA	NA	NA	NA
AZH57476.1|1274506_1274827_-	hypothetical protein	NA	NA	NA	NA	NA
AZH53834.1|1274761_1274956_+	DNA-packaging protein	NA	NA	NA	NA	NA
AZH53835.1|1275095_1275641_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
AZH53836.1|1275615_1277541_+|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
1277420:1277434	attR	TTTCCCGCTGGCAGC	NA	NA	NA	NA
AZH53837.1|1277537_1277744_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AZH53838.1|1277740_1279342_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
AZH53839.1|1279322_1280642_+|capsid	capsid assembly protein	capsid	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
AZH53840.1|1280651_1280984_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
AZH53841.1|1281039_1282065_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
AZH53842.1|1282106_1282505_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.0e-62
AZH53843.1|1282516_1282870_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
AZH53844.1|1282881_1283460_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.7	5.9e-80
AZH53845.1|1283456_1283852_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
AZH57477.1|1283859_1284600_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
AZH53846.1|1284615_1285038_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
AZH53847.1|1285019_1285454_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AZH53848.1|1285446_1288008_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
AZH53849.1|1288004_1288334_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
AZH53850.1|1288333_1289032_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
AZH53851.1|1289036_1289780_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
AZH53852.1|1289677_1290319_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.5	2.9e-96
AZH53853.1|1290379_1293862_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
AZH53854.1|1293920_1295942_+|tail	phage tail protein	tail	A0A0E3M0V5	Enterobacteria_phage	72.3	7.2e-181
AZH53855.1|1295938_1296217_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
>prophage 4
CP023844	Escherichia coli strain 4/1-1 chromosome, complete genome	5144480	1436718	1506433	5144480	terminase,holin,portal,transposase,capsid,integrase,lysis,head,tail,protease	Enterobacteria_phage(27.12%)	86	1432892:1432906	1438802:1438816
1432892:1432906	attL	ACTCCTTGTTCGGGA	NA	NA	NA	NA
AZH53995.1|1436718_1437849_-|integrase	integrase	integrase	O21940	Phage_21	51.4	3.4e-103
AZH53996.1|1437826_1438075_-	excisionase	NA	NA	NA	NA	NA
AZH53997.1|1438139_1440611_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
1438802:1438816	attR	ACTCCTTGTTCGGGA	NA	NA	NA	NA
AZH53998.1|1440703_1440895_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AZH53999.1|1440891_1441080_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AZH54000.1|1441402_1441597_+	hypothetical protein	NA	NA	NA	NA	NA
AZH54001.1|1441645_1441864_-	hypothetical protein	NA	NA	NA	NA	NA
AZH54002.1|1441893_1442064_-	hypothetical protein	NA	NA	NA	NA	NA
AZH57488.1|1442023_1442179_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
AZH54003.1|1442451_1443168_-	LexA family transcriptional repressor	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
AZH54004.1|1443217_1443433_+	transcriptional regulator	NA	NA	NA	NA	NA
AZH54005.1|1443429_1443855_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AZH54006.1|1443877_1444840_+	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
AZH54007.1|1444846_1445593_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
AZH54008.1|1445614_1446385_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
AZH54009.1|1446400_1446826_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
AZH54010.1|1447000_1447666_+	hypothetical protein	NA	NA	NA	NA	NA
AZH54011.1|1447846_1448059_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
AZH54012.1|1448100_1448280_-	hypothetical protein	NA	NA	NA	NA	NA
AZH54013.1|1448226_1448499_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
AZH54014.1|1448500_1449556_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
AZH54015.1|1449556_1449937_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.9e-35
AZH54016.1|1449933_1450755_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.7e-80
AZH54017.1|1450981_1451179_+	TrmB family transcriptional regulator	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
AZH54018.1|1451330_1452380_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
AZH54019.1|1452819_1453146_+	hypothetical protein	NA	NA	NA	NA	NA
AZH54020.1|1453181_1453313_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
AZH54021.1|1453593_1453929_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
AZH54022.1|1454189_1456043_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
AZH54023.1|1456193_1456409_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
AZH54024.1|1456413_1456758_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
AZH54025.1|1456723_1456996_-	hypothetical protein	NA	NA	NA	NA	NA
AZH54026.1|1457101_1457635_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
AZH54027.1|1457712_1457925_+	hypothetical protein	NA	A0A0M4S639	Salmonella_phage	60.5	2.7e-06
AZH57489.1|1458189_1458276_+	hypothetical protein	NA	NA	NA	NA	NA
AZH54028.1|1458277_1458772_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	87.7	1.7e-72
AZH54029.1|1458768_1458984_+	hypothetical protein	NA	NA	NA	NA	NA
AZH57490.1|1458980_1459145_+	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	77.8	3.3e-12
AZH54030.1|1459182_1459383_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
AZH54031.1|1459424_1459790_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
AZH54032.1|1460080_1460644_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
AZH54033.1|1460640_1462302_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
AZH54034.1|1462365_1464303_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.8	0.0e+00
AZH57491.1|1464347_1464569_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	98.6	1.7e-35
AZH54035.1|1464514_1467100_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
AZH54036.1|1467096_1467423_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
AZH54037.1|1467432_1467783_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AZH54038.1|1467779_1468226_+	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AZH54039.1|1468222_1468567_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AZH54040.1|1468633_1469350_+|tail	phage tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
AZH54041.1|1469364_1469739_+|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
AZH54042.1|1469762_1470044_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.9	2.3e-45
AZH54043.1|1470091_1473334_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.6	0.0e+00
AZH54044.1|1473326_1473668_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
AZH54045.1|1473667_1474366_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
AZH54046.1|1474376_1475120_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	4.3e-147
AZH54047.1|1475017_1475698_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.8	3.8e-110
AZH54048.1|1476040_1479514_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
AZH54049.1|1479581_1480040_+	hypothetical protein	NA	Q9EV15	Enterobacteria_phage	89.0	9.5e-65
AZH54050.1|1480154_1481696_+|transposase	IS21 family transposase ISEc12	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
AZH54051.1|1481710_1482457_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
AZH54052.1|1482918_1485825_+|tail	phage tail protein	tail	A0A0F7LDR4	Escherichia_phage	45.9	1.1e-118
AZH54053.1|1485840_1486368_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
AZH54054.1|1486398_1486932_-|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
AZH54055.1|1486933_1487719_-|tail	phage tail protein	tail	Q858V4	Yersinia_virus	77.8	1.3e-109
AZH57492.1|1487946_1488129_+	DNA-invertase	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
AZH54056.1|1488245_1488383_+|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AZH57493.1|1488327_1488954_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZH54057.1|1489052_1489322_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
AZH54058.1|1489733_1490291_-	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
AZH54059.1|1490287_1490563_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
AZH54060.1|1490938_1491745_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AZH54061.1|1491744_1492938_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AZH54062.1|1492949_1494308_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
AZH54063.1|1494311_1495907_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
AZH54064.1|1495906_1497469_-	anthranilate synthase component I	NA	NA	NA	NA	NA
AZH57494.1|1497560_1497605_-	trp operon leader peptide	NA	NA	NA	NA	NA
AZH54065.1|1497742_1498624_+	phosphatase	NA	NA	NA	NA	NA
AZH54066.1|1498620_1499241_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AZH54067.1|1499268_1501164_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
AZH54068.1|1501376_1502252_+	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
AZH57495.1|1502457_1503444_+	hypothetical protein	NA	NA	NA	NA	NA
AZH54069.1|1503453_1503762_+	hypothetical protein	NA	NA	NA	NA	NA
AZH54070.1|1503818_1504409_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AZH54071.1|1504405_1505164_-	NAD(P)-dependent oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
AZH54072.1|1505383_1506433_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 5
CP023844	Escherichia coli strain 4/1-1 chromosome, complete genome	5144480	1998064	2086310	5144480	terminase,plate,holin,portal,transposase,capsid,integrase,head,tail,tRNA	Escherichia_phage(22.22%)	107	2043761:2043820	2086372:2086496
AZH54538.1|1998064_1998787_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	54.4	1.6e-69
AZH54539.1|1998891_1999413_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AZH54540.1|1999522_2000533_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
AZH54541.1|2000541_2001153_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AZH57513.1|2001291_2001357_-	hypothetical protein	NA	NA	NA	NA	NA
AZH54542.1|2001427_2002030_+	hypothetical protein	NA	NA	NA	NA	NA
AZH54543.1|2002031_2002553_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
AZH54544.1|2002587_2003328_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AZH54545.1|2003356_2003809_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
AZH54546.1|2003801_2005574_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AZH54547.1|2005883_2006450_+	hydrolase	NA	NA	NA	NA	NA
AZH54548.1|2006446_2007265_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
AZH54549.1|2007317_2007713_+	hypothetical protein	NA	NA	NA	NA	NA
AZH54550.1|2007753_2008497_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
AZH54551.1|2008493_2009465_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AZH54552.1|2009500_2011930_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	NA	NA	NA	NA
AZH54553.1|2011954_2013055_-	cytochrome C	NA	NA	NA	NA	NA
AZH54554.1|2013442_2014189_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AZH57514.1|2014202_2014769_-	VOC family protein	NA	NA	NA	NA	NA
AZH54555.1|2014984_2016718_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
AZH54556.1|2016770_2017163_-	flagellar protein FlhE	NA	NA	NA	NA	NA
AZH54557.1|2017162_2019241_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
AZH54558.1|2019233_2020382_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
AZH54559.1|2020570_2021215_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
AZH54560.1|2021225_2021615_-	two-component system response regulator	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
AZH54561.1|2021629_2022679_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
AZH54562.1|2022681_2023542_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
AZH54563.1|2023832_2025494_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
AZH54564.1|2025638_2026142_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AZH54565.1|2026162_2028127_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
AZH54566.1|2028131_2029058_-	motility protein MotB	NA	NA	NA	NA	NA
AZH54567.1|2029054_2029942_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
AZH54568.1|2030068_2030647_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
AZH54569.1|2030649_2031000_-	flagellar transcriptional activator FlhD	NA	NA	NA	NA	NA
AZH54570.1|2031779_2032208_+	universal stress protein UspC	NA	NA	NA	NA	NA
AZH54571.1|2032214_2033639_-	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
AZH54572.1|2033613_2034414_-	trehalose-phosphatase	NA	NA	NA	NA	NA
AZH54573.1|2034580_2035567_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
AZH54574.1|2035581_2037096_-	arabinose import ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
AZH54575.1|2037165_2038155_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZH54576.1|2038240_2038480_-	hypothetical protein	NA	NA	NA	NA	NA
AZH54577.1|2038949_2039453_+	non-heme ferritin	NA	NA	NA	NA	NA
AZH54578.1|2039530_2039782_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
AZH54579.1|2039893_2040040_+	hypothetical protein	NA	NA	NA	NA	NA
AZH54580.1|2040246_2040570_+	hypothetical protein	NA	NA	NA	NA	NA
AZH54581.1|2040741_2041239_+	non-heme ferritin	NA	NA	NA	NA	NA
AZH54582.1|2041276_2041516_-	DUF2492 domain-containing protein	NA	NA	NA	NA	NA
AZH54583.1|2041706_2042918_+	tyrosine transporter	NA	NA	NA	NA	NA
AZH54584.1|2042968_2043634_-	YecA family protein	NA	NA	NA	NA	NA
2043761:2043820	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
AZH54585.1|2044105_2044525_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
AZH54586.1|2045739_2045964_-|tail	phage tail protein	tail	NA	NA	NA	NA
AZH57515.1|2046125_2046515_-	hypothetical protein	NA	E5FFG4	Burkholderia_phage	37.9	1.0e-14
AZH54587.1|2046550_2048191_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
AZH54588.1|2048299_2048581_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AZH54589.1|2048593_2049106_-|tail	phage tail protein	tail	NA	NA	NA	NA
AZH54590.1|2049123_2050626_-|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
AZH54591.1|2050622_2051012_-	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
AZH54592.1|2051011_2052196_-	hypothetical protein	NA	J9QDX3	Clostridium_phage	35.2	2.5e-16
AZH54593.1|2052188_2052815_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
AZH54594.1|2052817_2053738_-|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
AZH54595.1|2053734_2054076_-|plate	baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.1e-20
AZH54596.1|2054078_2054981_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
AZH54597.1|2054961_2055498_-	hypothetical protein	NA	NA	NA	NA	NA
AZH54598.1|2055494_2056175_-	hypothetical protein	NA	NA	NA	NA	NA
AZH54599.1|2056206_2056587_-	hypothetical protein	NA	NA	NA	NA	NA
AZH54600.1|2056583_2057003_-	DNA-packaging protein	NA	NA	NA	NA	NA
AZH54601.1|2057037_2058072_-|capsid	minor capsid protein E	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
AZH54602.1|2058130_2058460_-|head	head protein	head	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
AZH54603.1|2058459_2059767_-|capsid	capsid assembly protein	capsid	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
AZH54604.1|2059766_2061341_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
AZH54605.1|2061337_2061571_-	hypothetical protein	NA	NA	NA	NA	NA
AZH54606.1|2061570_2063433_-|terminase	terminase	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
AZH54607.1|2063419_2063986_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
AZH57516.1|2064354_2064600_+	hypothetical protein	NA	NA	NA	NA	NA
AZH54608.1|2064659_2064854_-	hypothetical protein	NA	NA	NA	NA	NA
AZH54609.1|2064861_2065341_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
AZH54610.1|2065340_2065613_-|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
AZH54611.1|2065612_2065996_-	hypothetical protein	NA	NA	NA	NA	NA
AZH54612.1|2066108_2066780_-	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
AZH54613.1|2066779_2067073_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
AZH54614.1|2067069_2067666_-	hypothetical protein	NA	H9C173	Pectobacterium_phage	63.6	2.2e-69
AZH54615.1|2067743_2067923_-	hypothetical protein	NA	NA	NA	NA	NA
AZH54616.1|2068074_2068716_-	hypothetical protein	NA	NA	NA	NA	NA
AZH54617.1|2068959_2069193_+	hypothetical protein	NA	NA	NA	NA	NA
AZH54618.1|2069591_2070080_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
AZH54619.1|2070089_2070695_+	hypothetical protein	NA	NA	NA	NA	NA
AZH54620.1|2071157_2071856_-	lysogenic protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
AZH54621.1|2073043_2073967_+	hypothetical protein	NA	NA	NA	NA	NA
AZH57517.1|2074141_2074930_-	hypothetical protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
AZH54622.1|2075202_2075424_-	hypothetical protein	NA	NA	NA	NA	NA
AZH54623.1|2075611_2075836_-	hypothetical protein	NA	NA	NA	NA	NA
AZH54624.1|2075832_2076144_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
AZH54625.1|2076140_2076377_-	hypothetical protein	NA	NA	NA	NA	NA
AZH54626.1|2076378_2076789_-	hypothetical protein	NA	NA	NA	NA	NA
AZH54627.1|2076827_2078243_-	helicase DnaB	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
AZH54628.1|2078232_2078988_-	replication protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
AZH54629.1|2078984_2079209_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
AZH54630.1|2079248_2079725_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
AZH54631.1|2079783_2080014_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
AZH54632.1|2080112_2080526_+	transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
AZH54633.1|2081536_2081857_+	hypothetical protein	NA	NA	NA	NA	NA
AZH54634.1|2081887_2084104_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
AZH54635.1|2084100_2084670_+	hypothetical protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
AZH54636.1|2084669_2084852_+	hypothetical protein	NA	NA	NA	NA	NA
AZH54637.1|2084901_2085126_+	hypothetical protein	NA	H9C154	Pectobacterium_phage	56.3	7.3e-10
AZH54638.1|2085061_2085325_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
AZH54639.1|2085293_2086310_+|integrase	integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
2086372:2086496	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAAT	NA	NA	NA	NA
>prophage 6
CP023844	Escherichia coli strain 4/1-1 chromosome, complete genome	5144480	2135862	2213296	5144480	transposase,integrase	Bacillus_phage(30.0%)	60	2138858:2138873	2216324:2216339
AZH54700.1|2135862_2136585_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	54.4	3.1e-70
AZH54701.1|2136689_2137211_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AZH54702.1|2137471_2138122_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
AZH54703.1|2138157_2138487_+	hypothetical protein	NA	NA	NA	NA	NA
2138858:2138873	attL	GTTCAGCCGCTCCGGC	NA	NA	NA	NA
AZH57519.1|2138974_2139772_+	protein MtfA	NA	NA	NA	NA	NA
AZH54704.1|2140109_2141372_+|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.5	2.6e-72
AZH54705.1|2141565_2142870_-	salicylate synthase	NA	NA	NA	NA	NA
AZH54706.1|2142897_2144178_-	MFS transporter	NA	NA	NA	NA	NA
AZH54707.1|2144170_2145973_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
AZH54708.1|2145959_2147762_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.6	6.5e-32
AZH54709.1|2147928_2148888_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZH54710.1|2149078_2155186_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	27.3	1.8e-33
AZH54711.1|2155273_2164765_+	polyketide synthase	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
AZH54712.1|2164761_2165862_+	thiazolinyl imide reductase	NA	NA	NA	NA	NA
AZH54713.1|2165858_2166662_+	thioesterase	NA	NA	NA	NA	NA
AZH54714.1|2166665_2168243_+	2,3-dihydroxybenzoate-AMP ligase	NA	NA	NA	NA	NA
AZH54715.1|2168373_2170395_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AZH54716.1|2170987_2171794_+	hypothetical protein	NA	NA	NA	NA	NA
AZH54717.1|2171720_2171891_+	adhesin	NA	NA	NA	NA	NA
AZH54718.1|2171926_2173189_+	adhesin	NA	NA	NA	NA	NA
AZH54719.1|2173408_2173885_+	invasin	NA	NA	NA	NA	NA
AZH54720.1|2174012_2175065_-	hypothetical protein	NA	NA	NA	NA	NA
AZH54721.1|2175379_2176696_+	MFS transporter	NA	NA	NA	NA	NA
AZH54722.1|2176797_2178252_+	AMP nucleosidase	NA	NA	NA	NA	NA
AZH54723.1|2178594_2179311_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AZH54724.1|2179521_2179725_+	hypothetical protein	NA	NA	NA	NA	NA
AZH54725.1|2179940_2181428_-	FMN/FAD transporter	NA	NA	NA	NA	NA
AZH54726.1|2181701_2182652_-	transcriptional regulator Cbl	NA	NA	NA	NA	NA
AZH54727.1|2182753_2183671_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
AZH54728.1|2184128_2185061_-	L,D-transpeptidase	NA	NA	NA	NA	NA
AZH54729.1|2185125_2186205_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
AZH54730.1|2186216_2186960_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
AZH54731.1|2186956_2187502_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
AZH54732.1|2187653_2187776_-	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
AZH54733.1|2188869_2189067_+	hypothetical protein	NA	NA	NA	NA	NA
AZH54734.1|2188994_2189222_-	hypothetical protein	NA	NA	NA	NA	NA
AZH54735.1|2189173_2191321_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AZH54736.1|2191691_2192336_-	transcriptional regulator	NA	A0A0F7L444	uncultured_marine_virus	50.5	8.2e-54
AZH57520.1|2192320_2193544_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.5	2.0e-61
AZH54737.1|2194591_2195245_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
AZH54738.1|2195258_2196455_+	hypothetical protein	NA	NA	NA	NA	NA
AZH57521.1|2196432_2197014_+	acetyltransferase	NA	NA	NA	NA	NA
AZH54739.1|2197015_2197789_+	YaiO family outer membrane beta-barrel protein	NA	NA	NA	NA	NA
AZH54740.1|2198790_2200005_+	ribokinase	NA	NA	NA	NA	NA
AZH54741.1|2200018_2200777_+	cytoplasmic protein	NA	NA	NA	NA	NA
AZH54742.1|2200830_2201796_+	hypothetical protein	NA	NA	NA	NA	NA
AZH54743.1|2201798_2202833_+	phosphotriesterase	NA	NA	NA	NA	NA
AZH54744.1|2205147_2205645_-	hypothetical protein	NA	NA	NA	NA	NA
AZH54745.1|2205545_2205947_-	hypothetical protein	NA	NA	NA	NA	NA
AZH54746.1|2206112_2206718_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AZH54747.1|2206881_2207082_+	hypothetical protein	NA	NA	NA	NA	NA
AZH54748.1|2207321_2207462_-	hemolysin expression modulating family protein	NA	NA	NA	NA	NA
AZH57522.1|2207448_2207829_+	hypothetical protein	NA	NA	NA	NA	NA
AZH54749.1|2207796_2208030_-	hypothetical protein	NA	NA	NA	NA	NA
AZH54750.1|2208261_2209458_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZH54751.1|2209506_2209860_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AZH54752.1|2209938_2210556_+	hypothetical protein	NA	NA	NA	NA	NA
AZH54753.1|2211029_2211245_+	hypothetical protein	NA	NA	NA	NA	NA
AZH54754.1|2211581_2212277_-|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	88.4	2.3e-118
AZH54755.1|2212273_2213296_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
2216324:2216339	attR	GCCGGAGCGGCTGAAC	NA	NA	NA	NA
>prophage 7
CP023844	Escherichia coli strain 4/1-1 chromosome, complete genome	5144480	2227911	2236946	5144480	transposase	Acidithiobacillus_phage(25.0%)	11	NA	NA
AZH54768.1|2227911_2229453_+|transposase	IS21 family transposase ISEc12	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
AZH54769.1|2229467_2230214_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
AZH54770.1|2230494_2232036_+|transposase	IS21 family transposase ISEc12	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
AZH54771.1|2232050_2232797_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
AZH54772.1|2233245_2233656_+	hypothetical protein	NA	NA	NA	NA	NA
AZH54773.1|2233876_2234695_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
AZH54774.1|2234694_2234940_+	antirestriction protein	NA	NA	NA	NA	NA
AZH54775.1|2235033_2235507_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
AZH57525.1|2235552_2235999_+	hypothetical protein	NA	NA	NA	NA	NA
AZH54776.1|2236061_2236283_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
AZH54777.1|2236301_2236946_+	antitoxin of toxin-antitoxin stability system	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
>prophage 8
CP023844	Escherichia coli strain 4/1-1 chromosome, complete genome	5144480	2267749	2274052	5144480		Enterobacteria_phage(66.67%)	6	NA	NA
AZH54808.1|2267749_2268292_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
AZH54809.1|2268296_2269175_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
AZH54810.1|2269232_2270132_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
AZH57530.1|2270131_2271217_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
AZH54811.1|2271589_2272483_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
AZH54812.1|2272657_2274052_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
>prophage 9
CP023844	Escherichia coli strain 4/1-1 chromosome, complete genome	5144480	2320770	2360627	5144480	terminase,plate,holin,portal,capsid,integrase,head,lysis,tail	Escherichia_phage(45.45%)	50	2324367:2324385	2367755:2367773
AZH54846.1|2320770_2322174_+	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
AZH54847.1|2322170_2322893_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
AZH54848.1|2323072_2323405_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AZH54849.1|2323551_2324913_+	peptidase	NA	Q6DW11	Phage_TP	99.7	1.9e-217
2324367:2324385	attL	CGCCCATGTTGAACGCCTG	NA	NA	NA	NA
AZH54850.1|2325185_2325440_-	transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	6.1e-45
AZH54851.1|2325485_2326649_-	hypothetical protein	NA	A0A0F7LDZ2	Escherichia_phage	99.0	1.2e-204
AZH54852.1|2326648_2327128_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	2.5e-84
AZH54853.1|2327142_2329590_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.1	0.0e+00
AZH57531.1|2329582_2329702_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AZH54854.1|2329734_2330010_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	97.8	6.3e-40
AZH54855.1|2330066_2330585_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AZH54856.1|2330597_2331788_-|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
AZH54857.1|2332222_2333302_-	hypothetical protein	NA	NA	NA	NA	NA
AZH54858.1|2333630_2334209_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	65.4	6.8e-68
AZH54859.1|2334208_2336827_-|tail	phage tail protein	tail	Q858V4	Yersinia_virus	73.0	3.4e-284
AZH54860.1|2336837_2337368_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	99.4	1.3e-102
AZH54861.1|2337360_2338269_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	2.6e-162
AZH54862.1|2338273_2338621_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
AZH54863.1|2338617_2339253_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	2.6e-113
AZH54864.1|2339336_2340122_+	hypothetical protein	NA	NA	NA	NA	NA
AZH54865.1|2340193_2340646_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	97.3	1.3e-74
AZH54866.1|2340638_2341106_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	98.1	9.7e-81
AZH54867.1|2341068_2341242_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
AZH54868.1|2341213_2341639_-	protein lysB	NA	A0A0F7L9Y0	Escherichia_phage	95.0	4.0e-65
AZH54869.1|2341626_2342052_-	protein lysA	NA	U5N096	Enterobacteria_phage	98.6	1.7e-60
AZH54870.1|2342066_2342564_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
AZH54871.1|2342563_2342845_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AZH54872.1|2342848_2343052_-|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
AZH54873.1|2343051_2343561_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
AZH54874.1|2343660_2344404_-|terminase	terminase	terminase	Q858W5	Yersinia_virus	98.8	2.7e-125
AZH54875.1|2344407_2345481_-|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	98.6	3.1e-199
AZH54876.1|2345539_2346394_-|capsid	capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	88.0	2.7e-137
AZH54877.1|2346567_2348340_+	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
AZH54878.1|2348339_2349374_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	98.8	3.3e-198
AZH54879.1|2349350_2349566_-	hypothetical protein	NA	M1TAP7	Escherichia_phage	84.3	2.3e-13
AZH54880.1|2349877_2350072_-	hypothetical protein	NA	NA	NA	NA	NA
AZH54881.1|2350070_2350508_+	hypothetical protein	NA	S4TUD6	Salmonella_phage	86.0	1.4e-65
AZH54882.1|2350670_2351762_+	MBL fold hydrolase	NA	Q0H255	Geobacillus_phage	33.3	9.1e-05
AZH54883.1|2351775_2352264_-	phosphohistidine phosphatase	NA	NA	NA	NA	NA
AZH54884.1|2352681_2354982_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.0	0.0e+00
AZH54885.1|2354971_2355247_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
AZH54886.1|2355243_2355468_-	hypothetical protein	NA	S4TRY6	Salmonella_phage	98.6	3.2e-34
AZH54887.1|2355470_2355770_-	hypothetical protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
AZH54888.1|2355769_2355994_-	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
AZH54889.1|2356057_2356558_-	replication protein B	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
AZH54890.1|2356735_2357011_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
AZH54891.1|2357132_2357432_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
AZH54892.1|2357547_2358561_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
AZH54893.1|2358995_2359313_-	hypothetical protein	NA	NA	NA	NA	NA
AZH54894.1|2359727_2360627_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.5	5.7e-13
2367755:2367773	attR	CGCCCATGTTGAACGCCTG	NA	NA	NA	NA
>prophage 10
CP023844	Escherichia coli strain 4/1-1 chromosome, complete genome	5144480	2401811	2411256	5144480		Enterobacteria_phage(85.71%)	10	NA	NA
AZH54925.1|2401811_2402948_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
AZH54926.1|2402944_2404948_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
AZH54927.1|2405072_2405534_+	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
AZH54928.1|2405574_2406045_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AZH54929.1|2406091_2406811_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AZH54930.1|2406807_2408493_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AZH54931.1|2408714_2409446_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
AZH54932.1|2409505_2409613_+	hypothetical protein	NA	NA	NA	NA	NA
AZH54933.1|2409593_2410325_-	ABC transporter permease	NA	NA	NA	NA	NA
AZH54934.1|2410329_2411256_-	ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.6e-08
>prophage 11
CP023844	Escherichia coli strain 4/1-1 chromosome, complete genome	5144480	2765449	2830874	5144480	terminase,holin,integrase,protease,tail,tRNA	Escherichia_phage(50.0%)	70	2788779:2788795	2827760:2827776
AZH55254.1|2765449_2767465_-|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
AZH55255.1|2767479_2768343_-	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
AZH55256.1|2768510_2769224_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
AZH55257.1|2769436_2770471_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
AZH55258.1|2770487_2771366_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
AZH55259.1|2771511_2772084_+	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
AZH55260.1|2772083_2772554_+	peroxiredoxin	NA	NA	NA	NA	NA
AZH55261.1|2772651_2773713_-	AI-2E family transporter	NA	NA	NA	NA	NA
AZH55262.1|2773925_2775389_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
AZH55263.1|2775409_2775769_+	oxidoreductase	NA	NA	NA	NA	NA
AZH55264.1|2775906_2776653_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
AZH55265.1|2776702_2777992_-	uracil/xanthine transporter	NA	Q9KX94	Enterobacteria_phage	37.1	8.6e-63
AZH55266.1|2778077_2778704_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AZH55267.1|2778824_2779010_+	hypothetical protein	NA	NA	NA	NA	NA
AZH55268.1|2779028_2780066_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.8e-71
AZH55269.1|2780065_2780704_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
AZH55270.1|2780875_2782942_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
AZH55271.1|2782946_2784488_+	exopolyphosphatase	NA	NA	NA	NA	NA
AZH55272.1|2784526_2786770_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
AZH55273.1|2786951_2787104_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	90.0	7.1e-17
AZH55274.1|2787121_2787313_+	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
AZH55275.1|2787374_2787512_+	succinate dehydrogenase	NA	NA	NA	NA	NA
AZH55276.1|2787614_2788133_+	hypothetical protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
AZH55277.1|2788148_2788688_+	hypothetical protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
2788779:2788795	attL	AATCATTCCCACTCAAT	NA	NA	NA	NA
AZH55278.1|2788905_2789388_-	endopeptidase	NA	A0A2R9YJI7	Escherichia_phage	94.4	3.1e-74
AZH55279.1|2789384_2790014_-	endolysin	NA	A0A0F6R8M1	Escherichia_coli_O157_typing_phage	98.1	1.2e-113
AZH55280.1|2790003_2790312_-|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	94.1	4.6e-47
AZH55281.1|2790298_2790703_-	hypothetical protein	NA	G9L6E6	Escherichia_phage	95.5	3.9e-62
AZH55282.1|2790775_2793238_-|tail	phage tail protein	tail	O09496	Escherichia_virus	50.2	1.3e-171
AZH55283.1|2793434_2793692_+	hypothetical protein	NA	G9L6E3	Escherichia_phage	98.8	4.9e-42
AZH55284.1|2794007_2794718_+	BRO-like protein	NA	G9L6E2	Escherichia_phage	80.3	8.9e-102
AZH55285.1|2794864_2795497_+	hypothetical protein	NA	NA	NA	NA	NA
AZH55286.1|2795595_2795757_+	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
AZH55287.1|2795788_2796085_-	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	100.0	4.7e-49
AZH55288.1|2796280_2798755_-	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	99.4	0.0e+00
AZH55289.1|2798760_2800563_-	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	97.5	0.0e+00
AZH55290.1|2800559_2803073_-	hypothetical protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	99.3	0.0e+00
AZH55291.1|2803072_2803618_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	99.4	6.4e-92
AZH55292.1|2803617_2804082_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	99.4	1.9e-84
AZH55293.1|2804081_2806553_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	99.3	0.0e+00
AZH55294.1|2806552_2807158_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	99.5	6.2e-112
AZH55295.1|2807157_2807481_-	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	98.1	2.6e-53
AZH55296.1|2807531_2807867_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
AZH55297.1|2807877_2808315_-	hypothetical protein	NA	G9L6C6	Escherichia_phage	99.3	6.3e-74
AZH55298.1|2808366_2809353_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	98.8	1.4e-185
AZH55299.1|2809367_2810063_-	peptidase	NA	G9L6C4	Escherichia_phage	99.6	3.0e-94
AZH55300.1|2810065_2810362_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
AZH55301.1|2810358_2812038_-|tail	phage tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	98.9	4.7e-303
AZH55302.1|2812052_2812259_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
AZH55303.1|2812961_2813333_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	89.4	2.9e-56
AZH55304.1|2813423_2814899_-|terminase	terminase	terminase	G9L6B8	Escherichia_phage	99.2	1.3e-296
AZH57538.1|2814895_2815570_-|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	99.1	7.6e-119
AZH55305.1|2815609_2815948_-	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	87.5	3.7e-50
AZH55306.1|2816972_2817713_-	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	76.3	2.4e-57
AZH55307.1|2817699_2818017_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	93.0	6.2e-47
AZH55308.1|2818604_2818949_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	97.4	1.4e-60
AZH57539.1|2819066_2819852_-	replication protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	99.6	3.6e-152
AZH55309.1|2819848_2820664_-	primosomal protein	NA	Q286X4	Escherichia_phage	95.6	1.7e-117
AZH55310.1|2820679_2820880_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	6.0e-32
AZH55311.1|2821030_2821261_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
AZH55312.1|2821415_2822000_+	XRE family transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
AZH55313.1|2822308_2822608_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	93.9	4.6e-44
AZH55314.1|2822604_2823426_+	exodeoxyribonuclease VIII	NA	G9L6A3	Escherichia_phage	98.9	6.1e-163
AZH55315.1|2823422_2824304_+	recombinase RecT	NA	G9L6A2	Escherichia_phage	99.0	6.8e-160
AZH55316.1|2824353_2824602_+	transcriptional regulator	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
AZH57540.1|2824759_2825011_+	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	97.6	2.6e-40
AZH55317.1|2825650_2826310_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	79.5	5.7e-103
AZH55318.1|2826312_2827569_-|integrase	integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.0	6.3e-236
AZH55319.1|2827761_2829339_-	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
2827760:2827776	attR	AATCATTCCCACTCAAT	NA	NA	NA	NA
AZH55320.1|2829407_2830874_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
>prophage 12
CP023844	Escherichia coli strain 4/1-1 chromosome, complete genome	5144480	3056268	3063408	5144480		Escherichia_phage(83.33%)	6	NA	NA
AZH55526.1|3056268_3058830_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
AZH55527.1|3058935_3059592_+	serine/threonine protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
AZH55528.1|3059642_3060410_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
AZH55529.1|3060605_3061514_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
AZH55530.1|3061510_3062773_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
AZH55531.1|3062769_3063408_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 13
CP023844	Escherichia coli strain 4/1-1 chromosome, complete genome	5144480	4875527	4935661	5144480	transposase,holin,protease,tRNA	Enterobacteria_phage(17.65%)	59	NA	NA
AZH57171.1|4875527_4876880_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
AZH57172.1|4877062_4877449_+	soluble cytochrome b562	NA	NA	NA	NA	NA
AZH57173.1|4877493_4877958_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
AZH57174.1|4878116_4880255_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
AZH57175.1|4880648_4882304_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
AZH57176.1|4882353_4883775_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
AZH57177.1|4883893_4884841_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
AZH57178.1|4885219_4887916_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
AZH57179.1|4888121_4888508_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
AZH57180.1|4888580_4889042_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AZH57181.1|4889054_4889990_-	aspartate carbamoyltransferase catalytic subunit	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
AZH57182.1|4889993_4890128_-	pyrBI operon leader peptide	NA	NA	NA	NA	NA
AZH57183.1|4890257_4890440_+	hypothetical protein	NA	NA	NA	NA	NA
AZH57184.1|4890408_4890804_-	RidA family protein	NA	NA	NA	NA	NA
AZH57185.1|4890934_4891648_-	oxidoreductase	NA	NA	NA	NA	NA
AZH57186.1|4891718_4892312_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZH57187.1|4892456_4892909_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
AZH57188.1|4893031_4894303_+	hypothetical protein	NA	NA	NA	NA	NA
AZH57189.1|4894289_4894628_+	hypothetical protein	NA	NA	NA	NA	NA
AZH57190.1|4894684_4895689_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AZH57191.1|4895850_4896267_+	regulator of ribonuclease activity B	NA	NA	NA	NA	NA
AZH57192.1|4896312_4896816_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZH57193.1|4897008_4898205_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
AZH57194.1|4898258_4901114_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
AZH57195.1|4901113_4901557_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AZH57196.1|4901912_4903424_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
AZH57197.1|4903690_4904791_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AZH57198.1|4904790_4905873_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AZH57199.1|4906033_4907536_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	4.6e-84
AZH57200.1|4907665_4908685_-	aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.9e-44
AZH57201.1|4909151_4909742_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	43.9	3.7e-29
AZH57202.1|4909764_4909995_-	hypothetical protein	NA	NA	NA	NA	NA
AZH57203.1|4910010_4910205_+	hypothetical protein	NA	NA	NA	NA	NA
AZH57615.1|4911579_4911825_+	hypothetical protein	NA	NA	NA	NA	NA
AZH57204.1|4911978_4912743_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AZH57205.1|4912982_4913882_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
AZH57206.1|4913898_4915416_+	altronate dehydratase	NA	NA	NA	NA	NA
AZH57207.1|4915493_4916507_+	4-hydroxythreonine-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AZH57208.1|4916767_4918012_+	MFS transporter	NA	NA	NA	NA	NA
AZH57209.1|4919703_4919940_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	66.7	9.0e-19
AZH57210.1|4920035_4920224_-	hypothetical protein	NA	NA	NA	NA	NA
AZH57211.1|4920277_4920703_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AZH57212.1|4920699_4921050_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AZH57213.1|4921080_4922694_+|transposase	IS66 family transposase ISEc23	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
AZH57214.1|4922964_4923978_-	DUF4432 domain-containing protein	NA	NA	NA	NA	NA
AZH57215.1|4923989_4925306_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
AZH57216.1|4925689_4926837_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
AZH57217.1|4927812_4928595_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AZH57218.1|4928596_4928695_-	acetolactate synthase	NA	NA	NA	NA	NA
AZH57616.1|4928822_4929023_-	hypothetical protein	NA	NA	NA	NA	NA
AZH57219.1|4929210_4929408_+	hypothetical protein	NA	NA	NA	NA	NA
AZH57220.1|4929421_4929625_+	hypothetical protein	NA	NA	NA	NA	NA
AZH57221.1|4929799_4929928_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AZH57222.1|4929946_4930051_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AZH57223.1|4930108_4930765_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZH57224.1|4931012_4932290_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AZH57225.1|4932249_4932408_-|holin	choline transporter	holin	NA	NA	NA	NA
AZH57226.1|4932352_4934356_-|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	4.4e-21
AZH57227.1|4934504_4935661_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
>prophage 14
CP023844	Escherichia coli strain 4/1-1 chromosome, complete genome	5144480	5067506	5108968	5144480	integrase,lysis,tail,portal	Enterobacteria_phage(48.94%)	49	5060114:5060129	5085313:5085328
5060114:5060129	attL	CAGCAGAACGCTGGCG	NA	NA	NA	NA
AZH57358.1|5067506_5068730_+|integrase	integrase	integrase	A0A291AWU1	Escherichia_phage	99.0	9.5e-237
AZH57622.1|5068914_5070156_+	hypothetical protein	NA	NA	NA	NA	NA
AZH57359.1|5070441_5070636_-	DNA-binding protein	NA	A5LH59	Enterobacteria_phage	95.3	2.2e-31
AZH57360.1|5070632_5070980_-	DNA-binding protein	NA	U5P0J0	Shigella_phage	72.2	1.2e-24
AZH57361.1|5070976_5071855_-	hypothetical protein	NA	A0A2R2Z314	Escherichia_phage	93.1	8.2e-166
AZH57362.1|5071845_5072382_-	hypothetical protein	NA	S5MW55	Escherichia_phage	97.8	7.7e-98
AZH57363.1|5072509_5073334_-	DUF2303 domain-containing protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
AZH57364.1|5073399_5073762_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AZH57365.1|5074150_5074429_-	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	97.4	3.0e-13
AZH57366.1|5074484_5075177_-	XRE family transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	2.9e-121
AZH57623.1|5075150_5075294_+	amino acid permease	NA	NA	NA	NA	NA
AZH57367.1|5075274_5075535_+	XRE family transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
AZH57368.1|5075527_5076079_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	99.5	1.7e-100
AZH57369.1|5076075_5077227_+	peptidase	NA	A0A0P0ZE80	Stx2-converting_phage	99.0	2.8e-214
AZH57370.1|5077223_5077448_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	1.3e-38
AZH57371.1|5077444_5078263_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	89.5	2.7e-126
AZH57372.1|5078259_5078754_+	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	95.1	2.6e-84
AZH57373.1|5078753_5079407_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	4.7e-126
AZH57374.1|5079403_5079730_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
AZH57375.1|5079726_5080116_+	hypothetical protein	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
AZH57376.1|5080135_5080945_+	DNA-binding protein	NA	Q8SBE6	Shigella_phage	98.9	2.8e-152
AZH57377.1|5080952_5081942_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	3.3e-195
AZH57378.1|5081955_5082708_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	98.8	2.0e-136
AZH57379.1|5082961_5083165_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
AZH57380.1|5083315_5084368_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
AZH57381.1|5084435_5084651_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AZH57382.1|5084650_5085148_+	lysozyme	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
AZH57383.1|5085144_5085612_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
5085313:5085328	attR	CGCCAGCGTTCTGCTG	NA	NA	NA	NA
AZH57384.1|5085599_5085752_+	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	100.0	1.2e-21
AZH57385.1|5086427_5086919_+	DUF1441 domain-containing protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
AZH57386.1|5086918_5089021_+	DNA packaging protein	NA	A0A291AWY5	Escherichia_phage	97.3	0.0e+00
AZH57387.1|5089017_5089230_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AZH57388.1|5089229_5090738_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	100.0	3.1e-290
AZH57389.1|5090682_5092710_+	peptidase S14	NA	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
AZH57390.1|5092751_5093120_+	DUF2190 domain-containing protein	NA	A0A291AWX2	Escherichia_phage	100.0	9.7e-52
AZH57391.1|5093112_5093388_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
AZH57392.1|5093399_5093978_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
AZH57625.1|5093974_5094376_+|tail	phage tail protein	tail	A5LH34	Enterobacteria_phage	97.7	6.0e-71
AZH57393.1|5094386_5095130_+|tail	phage tail protein	tail	K7PGT7	Enterobacteria_phage	98.0	5.6e-131
AZH57624.1|5095190_5095577_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	99.2	2.8e-65
AZH57394.1|5095585_5095915_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
AZH57395.1|5095886_5098961_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	93.9	0.0e+00
AZH57396.1|5098957_5099287_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	96.3	3.8e-55
AZH57397.1|5099286_5099985_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	95.7	4.9e-129
AZH57398.1|5099989_5100733_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
AZH57399.1|5100630_5101272_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	3.8e-96
AZH57400.1|5101749_5105163_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.6	0.0e+00
AZH57401.1|5105232_5105832_+	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	96.0	3.1e-108
AZH57402.1|5105896_5108968_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	81.4	1.6e-67
>prophage 1
CP023845	Escherichia coli strain 4/1-1 plasmid p4_1_1.1, complete sequence	181324	10978	54008	181324	integrase,protease,transposase	Escherichia_phage(37.5%)	49	23444:23458	57085:57099
AZH57637.1|10978_12001_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZH57638.1|12187_12439_-	hypothetical protein	NA	NA	NA	NA	NA
AZH57639.1|12405_12663_+	replication protein RepA	NA	NA	NA	NA	NA
AZH57797.1|12698_12815_-	replication protein RepA	NA	NA	NA	NA	NA
AZH57796.1|12898_12973_+	positive regulator of RepFIC repA1 expression	NA	NA	NA	NA	NA
AZH57640.1|12965_13823_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AZH57641.1|14185_14572_+	hypothetical protein	NA	NA	NA	NA	NA
AZH57642.1|14761_15415_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AZH57643.1|15634_16099_+	mRNA interferase PemK	NA	NA	NA	NA	NA
AZH57644.1|16235_19133_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AZH57645.1|19227_19833_+	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
AZH57798.1|20609_21002_+	cysteine hydrolase	NA	NA	NA	NA	NA
AZH57646.1|21139_22024_+	EamA family transporter	NA	NA	NA	NA	NA
AZH57647.1|22055_23255_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AZH57648.1|23333_24011_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
23444:23458	attL	CAAACTGGCGGAACG	NA	NA	NA	NA
AZH57799.1|24042_24285_-	relaxase	NA	NA	NA	NA	NA
AZH57649.1|25906_26611_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZH57800.1|26754_27309_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AZH57801.1|27439_28270_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
AZH57650.1|28901_29606_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZH57651.1|31927_32260_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AZH57652.1|32306_33182_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
AZH57653.1|33437_34700_-|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AZH57654.1|35263_35821_+	recombinase	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
AZH57655.1|36003_36864_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AZH57656.1|36979_37522_+	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
AZH57657.1|37539_37902_+	transcriptional regulator	NA	NA	NA	NA	NA
AZH57658.1|37898_38135_+	mercury resistance protein	NA	NA	NA	NA	NA
AZH57659.1|38131_38839_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AZH57660.1|38877_40182_+|integrase	integrase	integrase	NA	NA	NA	NA
AZH57661.1|40228_40933_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
AZH57662.1|41122_41938_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
AZH57663.1|42088_42793_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
AZH57664.1|42914_43820_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AZH57665.1|43816_45055_+	MFS transporter	NA	NA	NA	NA	NA
AZH57666.1|45054_45639_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZH57667.1|45584_45941_+	hypothetical protein	NA	NA	NA	NA	NA
AZH57802.1|46131_46896_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AZH57668.1|46924_47107_+	resolvase	NA	NA	NA	NA	NA
AZH57669.1|47122_47428_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AZH57670.1|47438_48644_-	chromate transporter	NA	NA	NA	NA	NA
AZH57671.1|48799_49003_-	hypothetical protein	NA	NA	NA	NA	NA
AZH57672.1|49021_49201_+	hypothetical protein	NA	NA	NA	NA	NA
AZH57673.1|49130_49970_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AZH57674.1|49963_50311_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AZH57675.1|50474_51266_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AZH57676.1|51673_52171_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
AZH57677.1|52315_53257_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	43.6	1.5e-64
AZH57678.1|53303_54008_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
57085:57099	attR	CGTTCCGCCAGTTTG	NA	NA	NA	NA
>prophage 2
CP023845	Escherichia coli strain 4/1-1 plasmid p4_1_1.1, complete sequence	181324	91988	101254	181324	transposase	Escherichia_phage(62.5%)	9	NA	NA
AZH57710.1|91988_93005_+|transposase	IS5/IS1182 family transposase	transposase	Q38213	Escherichia_phage	99.4	4.9e-186
AZH57711.1|93232_93550_+	type I deoxyribonuclease HsdR	NA	NA	NA	NA	NA
AZH57712.1|93836_94196_-	pdcB	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
AZH57713.1|94223_94403_-	PdcA protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
AZH57714.1|94407_94788_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
AZH57715.1|94787_95009_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
AZH57807.1|95191_96748_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.5	7.1e-104
AZH57716.1|96744_98016_+	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	27.6	6.9e-12
AZH57717.1|98137_101254_+	DEAD/DEAH box helicase	NA	A0A220A398	Liberibacter_phage	24.0	3.7e-27
