The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024684	Bacillus wiedmannii bv. thuringiensis strain FCC41 chromosome, complete genome	5513449	469644	509010	5513449	capsid,head,integrase,portal,tail,terminase	Bacillus_phage(70.0%)	50	469637:469653	509070:509086
469637:469653	attL	CAATTTTTTTATGATTT	NA	NA	NA	NA
AZJ18663.1|469644_470769_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	85.3	4.9e-187
AZJ18664.1|472229_472877_-	class D sortase	NA	NA	NA	NA	NA
AZJ18665.1|472936_473491_-	cell wall anchor protein	NA	NA	NA	NA	NA
AZJ18666.1|473965_474310_-	XRE family transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	63.1	1.9e-33
AZJ18667.1|474811_475975_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ18668.1|478033_478384_-	transcriptional regulator	NA	A0A142LP08	Marinitoga_camini_virus	42.7	3.8e-05
AZJ18669.1|478651_478855_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZJ18670.1|478936_479731_+	DNA-binding protein	NA	R4IFK0	Staphylococcus_phage	55.1	1.2e-75
AZJ18671.1|479797_480148_+	DNA-binding protein	NA	A0A1B0T6C2	Bacillus_phage	91.4	6.2e-56
AZJ23562.1|480147_480312_+	hypothetical protein	NA	A0A0U3B230	Bacillus_phage	75.9	1.3e-16
AZJ18672.1|480518_481268_+	replication protein	NA	A0A1B0T6C0	Bacillus_phage	77.5	8.5e-71
AZJ18673.1|481206_482082_+	hypothetical protein	NA	Q2I8C8	Bacillus_phage	46.2	5.3e-64
AZJ18674.1|482098_482401_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ18675.1|482403_482607_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ18676.1|482603_482828_-	hypothetical protein	NA	Q9T1I9	Lactobacillus_phage	62.9	3.0e-16
AZJ18677.1|482908_483103_+	hypothetical protein	NA	A0A0U3K3J8	Bacillus_phage	78.1	1.4e-20
AZJ18678.1|483127_483301_+	DUF3954 domain-containing protein	NA	A0A1B1P7U5	Bacillus_phage	93.0	6.8e-24
AZJ18679.1|483315_483570_+	hypothetical protein	NA	A0A1B0T6B9	Bacillus_phage	84.5	6.7e-36
AZJ18680.1|483932_484154_+	glyoxalase	NA	A0A1B0T6B5	Bacillus_phage	95.2	7.1e-26
AZJ18681.1|484195_484603_+	hypothetical protein	NA	A0A0S2MVF6	Bacillus_phage	98.5	7.6e-74
AZJ18682.1|484822_485257_+	hypothetical protein	NA	A0A0K2CNV8	Brevibacillus_phage	60.3	5.4e-17
AZJ18683.1|485485_485797_+	hypothetical protein	NA	D2XR52	Bacillus_phage	71.8	9.1e-35
AZJ23563.1|486948_487071_+	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
AZJ18684.1|487186_487357_+	hypothetical protein	NA	A0A1B0T6D0	Bacillus_phage	76.8	9.4e-10
AZJ18685.1|487384_487867_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	83.8	6.5e-72
AZJ18686.1|487866_488409_+|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	92.2	7.8e-90
AZJ18687.1|488623_488869_+	hypothetical protein	NA	H0USV5	Bacillus_phage	95.9	2.3e-33
AZJ18688.1|489277_489565_+	hypothetical protein	NA	H0USV6	Bacillus_phage	93.7	1.5e-44
AZJ18689.1|489599_489827_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ18690.1|489872_490187_+	hypothetical protein	NA	A0A0A7AQ61	Bacillus_phage	48.9	1.5e-13
AZJ18691.1|490187_490403_+	hypothetical protein	NA	A0A1B1P862	Bacillus_phage	72.9	2.3e-21
AZJ18692.1|490535_490793_+	hydrolase	NA	NA	NA	NA	NA
AZJ18693.1|490782_491034_+	hypothetical protein	NA	A0A1B1P743	Bacillus_phage	48.3	4.8e-10
AZJ23564.1|491253_491592_+	hypothetical protein	NA	Q2I8B8	Bacillus_phage	63.6	7.9e-16
AZJ18694.1|491596_491827_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ18695.1|491819_492155_+	alpha/beta hydrolase	NA	D2XR61	Bacillus_phage	92.8	4.2e-54
AZJ18696.1|492278_492590_+|terminase	terminase	terminase	D2XR14	Bacillus_phage	86.3	9.4e-40
AZJ18697.1|492586_494254_+|terminase	terminase	terminase	D2XR15	Bacillus_phage	88.8	8.9e-294
AZJ18698.1|494262_495426_+|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	81.8	4.1e-181
AZJ18699.1|495409_496198_+	peptidase	NA	R9TLM7	Paenibacillus_phage	52.8	6.7e-58
AZJ18700.1|496201_497353_+|capsid	phage major capsid protein	capsid	A0A2H4JHU0	uncultured_Caudovirales_phage	95.3	2.8e-206
AZJ18701.1|497358_497652_+	hypothetical protein	NA	D2XR19	Bacillus_phage	90.7	5.9e-44
AZJ18702.1|497653_498007_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JGG7	uncultured_Caudovirales_phage	96.6	5.1e-58
AZJ18703.1|498033_498408_+	hypothetical protein	NA	Q0H235	Geobacillus_phage	55.6	3.4e-36
AZJ18704.1|498404_498734_+	hypothetical protein	NA	D2XR22	Bacillus_phage	89.9	1.1e-49
AZJ18705.1|498734_499331_+|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	98.5	4.8e-109
AZJ18706.1|499335_499698_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	84.2	1.2e-51
AZJ18707.1|499928_503549_+	DUF2207 domain-containing protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	86.4	1.6e-186
AZJ18708.1|503590_505075_+|tail	phage tail protein	tail	A0A1B1P7W7	Bacillus_phage	79.1	3.0e-237
AZJ18709.1|505071_509010_+	peptidase S74	NA	A0A288WFP5	Bacillus_phage	74.3	0.0e+00
509070:509086	attR	CAATTTTTTTATGATTT	NA	NA	NA	NA
>prophage 2
CP024684	Bacillus wiedmannii bv. thuringiensis strain FCC41 chromosome, complete genome	5513449	1390659	1461673	5513449	transposase,capsid,head,holin,integrase,portal,tail,protease,terminase	Bacillus_phage(56.86%)	90	1391406:1391422	1467765:1467781
AZJ19564.1|1390659_1391631_+	hydroxyacid dehydrogenase	NA	A0A1M7XU89	Cedratvirus	28.4	2.1e-29
1391406:1391422	attL	AACGAATGAAATTGAAG	NA	NA	NA	NA
AZJ19565.1|1391660_1392362_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AZJ19566.1|1392544_1394431_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	34.5	9.6e-87
AZJ19567.1|1394626_1395736_-|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	76.2	1.6e-142
AZJ19568.1|1396175_1396520_-	XRE family transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	43.8	3.5e-19
AZJ19569.1|1397013_1398237_+	hypothetical protein	NA	D2XQ10	Bacillus_virus	44.4	1.0e-81
AZJ19570.1|1398473_1398689_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ19571.1|1398724_1399075_-	transcriptional regulator	NA	A0A0U3SD25	Bacillus_phage	47.8	2.2e-21
AZJ19572.1|1399205_1399427_+	transcriptional regulator	NA	Q0H243	Geobacillus_phage	43.1	1.1e-05
AZJ19573.1|1399466_1400264_+	DNA-binding protein	NA	A0A1Q1PVZ8	Staphylococcus_phage	51.0	8.2e-72
AZJ19574.1|1400317_1400584_+	DNA-binding protein	NA	A0A0U3ULL9	Bacillus_phage	90.6	1.8e-36
AZJ19575.1|1400583_1400748_+	hypothetical protein	NA	A0A1B1P8G4	Bacillus_phage	91.5	4.1e-18
AZJ19576.1|1400777_1400954_+	hypothetical protein	NA	A0A1B1P7U0	Bacillus_phage	91.4	5.3e-24
AZJ19577.1|1400959_1401784_+	replication protein	NA	V5UQV4	Oenococcus_phage	41.0	1.8e-42
AZJ19578.1|1401722_1402598_+	hypothetical protein	NA	Q2I8C8	Bacillus_phage	45.8	7.7e-63
AZJ19579.1|1402614_1402917_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ19580.1|1402919_1403123_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ19581.1|1403119_1403344_-	hypothetical protein	NA	Q9T1I9	Lactobacillus_phage	62.9	3.0e-16
AZJ19582.1|1403424_1403619_+	hypothetical protein	NA	A0A0U3K3J8	Bacillus_phage	78.1	1.4e-20
AZJ19583.1|1403643_1403817_+	DUF3954 domain-containing protein	NA	A0A1B1P7U5	Bacillus_phage	93.0	6.8e-24
AZJ19584.1|1403831_1404086_+	hypothetical protein	NA	A0A1B0T6B9	Bacillus_phage	84.5	6.7e-36
AZJ19585.1|1404094_1404559_+	nucleoside permease	NA	A0A2H4J8I5	uncultured_Caudovirales_phage	36.1	3.4e-17
AZJ19586.1|1404576_1404798_+	glyoxalase	NA	A0A1B0T6B5	Bacillus_phage	95.2	7.1e-26
AZJ19587.1|1404839_1405247_+	hypothetical protein	NA	A0A0S2MVF6	Bacillus_phage	98.5	7.6e-74
AZJ19588.1|1405466_1405841_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ19589.1|1406035_1406347_+	hypothetical protein	NA	D2XR52	Bacillus_phage	71.8	9.1e-35
AZJ19590.1|1406837_1407032_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ19591.1|1407747_1408029_+	hypothetical protein	NA	A0A0S2GLD3	Bacillus_phage	88.2	2.5e-39
AZJ19592.1|1408369_1408855_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	98.8	3.3e-84
AZJ19593.1|1408851_1409394_+|integrase	site-specific integrase	integrase	H0USV4	Bacillus_phage	98.3	2.3e-94
AZJ19594.1|1409610_1409835_+	hypothetical protein	NA	H0USV5	Bacillus_phage	93.2	2.6e-31
AZJ19595.1|1410260_1410548_+	hypothetical protein	NA	H0USV6	Bacillus_phage	95.8	1.4e-45
AZJ19596.1|1410583_1410811_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ23587.1|1410964_1411252_+	hypothetical protein	NA	A0A0S2MVC8	Bacillus_phage	49.4	2.2e-11
AZJ23588.1|1411617_1411890_+	hypothetical protein	NA	Q2I8B8	Bacillus_phage	75.6	4.7e-11
AZJ19597.1|1411894_1412122_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ19598.1|1412124_1412460_+	alpha/beta hydrolase	NA	D2XR61	Bacillus_phage	89.2	1.4e-52
AZJ19599.1|1412453_1412951_+	endonuclease	NA	A0A2H4J2Q3	uncultured_Caudovirales_phage	45.2	1.2e-31
AZJ19600.1|1413057_1413369_+|terminase	terminase	terminase	D2XR14	Bacillus_phage	86.3	9.4e-40
AZJ19601.1|1413365_1415033_+|terminase	terminase	terminase	D2XR15	Bacillus_phage	90.6	1.3e-300
AZJ19602.1|1415041_1416205_+|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	81.2	7.1e-181
AZJ19603.1|1416188_1416971_+	peptidase	NA	R9TLM7	Paenibacillus_phage	52.0	3.1e-55
AZJ19604.1|1416974_1418123_+|capsid	phage major capsid protein	capsid	A0A2H4JHU0	uncultured_Caudovirales_phage	94.3	5.0e-203
AZJ19605.1|1418135_1418429_+	hypothetical protein	NA	D2XR19	Bacillus_phage	89.7	3.8e-43
AZJ19606.1|1418430_1418781_+|head,tail	head-tail adaptor protein	head,tail	D2XR20	Bacillus_phage	87.9	1.1e-52
AZJ19607.1|1418807_1419182_+	hypothetical protein	NA	Q0H235	Geobacillus_phage	56.5	5.8e-36
AZJ19608.1|1419178_1419508_+	hypothetical protein	NA	A0A2H4JAG4	uncultured_Caudovirales_phage	94.5	2.4e-54
AZJ19609.1|1419508_1420081_+|tail	phage tail protein	tail	A0A0U4JWV5	Exiguobacterium_phage	58.4	1.1e-54
AZJ19610.1|1420085_1420448_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	55.0	4.2e-31
AZJ19611.1|1420558_1420672_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ19612.1|1420689_1424646_+	tape measure protein	NA	D2XR25	Bacillus_phage	71.5	6.8e-151
AZJ19613.1|1424642_1425452_+|tail	phage tail family protein	tail	A0A290FZP5	Caldibacillus_phage	44.5	2.8e-59
AZJ19614.1|1425465_1427250_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ19615.1|1427267_1427465_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ19616.1|1427822_1429796_+	hypothetical protein	NA	A0A2H4JG80	uncultured_Caudovirales_phage	60.6	1.7e-166
AZJ19617.1|1429832_1430300_+	hypothetical protein	NA	A0A2H4J980	uncultured_Caudovirales_phage	82.8	4.7e-51
AZJ19618.1|1430501_1431647_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	29.2	1.5e-42
AZJ23589.1|1431918_1432887_+|integrase	integrase	integrase	A0A0S2GLC8	Bacillus_phage	94.7	1.8e-174
AZJ19619.1|1432902_1433328_+|holin	holin	holin	A0A1B1P787	Bacillus_phage	100.0	3.3e-72
AZJ19620.1|1433327_1434029_+	N-acetylmuramoyl-L-alanine amidase	NA	Q2I8E6	Bacillus_phage	98.7	1.9e-133
AZJ19621.1|1434350_1434617_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ19622.1|1434632_1434824_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ19623.1|1435313_1435763_+	DUF3888 domain-containing protein	NA	NA	NA	NA	NA
AZJ19624.1|1436214_1437531_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
AZJ19625.1|1437828_1437972_+	DUF2292 domain-containing protein	NA	NA	NA	NA	NA
AZJ19626.1|1438058_1438763_+	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
AZJ19627.1|1438801_1439938_+	sulfate adenylyltransferase	NA	A0A2K9L0F0	Tupanvirus	29.7	4.6e-44
AZJ19628.1|1439950_1440544_+	adenylyl-sulfate kinase	NA	NA	NA	NA	NA
AZJ19629.1|1440555_1442178_+	ferredoxin--nitrite reductase	NA	NA	NA	NA	NA
AZJ19630.1|1442188_1442389_+	DUF3906 domain-containing protein	NA	NA	NA	NA	NA
AZJ19631.1|1442474_1443251_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
AZJ19632.1|1443252_1444008_+	sirohydrochlorin chelatase	NA	NA	NA	NA	NA
AZJ19633.1|1443982_1444600_+	precorrin-2 dehydrogenase	NA	NA	NA	NA	NA
AZJ19634.1|1445017_1446376_+	sodium-dependent transporter	NA	NA	NA	NA	NA
AZJ19635.1|1446670_1447942_-	peptidase M24	NA	A0A2D0ZM66	Rhodococcus_phage	37.2	2.0e-11
AZJ19636.1|1448435_1449710_+	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
AZJ19637.1|1449776_1450295_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ19638.1|1450615_1451932_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AZJ19639.1|1452161_1452518_+	flagellar basal body rod protein	NA	NA	NA	NA	NA
AZJ19640.1|1452574_1453237_+	phage shock protein A	NA	NA	NA	NA	NA
AZJ19641.1|1453343_1454084_+	transporter	NA	NA	NA	NA	NA
AZJ19642.1|1454083_1455139_+	sensor histidine kinase	NA	NA	NA	NA	NA
AZJ19643.1|1455135_1455768_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AZJ19644.1|1455833_1456163_+	DUF3992 domain-containing protein	NA	NA	NA	NA	NA
AZJ19645.1|1456186_1457542_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
AZJ19646.1|1458128_1458338_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ19647.1|1458377_1459154_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZJ19648.1|1459262_1460114_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ19649.1|1460221_1460419_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ19650.1|1460575_1461673_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
1467765:1467781	attR	AACGAATGAAATTGAAG	NA	NA	NA	NA
>prophage 3
CP024684	Bacillus wiedmannii bv. thuringiensis strain FCC41 chromosome, complete genome	5513449	1996801	2006122	5513449		Bacillus_phage(71.43%)	9	NA	NA
AZJ20134.1|1996801_1998082_+	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	31.5	3.4e-11
AZJ20135.1|1998180_1998945_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZJ20136.1|1999185_2000946_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	95.7	2.6e-267
AZJ20137.1|2001007_2001712_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	92.7	1.0e-121
AZJ20138.1|2001708_2002782_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	94.1	2.1e-179
AZJ20139.1|2002805_2003399_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ20140.1|2003580_2004309_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	6.0e-61
AZJ20141.1|2004446_2005118_+	methyltransferase	NA	W8CYT3	Bacillus_phage	93.4	2.5e-66
AZJ20142.1|2005249_2006122_+	aminoglycoside adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	44.4	1.6e-65
>prophage 4
CP024684	Bacillus wiedmannii bv. thuringiensis strain FCC41 chromosome, complete genome	5513449	2602419	2668499	5513449	coat,head,holin,portal,tail,bacteriocin,tRNA,terminase	Bacillus_phage(75.0%)	72	NA	NA
AZJ20671.1|2602419_2603976_+|tRNA	lysine--tRNA ligase	tRNA	NA	NA	NA	NA
AZJ20672.1|2604036_2604465_-	cell wall hydrolase	NA	NA	NA	NA	NA
AZJ20673.1|2604621_2605536_+	acetamidase	NA	NA	NA	NA	NA
AZJ20674.1|2605662_2606370_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AZJ20675.1|2606366_2607350_+	sensor histidine kinase	NA	NA	NA	NA	NA
AZJ20676.1|2607751_2608378_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ23634.1|2608939_2610568_+	ABC transporter ATP-binding protein	NA	A0A1B0RXA0	Streptococcus_phage	30.1	6.4e-55
AZJ20677.1|2610589_2611183_+	N-acetyltransferase	NA	NA	NA	NA	NA
AZJ20678.1|2611551_2612052_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ20679.1|2612361_2613132_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.9	5.6e-33
AZJ20680.1|2613106_2615041_+	ABC transporter permease	NA	NA	NA	NA	NA
AZJ20681.1|2615106_2615781_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ20682.1|2615856_2616198_-	DUF3914 domain-containing protein	NA	NA	NA	NA	NA
AZJ20683.1|2616465_2617707_+	lipase	NA	NA	NA	NA	NA
AZJ20684.1|2617794_2618838_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
AZJ20685.1|2618998_2620447_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
AZJ20686.1|2620451_2621366_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
AZJ20687.1|2621666_2622356_+	thiaminase II	NA	NA	NA	NA	NA
AZJ20688.1|2622634_2622967_+|bacteriocin	heterocycloanthracin/sonorensin family bacteriocin	bacteriocin	NA	NA	NA	NA
AZJ20689.1|2623329_2623815_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
AZJ20690.1|2625683_2625968_-	DUF4183 domain-containing protein	NA	NA	NA	NA	NA
AZJ20691.1|2626756_2627353_+	ABC transporter permease	NA	NA	NA	NA	NA
AZJ20692.1|2628280_2628475_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ20693.1|2629354_2629579_+	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	89.2	8.5e-27
AZJ20694.1|2630161_2630668_+	IDEAL domain-containing protein	NA	G3MAV7	Bacillus_virus	33.9	8.2e-17
AZJ23635.1|2630815_2631130_+	hypothetical protein	NA	A0A0A7AQW3	Bacillus_phage	44.7	2.6e-21
AZJ20695.1|2631689_2632205_+	dUTPase	NA	A0A1L2JY27	Aeribacillus_phage	44.1	3.7e-25
AZJ20696.1|2632201_2632618_+	hypothetical protein	NA	A0A2P1JTY5	Anoxybacillus_phage	51.9	1.8e-30
AZJ20697.1|2632632_2633364_+	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
AZJ23636.1|2633478_2634327_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ20698.1|2634336_2634738_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ20699.1|2634730_2635405_+	RNA polymerase subunit sigma-28	NA	Q2I8C6	Bacillus_phage	45.5	2.9e-46
AZJ20700.1|2636269_2636671_+	hypothetical protein	NA	A0A0S2GLF8	Bacillus_phage	50.4	3.0e-30
AZJ20701.1|2636766_2637135_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ20702.1|2637288_2637831_+	DNA (cytosine-5-)-methyltransferase	NA	A0A0A8WFL3	Clostridium_phage	53.9	3.1e-54
AZJ20703.1|2637730_2638213_+	DNA methyltransferase	NA	A0A218MND0	uncultured_virus	49.1	3.0e-24
AZJ20704.1|2638253_2638487_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ20705.1|2638527_2638896_+	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	36.2	3.0e-13
AZJ20706.1|2639097_2639343_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ20707.1|2639311_2640364_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ20708.1|2640540_2641218_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ20709.1|2641425_2642082_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ20710.1|2642160_2643099_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	83.1	1.0e-113
AZJ20711.1|2643085_2644357_+|terminase	PBSX family phage terminase large subunit	terminase	A0A1L2JY46	Aeribacillus_phage	84.2	6.4e-220
AZJ20712.1|2644369_2645803_+|portal	phage portal protein	portal	A0A0S2MVB2	Bacillus_phage	96.6	6.9e-271
AZJ23637.1|2645876_2646644_+|head	phage head protein	head	A0A0S2MVF0	Bacillus_phage	96.1	1.8e-137
AZJ20713.1|2646719_2647430_+	ribonuclease	NA	A0A0A7AQU8	Bacillus_phage	68.6	5.2e-70
AZJ20714.1|2647538_2648381_+	hypothetical protein	NA	A0A0A7AQF5	Bacillus_phage	93.6	9.1e-146
AZJ20715.1|2648576_2648885_+	hypothetical protein	NA	A0A0A7AQX9	Bacillus_phage	84.3	5.3e-43
AZJ20716.1|2648881_2649226_+|head,tail	head-tail adaptor protein	head,tail	A0A0A7AR32	Bacillus_phage	88.6	1.8e-55
AZJ20717.1|2649200_2649608_+	hypothetical protein	NA	A0A0A7AQU9	Bacillus_phage	94.8	3.4e-66
AZJ20718.1|2649613_2649976_+	hypothetical protein	NA	A0A0S2MV90	Bacillus_phage	90.8	1.2e-57
AZJ20719.1|2649990_2650584_+	hypothetical protein	NA	A0A0S2MV81	Bacillus_phage	97.5	3.4e-107
AZJ20720.1|2650631_2651060_+	hypothetical protein	NA	A0A0S2MV94	Bacillus_phage	95.1	1.3e-68
AZJ23638.1|2651164_2651371_+	hypothetical protein	NA	A0A0A7AQY2	Bacillus_phage	95.6	5.3e-31
AZJ20721.1|2651371_2654311_+|tail	phage tail tape measure protein	tail	A0A0A7AR36	Bacillus_phage	77.2	4.1e-302
AZJ23639.1|2654332_2655814_+|tail	phage tail protein	tail	A0A288WFS2	Bacillus_phage	83.1	3.6e-246
AZJ20722.1|2655810_2658873_+	peptidase S74	NA	A0A288WG04	Bacillus_phage	61.0	0.0e+00
AZJ20723.1|2659137_2660526_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ20724.1|2660612_2661038_+|holin	holin	holin	A0A0S2MVC4	Bacillus_phage	87.0	3.1e-62
AZJ20725.1|2661037_2661838_+	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	70.4	2.5e-108
AZJ20726.1|2661971_2662280_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ20727.1|2662514_2662973_-	1,3-beta-glucan synthase regulator	NA	NA	NA	NA	NA
AZJ20728.1|2662994_2664257_-	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	47.0	5.7e-51
AZJ20729.1|2664507_2664708_+|coat	spore coat protein	coat	NA	NA	NA	NA
AZJ20730.1|2664722_2665175_+|coat	spore coat protein	coat	NA	NA	NA	NA
AZJ20731.1|2665288_2665762_-	restriction endonuclease	NA	NA	NA	NA	NA
AZJ23640.1|2665798_2665996_-	transcriptional regulator	NA	A0A288WG80	Bacillus_phage	50.0	1.6e-08
AZJ20732.1|2666146_2666449_+	hypothetical protein	NA	H0USY0	Bacillus_phage	54.6	1.8e-24
AZJ20733.1|2666445_2666628_+	hypothetical protein	NA	Q2I8E2	Bacillus_phage	80.0	6.3e-20
AZJ20734.1|2666746_2667937_+	cell division protein FtsK	NA	A0A288WFS1	Bacillus_phage	65.4	1.5e-149
AZJ20735.1|2667878_2668499_+	hypothetical protein	NA	Q2LIA9	Bacillus_phage	75.9	6.0e-86
>prophage 5
CP024684	Bacillus wiedmannii bv. thuringiensis strain FCC41 chromosome, complete genome	5513449	2828479	2836580	5513449		Geobacillus_phage(28.57%)	10	NA	NA
AZJ20889.1|2828479_2829847_-	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	38.6	3.3e-20
AZJ20890.1|2830204_2831398_-	glycosyl transferase family 1	NA	B0LUM8	Spodoptera_litura_multicapsid_nucleopolyhedrovirus	26.9	1.4e-11
AZJ23647.1|2831467_2832112_-	cytoplasmic protein	NA	A0A075BUR2	Microcystis_phage	40.7	1.1e-31
AZJ20891.1|2832177_2832696_-	topology modulation protein	NA	A0A097BYE2	Leuconostoc_phage	47.2	8.0e-44
AZJ20892.1|2832717_2833104_-	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
AZJ20893.1|2833169_2833877_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	27.5	9.4e-19
AZJ20894.1|2833898_2834252_-	cytoplasmic protein	NA	NA	NA	NA	NA
AZJ20895.1|2834267_2834672_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZJ20896.1|2834979_2836365_+	S-layer protein	NA	Q0H255	Geobacillus_phage	59.5	3.0e-77
AZJ20897.1|2836367_2836580_+	DUF3006 domain-containing protein	NA	Q0H256	Geobacillus_phage	51.5	1.9e-12
>prophage 6
CP024684	Bacillus wiedmannii bv. thuringiensis strain FCC41 chromosome, complete genome	5513449	3508460	3522584	5513449	bacteriocin	Bacillus_phage(81.82%)	13	NA	NA
AZJ21523.1|3508460_3509939_+	Lsa family ABC-F type ribosomal protection protein	NA	Q6DMX7	Streptococcus_phage	25.5	2.0e-31
AZJ21524.1|3510081_3510687_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZJ21525.1|3512052_3512883_+	cytosolic protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	71.7	2.4e-106
AZJ21526.1|3512889_3513510_-	hypothetical protein	NA	H0USY2	Bacillus_phage	84.5	1.6e-99
AZJ21527.1|3513451_3514633_-	cell division protein FtsK	NA	H0USY1	Bacillus_phage	80.9	1.3e-185
AZJ21528.1|3514748_3514931_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	85.0	2.2e-20
AZJ21529.1|3514927_3515233_-	hypothetical protein	NA	A0A288WG38	Bacillus_phage	49.5	2.3e-22
AZJ21530.1|3515418_3515640_+	XRE family transcriptional regulator	NA	A0A0S2SXU5	Bacillus_phage	49.2	2.1e-09
AZJ21531.1|3515636_3516230_-	restriction endonuclease	NA	NA	NA	NA	NA
AZJ21532.1|3516992_3517697_-	N-acetylmuramoyl-L-alanine amidase	NA	W8CZ46	Bacillus_phage	85.7	1.5e-114
AZJ21533.1|3517696_3517927_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	87.8	1.6e-28
AZJ21534.1|3517995_3518220_-	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	75.0	3.5e-20
AZJ21535.1|3518318_3522584_-	4'-phosphopantetheinyl transferase	NA	A0A0A0RPU4	Bacillus_phage	37.7	7.1e-138
>prophage 7
CP024684	Bacillus wiedmannii bv. thuringiensis strain FCC41 chromosome, complete genome	5513449	3532013	3551749	5513449	integrase,terminase	Bacillus_phage(82.35%)	21	3549477:3549491	3554256:3554270
AZJ23681.1|3532013_3533429_-|terminase	terminase	terminase	U5PVG8	Bacillus_phage	70.0	1.3e-192
AZJ21546.1|3533472_3533979_-	hypothetical protein	NA	A0A090DCM3	Clostridium_phage	51.6	2.2e-38
AZJ21547.1|3534035_3534608_-	resolvase	NA	I1ZBD6	Salisaeta_icosahedral_phage	40.8	4.4e-27
AZJ21548.1|3534775_3534928_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ21549.1|3535281_3535677_-	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	66.4	5.7e-42
AZJ21550.1|3536227_3538093_-	DNA primase	NA	A0A1B1P7L5	Bacillus_phage	92.9	0.0e+00
AZJ21551.1|3538900_3540583_-	hypothetical protein	NA	A0A1B1P7M5	Bacillus_phage	88.5	2.8e-303
AZJ21552.1|3540668_3541160_-	DUF669 domain-containing protein	NA	A0A1B1P7N3	Bacillus_phage	95.1	3.3e-87
AZJ21553.1|3541159_3541477_-	organic solvent tolerance protein OstA	NA	A0A1B1P7N6	Bacillus_phage	74.3	7.3e-32
AZJ21554.1|3541500_3543312_-	NTP-binding protein	NA	A0A1B1P7N0	Bacillus_phage	86.7	1.8e-255
AZJ21555.1|3543311_3543590_-	nuclease	NA	A0A1B1P7M6	Bacillus_phage	88.0	4.3e-44
AZJ21556.1|3543590_3543908_-	hypothetical protein	NA	A0A1B1P7L0	Bacillus_phage	43.3	2.9e-12
AZJ21557.1|3543897_3544095_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ21558.1|3544087_3545320_-	helicase SNF2	NA	A0A1B1P7L4	Bacillus_phage	86.9	2.8e-212
AZJ21559.1|3545367_3546009_-	sigma-70 family RNA polymerase sigma factor	NA	H0USU1	Bacillus_phage	50.2	7.6e-52
AZJ21560.1|3546034_3546223_-	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	75.8	1.2e-18
AZJ21561.1|3546234_3546432_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ21562.1|3546829_3547084_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ21563.1|3547330_3547660_+	transcriptional regulator	NA	H0UST7	Bacillus_phage	94.5	4.8e-50
AZJ23682.1|3548062_3549229_-	hypothetical protein	NA	H0UST6	Bacillus_phage	32.2	6.6e-54
3549477:3549491	attL	AAATAATTATCTTTT	NA	NA	NA	NA
AZJ21564.1|3550687_3551749_+|integrase	site-specific integrase	integrase	H0UST3	Bacillus_phage	98.9	1.1e-196
AZJ21564.1|3550687_3551749_+|integrase	site-specific integrase	integrase	H0UST3	Bacillus_phage	98.9	1.1e-196
3554256:3554270	attR	AAATAATTATCTTTT	NA	NA	NA	NA
>prophage 8
CP024684	Bacillus wiedmannii bv. thuringiensis strain FCC41 chromosome, complete genome	5513449	3706150	3758507	5513449	capsid,head,holin,portal,tail,protease,terminase	Bacillus_phage(28.12%)	55	NA	NA
AZJ21710.1|3706150_3706516_+|holin	holin	holin	NA	NA	NA	NA
AZJ21711.1|3706512_3707190_+	LrgB family protein	NA	NA	NA	NA	NA
AZJ21712.1|3707202_3707616_-	DNA mismatch repair protein MutT	NA	NA	NA	NA	NA
AZJ21713.1|3707757_3707964_+	DUF3903 domain-containing protein	NA	NA	NA	NA	NA
AZJ21714.1|3708273_3709029_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ21715.1|3709127_3709274_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ23686.1|3709486_3711214_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	55.0	6.2e-40
AZJ21716.1|3711427_3711994_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ21717.1|3712000_3713020_-	NERD domain-containing protein	NA	A0A1L2JY40	Aeribacillus_phage	27.9	1.3e-24
AZJ21718.1|3713229_3714279_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A140HM31	Bacillus_phage	49.6	6.0e-30
AZJ21719.1|3714411_3716175_-	ABC transporter ATP-binding protein	NA	A0A1V0SD74	Indivirus	23.4	9.2e-15
AZJ21720.1|3716174_3717926_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.9	3.3e-49
AZJ21721.1|3718049_3718271_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ21722.1|3718349_3718790_-	sporulation inhibitor of replication protein SirA	NA	NA	NA	NA	NA
AZJ21723.1|3718946_3720947_-	transketolase	NA	NA	NA	NA	NA
AZJ21724.1|3721726_3722530_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
AZJ21725.1|3722529_3723324_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
AZJ21726.1|3723320_3724094_-	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	27.5	1.0e-10
AZJ23687.1|3724178_3725183_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZJ21727.1|3725301_3726885_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
AZJ21728.1|3726924_3727164_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ21729.1|3727209_3727866_-	resolvase	NA	NA	NA	NA	NA
AZJ23688.1|3727995_3728628_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.2	4.9e-19
AZJ21730.1|3728716_3729523_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AZJ21731.1|3729523_3730066_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
AZJ21732.1|3730058_3730388_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AZJ21733.1|3730957_3731158_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ21734.1|3731180_3732266_-	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	43.4	3.5e-57
AZJ21735.1|3732262_3732751_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ21736.1|3732919_3733132_-	DNA-binding protein	NA	A0A1Z1LZP5	Bacillus_phage	68.6	3.1e-18
AZJ21737.1|3733679_3734348_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ21738.1|3734618_3735674_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1C8E990	Bacillus_phage	76.9	4.9e-157
AZJ21739.1|3735670_3735910_-|holin	holin	holin	A0A0A7AR38	Bacillus_phage	83.5	5.7e-29
AZJ21740.1|3735909_3736146_-	hypothetical protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	92.3	1.9e-16
AZJ23689.1|3736184_3738332_-	hypothetical protein	NA	D2XR28	Bacillus_phage	40.1	2.0e-128
AZJ21741.1|3743323_3744796_-|tail	phage tail protein	tail	D2XPZ5	Bacillus_virus	71.3	1.7e-216
AZJ21742.1|3744837_3747270_-	hypothetical protein	NA	D2XR26	Bacillus_phage	66.0	6.1e-09
AZJ21743.1|3747484_3748735_-	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	84.3	6.9e-182
AZJ21744.1|3748747_3748909_-	hypothetical protein	NA	A0A2H4JHE4	uncultured_Caudovirales_phage	92.5	4.5e-22
AZJ21745.1|3748962_3749325_-	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	74.8	9.2e-47
AZJ21746.1|3749329_3749923_-|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	83.0	5.9e-91
AZJ21747.1|3749923_3750253_-	hypothetical protein	NA	A0A2H4JAG4	uncultured_Caudovirales_phage	83.5	3.8e-47
AZJ21748.1|3750249_3750606_-	hypothetical protein	NA	D2XR21	Bacillus_phage	60.3	2.7e-30
AZJ21749.1|3750598_3750898_-|head,tail	phage head-tail adapter protein	head,tail	R9TPZ2	Paenibacillus_phage	39.4	4.4e-10
AZJ21750.1|3750894_3751173_-	DNA-packaging protein	NA	R9TMB7	Paenibacillus_phage	56.2	2.5e-20
AZJ21751.1|3751169_3751460_-	hypothetical protein	NA	A6XMJ7	Bacillus_virus	40.2	7.5e-07
AZJ21752.1|3751496_3752660_-|capsid	phage major capsid protein	capsid	H7BUQ0	unidentified_phage	54.7	1.8e-80
AZJ21753.1|3752673_3753258_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2I7SBY1	Paenibacillus_phage	50.0	3.0e-39
AZJ21754.1|3753223_3754435_-|portal	phage portal protein	portal	J9QE83	Clostridium_phage	59.4	1.0e-137
AZJ21755.1|3754450_3756139_-|terminase	terminase large subunit	terminase	A0A290GJW3	Caldibacillus_phage	70.5	1.8e-238
AZJ21756.1|3756135_3756510_-	hypothetical protein	NA	R9TQ46	Paenibacillus_phage	46.7	2.1e-17
AZJ21757.1|3756676_3756973_-	HNH endonuclease	NA	R9TNN2	Paenibacillus_phage	61.5	1.6e-28
AZJ21758.1|3757307_3757469_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ21759.1|3757739_3758162_+	pilus assembly protein HicB	NA	A0A1L2JY34	Aeribacillus_phage	57.6	1.7e-39
AZJ21760.1|3758228_3758507_-	DNA-binding protein	NA	A0A2H4JBQ8	uncultured_Caudovirales_phage	43.8	1.5e-09
>prophage 9
CP024684	Bacillus wiedmannii bv. thuringiensis strain FCC41 chromosome, complete genome	5513449	3767862	3778999	5513449	integrase	Bacillus_phage(75.0%)	24	3774353:3774367	3790043:3790057
AZJ21770.1|3767862_3768237_-	ArpU family transcriptional regulator	NA	A0A0M4R397	Bacillus_phage	68.5	3.8e-43
AZJ21771.1|3768241_3768529_-	hypothetical protein	NA	A6M999	Geobacillus_virus	71.3	1.9e-34
AZJ21772.1|3768666_3768969_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ21773.1|3769118_3769865_-	thymidylate synthase (FAD)	NA	A0A142F1S2	Bacillus_phage	61.4	5.0e-79
AZJ21774.1|3769903_3770476_-	dUTPase	NA	A0A0A7AQI4	Bacillus_phage	73.8	1.7e-79
AZJ21775.1|3770570_3770693_-	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
AZJ21776.1|3770695_3771325_-	hypothetical protein	NA	A0A0M4RU33	Bacillus_phage	41.4	5.7e-28
AZJ21777.1|3771321_3771492_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ21778.1|3771488_3771677_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ21779.1|3771700_3772531_-	hypothetical protein	NA	U5PWH5	Bacillus_phage	38.7	2.0e-36
AZJ21780.1|3772466_3773225_-	replication protein	NA	A0A1W6JNI1	Staphylococcus_phage	55.3	4.3e-62
AZJ21781.1|3773221_3773494_-	hypothetical protein	NA	A0A0M4S680	Bacillus_phage	80.9	6.5e-37
AZJ21782.1|3773507_3774179_-	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	46.3	4.0e-27
AZJ21783.1|3774175_3774658_-	ATPase	NA	E5DV79	Deep-sea_thermophilic_phage	48.1	4.1e-34
3774353:3774367	attL	TACTGTTATCAACGC	NA	NA	NA	NA
AZJ21784.1|3774672_3774936_-	hypothetical protein	NA	A0A0M5M3T1	Bacillus_phage	61.1	1.3e-10
AZJ21785.1|3774907_3775255_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ21786.1|3775214_3775400_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ21787.1|3775375_3775642_-	group-specific protein	NA	S5MC08	Brevibacillus_phage	57.0	6.6e-26
AZJ21788.1|3775661_3776363_-	Rha family transcriptional regulator	NA	A0A288WFT2	Bacillus_phage	55.5	1.7e-65
AZJ21789.1|3776347_3776605_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZJ21790.1|3776748_3777177_+	immunity repressor protein	NA	Q786F1	Bacillus_phage	60.6	4.2e-38
AZJ21791.1|3777199_3777628_+	hypothetical protein	NA	Q9T201	Bacillus_phage	54.4	3.6e-34
AZJ21792.1|3777644_3777812_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ21793.1|3777853_3778999_+|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	38.5	1.5e-66
3790043:3790057	attR	TACTGTTATCAACGC	NA	NA	NA	NA
>prophage 10
CP024684	Bacillus wiedmannii bv. thuringiensis strain FCC41 chromosome, complete genome	5513449	4570172	4577851	5513449		Staphylococcus_phage(16.67%)	10	NA	NA
AZJ22606.1|4570172_4571096_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.5	2.6e-45
AZJ22607.1|4571220_4572156_-	sensor histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	25.9	3.6e-10
AZJ22608.1|4572157_4572850_-	DNA-binding response regulator	NA	B5LWA6	Feldmannia_species_virus	27.9	2.3e-06
AZJ22609.1|4573019_4573193_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ22610.1|4573193_4573388_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ22611.1|4573427_4574627_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.2	1.8e-70
AZJ22612.1|4574922_4575246_+	heme-degrading monooxygenase IsdG	NA	NA	NA	NA	NA
AZJ22613.1|4575314_4576076_-	SrtB family sortase	NA	NA	NA	NA	NA
AZJ22614.1|4576107_4576878_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.6	5.8e-14
AZJ22615.1|4576867_4577851_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.2	2.7e-16
>prophage 11
CP024684	Bacillus wiedmannii bv. thuringiensis strain FCC41 chromosome, complete genome	5513449	5082629	5158252	5513449	transposase,capsid,holin,head,portal,integrase,tail,protease,bacteriocin,terminase	Bacillus_phage(66.0%)	89	5076037:5076053	5141099:5141115
5076037:5076053	attL	TATTTCTATAATCTAAT	NA	NA	NA	NA
AZJ23132.1|5082629_5085314_-|transposase	transposase	transposase	NA	NA	NA	NA
AZJ23133.1|5085335_5086616_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ23134.1|5086766_5088794_+	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	32.1	4.1e-19
AZJ23135.1|5088790_5089429_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ23136.1|5089826_5090525_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ23137.1|5090633_5091833_-	macrolide ABC transporter permease	NA	NA	NA	NA	NA
AZJ23138.1|5091829_5092510_-	macrolide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.1	5.2e-35
AZJ23139.1|5092506_5093700_-	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AZJ23140.1|5093886_5094108_+|bacteriocin	bacteriocin uberolysin	bacteriocin	NA	NA	NA	NA
AZJ23141.1|5094207_5095893_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ23142.1|5095897_5096428_+	stage II sporulation protein M	NA	NA	NA	NA	NA
AZJ23143.1|5096475_5097120_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	25.5	4.7e-09
AZJ23144.1|5097148_5097430_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ23145.1|5098386_5098854_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	61.3	3.1e-47
AZJ23146.1|5099225_5101664_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	40.8	1.3e-91
AZJ23147.1|5102156_5103038_+	cytosolic protein	NA	I7ILW0	Bacillus_phage	84.6	5.8e-127
AZJ23148.1|5103040_5103649_-	hypothetical protein	NA	W8CZ47	Bacillus_phage	79.1	1.1e-89
AZJ23149.1|5103638_5104805_-	cell division protein FtsK	NA	A0A0S2GLG9	Bacillus_phage	84.8	1.4e-192
AZJ23150.1|5104815_5105010_-	hypothetical protein	NA	A0A1B1P7T1	Bacillus_phage	54.7	1.2e-13
AZJ23151.1|5105309_5105531_+	transcriptional regulator	NA	A0A0S2GLH4	Bacillus_phage	72.6	4.6e-25
AZJ23152.1|5105663_5105882_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ23153.1|5105914_5106676_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P7G0	Bacillus_phage	85.4	1.0e-124
AZJ23154.1|5106675_5107101_-|holin	holin	holin	D2XPZ9	Bacillus_virus	93.6	2.9e-68
AZJ23155.1|5107136_5107583_-	hypothetical protein	NA	A0A2H4J980	uncultured_Caudovirales_phage	87.7	9.6e-54
AZJ23156.1|5107621_5109595_-	hypothetical protein	NA	A0A2H4JG80	uncultured_Caudovirales_phage	60.4	7.8e-164
AZJ23157.1|5109610_5111395_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ23158.1|5111408_5112218_-|tail	phage tail family protein	tail	A0A290FZP5	Caldibacillus_phage	44.2	2.8e-59
AZJ23159.1|5112214_5113657_-	tape measure protein	NA	D2XR26	Bacillus_phage	41.5	1.3e-11
AZJ23160.1|5116395_5116509_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ23161.1|5116619_5116982_-	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	55.0	4.2e-31
AZJ23162.1|5116986_5117559_-|tail	phage tail protein	tail	A0A0U4JWV5	Exiguobacterium_phage	58.4	1.5e-54
AZJ23163.1|5117559_5117892_-	hypothetical protein	NA	D2XR22	Bacillus_phage	78.2	2.0e-40
AZJ23727.1|5117888_5118233_-	hypothetical protein	NA	A0A2H4JAH8	uncultured_Caudovirales_phage	84.2	1.0e-50
AZJ23164.1|5118234_5118579_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ23165.1|5118565_5118859_-	hypothetical protein	NA	A0A0S2SXS0	Bacillus_phage	55.2	3.7e-22
AZJ23166.1|5118851_5119031_-	hypothetical protein	NA	A0A0S2SXV2	Bacillus_phage	66.1	8.1e-12
AZJ23167.1|5119046_5120219_-|capsid	phage major capsid protein	capsid	A0A0S2SXJ6	Bacillus_phage	82.3	6.5e-158
AZJ23168.1|5120211_5120784_-|head,protease	HK97 family phage prohead protease	head,protease	A0A0S2SXJ4	Bacillus_phage	67.4	5.7e-67
AZJ23169.1|5120776_5121946_-|portal	phage portal protein	portal	A0A1S5S8H6	Streptococcus_phage	57.7	9.4e-133
AZJ23170.1|5121964_5123722_-|terminase	terminase	terminase	C5J959	Streptococcus_phage	60.2	3.5e-200
AZJ23171.1|5123727_5124081_-|terminase	terminase	terminase	A0A0U4JV93	Exiguobacterium_phage	50.5	1.3e-21
AZJ23728.1|5124174_5124384_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ23172.1|5124386_5124551_-	DNA-binding protein	NA	A0A142F1N8	Bacillus_phage	62.2	1.5e-09
AZJ23173.1|5124550_5124832_-	restriction endonuclease	NA	A0A0S2SXR6	Bacillus_phage	66.3	2.6e-28
AZJ23174.1|5125192_5125438_-	hypothetical protein	NA	W8CYG8	Bacillus_phage	93.8	5.0e-36
AZJ23175.1|5125644_5126187_-|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	99.4	3.3e-96
AZJ23176.1|5126183_5126672_-	ArpU family transcriptional regulator	NA	A0A1B0T6C9	Bacillus_phage	96.9	2.0e-84
AZJ23177.1|5127012_5127294_-	hypothetical protein	NA	A0A0S2GLD3	Bacillus_phage	88.2	2.5e-39
AZJ23178.1|5127420_5127819_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ23179.1|5127927_5128155_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ23180.1|5128200_5128446_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ23181.1|5128660_5129035_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ23182.1|5129518_5129830_-	hypothetical protein	NA	D2XR52	Bacillus_phage	71.8	9.1e-35
AZJ23183.1|5130019_5130328_-	hypothetical protein	NA	H0USU8	Bacillus_phage	90.2	3.5e-47
AZJ23184.1|5130498_5130696_-	hypothetical protein	NA	H0USU7	Bacillus_phage	95.2	4.7e-29
AZJ23185.1|5130983_5131148_-	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	83.3	3.7e-19
AZJ23186.1|5131198_5131465_-	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	92.0	4.0e-39
AZJ23187.1|5131507_5132320_-	DNA replication protein	NA	A0A0S2GLK2	Bacillus_phage	93.0	3.7e-144
AZJ23188.1|5132282_5133299_-	DNA replication protein DnaD	NA	W8CYG5	Bacillus_phage	92.9	3.7e-178
AZJ23189.1|5133544_5134192_-	sigma-70 family RNA polymerase sigma factor	NA	H0USU1	Bacillus_phage	92.1	8.9e-109
AZJ23190.1|5134524_5134839_-	hypothetical protein	NA	H0USU0	Bacillus_phage	91.2	8.3e-44
AZJ23191.1|5135000_5135762_-	phage regulatory protein	NA	A0A0S2GLP8	Bacillus_phage	69.8	3.3e-94
AZJ23192.1|5135973_5136162_-	transcriptional regulator	NA	A0A0S2GLE9	Bacillus_phage	91.9	6.7e-25
AZJ23193.1|5136212_5136440_-	XRE family transcriptional regulator	NA	A0A0S2GLE0	Bacillus_phage	66.7	4.0e-24
AZJ23729.1|5136590_5136953_+	XRE family transcriptional regulator	NA	I7J6V3	Bacillus_phage	82.6	2.1e-46
AZJ23730.1|5137318_5138569_-	hypothetical protein	NA	W8CYT9	Bacillus_phage	79.1	1.3e-185
AZJ23194.1|5139166_5140228_+|integrase	site-specific integrase	integrase	H0UST3	Bacillus_phage	79.0	1.3e-162
AZJ23195.1|5140289_5141033_-	carboxylesterase	NA	NA	NA	NA	NA
AZJ23196.1|5141192_5141426_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
5141099:5141115	attR	TATTTCTATAATCTAAT	NA	NA	NA	NA
AZJ23197.1|5141520_5142213_-	LrgB family protein	NA	NA	NA	NA	NA
AZJ23198.1|5142209_5142578_-|holin	holin-like protein	holin	NA	NA	NA	NA
AZJ23199.1|5142913_5143864_+	nucleoside hydrolase	NA	NA	NA	NA	NA
AZJ23200.1|5143914_5145210_-	enolase	NA	A0A1X9I5Z8	Streptococcus_phage	75.4	8.4e-183
AZJ23201.1|5145240_5146770_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AZJ23202.1|5146766_5147522_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
AZJ23203.1|5147554_5148739_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AZJ23204.1|5148878_5149883_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AZJ23205.1|5149909_5150938_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ23206.1|5151073_5151319_-	glutaredoxin family protein	NA	NA	NA	NA	NA
AZJ23207.1|5151328_5152636_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
AZJ23208.1|5152908_5153205_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ23209.1|5153666_5153873_+	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
AZJ23210.1|5153966_5154452_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ23211.1|5154481_5154958_+	stage V sporulation protein AC	NA	NA	NA	NA	NA
AZJ23212.1|5154958_5155975_+	stage V sporulation protein AD	NA	NA	NA	NA	NA
AZJ23213.1|5155971_5156322_+	stage V sporulation protein AE	NA	NA	NA	NA	NA
AZJ23214.1|5156333_5156540_+	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
AZJ23215.1|5156560_5157430_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ23216.1|5157670_5158252_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	56.5	1.8e-55
>prophage 1
CP024685	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence	490693	0	14739	490693		uncultured_Caudovirales_phage(33.33%)	11	NA	NA
AZJ23741.1|728_2375_-	cell wall hydrolase	NA	NA	NA	NA	NA
AZJ24095.1|2773_2920_+	gamma-aminobutyrate permease	NA	NA	NA	NA	NA
AZJ23742.1|3509_6119_+	S-layer protein	NA	NA	NA	NA	NA
AZJ23743.1|6190_6388_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ23744.1|6374_6923_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ23745.1|8032_8242_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ23746.1|9304_9679_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ23747.1|10367_10529_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ23748.1|10528_11644_-	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	54.4	5.8e-108
AZJ23749.1|12662_13751_-	CDP-glucose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	26.3	3.0e-16
AZJ23750.1|13779_14739_-	CDP-abequose synthase	NA	A0A2K9L4U8	Tupanvirus	29.8	2.8e-26
>prophage 2
CP024685	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence	490693	26494	27871	490693		Mycobacterium_phage(100.0%)	1	NA	NA
AZJ23758.1|26494_27871_+	chitin-binding protein	NA	G1FGA4	Mycobacterium_phage	39.2	2.9e-08
>prophage 3
CP024685	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence	490693	36202	36979	490693		Prochlorococcus_phage(100.0%)	1	NA	NA
AZJ23764.1|36202_36979_+	2-deoxy-D-gluconate 3-dehydrogenase	NA	A0A0K0KVL6	Prochlorococcus_phage	27.2	2.9e-05
>prophage 4
CP024685	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence	490693	73209	74952	490693		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AZJ23791.1|73209_74952_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	57.3	1.1e-12
>prophage 5
CP024685	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence	490693	77996	79424	490693		Bacillus_virus(100.0%)	1	NA	NA
AZJ23795.1|77996_79424_-	glucosaminidase	NA	G3MAW8	Bacillus_virus	43.6	2.9e-27
>prophage 6
CP024685	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence	490693	82701	84426	490693		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
AZJ23798.1|82701_84426_-	thiamine pyrophosphate-binding protein	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	23.3	1.9e-20
>prophage 7
CP024685	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence	490693	91192	93113	490693		Bacillus_phage(50.0%)	2	NA	NA
AZJ23803.1|91192_91420_-	hypothetical protein	NA	A0A125RQ78	Bacillus_phage	38.2	1.7e-06
AZJ23804.1|92378_93113_+	chitooligosaccharide deacetylase	NA	A0A2K9L357	Tupanvirus	27.0	3.7e-10
>prophage 8
CP024685	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence	490693	108621	192337	490693	transposase,holin,protease,integrase	Bacillus_phage(21.05%)	63	113424:113474	192340:192390
AZJ23819.1|108621_109203_-	hypothetical protein	NA	A0A127AWH2	Bacillus_phage	26.6	8.2e-05
AZJ23820.1|109254_110367_-	riboflavin biosynthesis protein RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.9	7.2e-58
AZJ23821.1|110359_111097_-	GTP cyclohydrolase	NA	A0A2H4PQS2	Staphylococcus_phage	45.9	1.2e-29
AZJ23822.1|111400_111718_+	transcriptional regulator	NA	NA	NA	NA	NA
AZJ23823.1|111992_113423_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
113424:113474	attL	CAAAAACGCCATCCTTTCTGTATATTTCTACAAAAAGAATAGCGTTTTTTT	NA	NA	NA	NA
AZJ23824.1|113539_113890_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ23825.1|117728_118766_-	peptidase M15	NA	NA	NA	NA	NA
AZJ23826.1|119409_121200_-	histidine kinase	NA	NA	NA	NA	NA
AZJ23827.1|121204_121795_-	histidine kinase	NA	NA	NA	NA	NA
AZJ23828.1|122494_123826_-	erythromycin esterase	NA	NA	NA	NA	NA
AZJ23829.1|124424_125582_-	D-alanyl-D-alanine carboxypeptidase	NA	G1DB24	Mycobacterium_phage	27.0	7.3e-21
AZJ23830.1|126164_128186_+	penicillin-binding protein	NA	A0A1I9S919	Mycobacterium_phage	31.9	2.3e-09
AZJ23831.1|128547_129294_+	bacitracin ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	8.1e-29
AZJ23832.1|129295_131263_+	ABC transporter permease	NA	NA	NA	NA	NA
AZJ23833.1|132015_132462_+	spermidine acetyltransferase	NA	NA	NA	NA	NA
AZJ23834.1|132901_135784_-	collagenase	NA	NA	NA	NA	NA
AZJ23835.1|136602_137301_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ23836.1|137666_138137_+	DUF5065 domain-containing protein	NA	NA	NA	NA	NA
AZJ23837.1|138319_139081_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ23838.1|141424_141805_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZJ23839.1|141801_142500_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.7	7.3e-16
AZJ23840.1|142496_143291_+	ABC transporter permease	NA	NA	NA	NA	NA
AZJ23841.1|143330_144065_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ23842.1|144281_145649_-	ABC transporter permease	NA	NA	NA	NA	NA
AZJ23843.1|145725_146496_-	bacitracin ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	3.0e-34
AZJ23844.1|146667_147852_-	ABC transporter permease	NA	NA	NA	NA	NA
AZJ23845.1|147854_148529_-	macrolide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.6	1.1e-37
AZJ23846.1|148525_149626_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AZJ23847.1|149902_150988_-	vancomycin resistance histidine kinase VanS	NA	A0A1B0VMK3	Pseudomonas_phage	31.9	1.5e-20
AZJ23848.1|150980_151685_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.9	2.6e-37
AZJ23849.1|152179_152554_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ23850.1|153157_153805_+	recombinase	NA	Q1MVP4	Enterobacteria_phage	30.7	5.7e-15
AZJ23851.1|153927_154245_+	2-acyl-glycerophospho-ethanolamine acyltransferase	NA	NA	NA	NA	NA
AZJ23852.1|154468_154687_-	acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	65.2	1.2e-17
AZJ23853.1|155241_155439_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ23854.1|155615_156788_-|integrase	integrase	integrase	A0A142F1N9	Bacillus_phage	24.4	3.4e-05
AZJ23855.1|157191_158193_+	excisionase	NA	NA	NA	NA	NA
AZJ23856.1|158679_159609_-|holin	choline-binding protein A	holin	NA	NA	NA	NA
AZJ23857.1|160108_161263_+	ribonuclease	NA	NA	NA	NA	NA
AZJ23858.1|161644_161887_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ23859.1|162103_162196_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ23860.1|162254_162554_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AZJ23861.1|163179_163920_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AZJ23862.1|164158_164593_-	sodium:proton symporter	NA	NA	NA	NA	NA
AZJ23863.1|165392_165866_+	DUF1203 domain-containing protein	NA	NA	NA	NA	NA
AZJ23864.1|166006_167437_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AZJ23865.1|168615_170559_-	ABC transporter permease	NA	NA	NA	NA	NA
AZJ23866.1|170533_171304_-	bacitracin ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.5	5.6e-33
AZJ23867.1|172144_173095_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	44.5	2.9e-55
AZJ23868.1|173656_174307_-	sugar phosphate isomerase	NA	NA	NA	NA	NA
AZJ23869.1|174583_176545_-	chitin-binding protein	NA	NA	NA	NA	NA
AZJ23870.1|177038_177467_-	DUF4879 domain-containing protein	NA	NA	NA	NA	NA
AZJ23871.1|177784_178549_-	short-chain dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.1	1.2e-22
AZJ23872.1|178948_179854_-	EamA family transporter	NA	NA	NA	NA	NA
AZJ23873.1|179963_181358_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.8	2.7e-25
AZJ23874.1|181558_182545_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ23875.1|182772_184266_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	40.0	9.6e-82
AZJ23876.1|185148_185628_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AZJ23877.1|185688_186312_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZJ23878.1|186374_186959_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZJ23879.1|187382_188756_-	carboxylic ester hydrolase	NA	NA	NA	NA	NA
AZJ24101.1|188897_190127_-	aminopeptidase	NA	NA	NA	NA	NA
AZJ23880.1|190906_192337_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
192340:192390	attR	CAAAAACGCCATCCTTTCTGTATATTTCTACAAAAAGAATAGCGTTTTTTT	NA	NA	NA	NA
>prophage 9
CP024685	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence	490693	204316	205225	490693		Klosneuvirus(100.0%)	1	NA	NA
AZJ23890.1|204316_205225_-	arginase	NA	A0A1V0SJM8	Klosneuvirus	35.3	1.7e-33
>prophage 10
CP024685	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence	490693	223584	223785	490693		Lactococcus_phage(100.0%)	1	NA	NA
AZJ23903.1|223584_223785_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	72.7	6.3e-21
>prophage 11
CP024685	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence	490693	230654	236481	490693	transposase	Bacillus_phage(100.0%)	7	NA	NA
AZJ23909.1|230654_231020_-	ArpU family transcriptional regulator	NA	A0A1B1P853	Bacillus_phage	42.5	2.2e-19
AZJ23910.1|232763_232928_+	hypothetical protein	NA	A0A288WGN0	Bacillus_phage	59.3	3.8e-08
AZJ23911.1|233541_234663_-|transposase	transposase	transposase	S6AND0	Bacillus_phage	82.0	1.9e-175
AZJ23912.1|234805_235063_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ23913.1|235755_236019_-	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	60.2	3.1e-20
AZJ23914.1|236015_236303_-	helix-turn-helix domain containing protein	NA	A0A1B1P7W1	Bacillus_phage	75.8	1.7e-32
AZJ23915.1|236217_236481_-	hypothetical protein	NA	A0A1B1P8D7	Bacillus_phage	75.0	1.2e-19
>prophage 12
CP024685	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence	490693	251216	251879	490693		Bacillus_phage(100.0%)	1	NA	NA
AZJ23928.1|251216_251879_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	39.7	9.9e-39
>prophage 13
CP024685	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence	490693	256996	258114	490693		Bacillus_phage(50.0%)	2	NA	NA
AZJ23935.1|256996_257368_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	45.6	1.3e-19
AZJ23936.1|257595_258114_-	Holliday junction resolvase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	58.9	5.6e-45
>prophage 14
CP024685	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence	490693	266665	267643	490693		Cyanophage(100.0%)	1	NA	NA
AZJ23943.1|266665_267643_-	RNA polymerase subunit sigma-70	NA	M4SMP8	Cyanophage	27.0	3.3e-14
>prophage 15
CP024685	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence	490693	292432	299143	490693		Streptococcus_phage(100.0%)	4	NA	NA
AZJ23959.1|292432_294973_+	hypothetical protein	NA	A0A1S5SF64	Streptococcus_phage	36.6	2.4e-141
AZJ23960.1|294974_295457_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ23961.1|295489_297877_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ23962.1|297904_299143_+	lytic transglycosylase	NA	A0A1S5SEZ8	Streptococcus_phage	44.5	2.1e-66
>prophage 16
CP024685	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence	490693	307401	319984	490693		Bacillus_phage(75.0%)	10	NA	NA
AZJ24105.1|307401_309354_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.7	4.9e-17
AZJ23970.1|309573_309795_-	XRE family transcriptional regulator	NA	A0A0S2GLH4	Bacillus_phage	46.6	1.1e-10
AZJ23971.1|310088_310409_+	hypothetical protein	NA	A0A0S2GLK1	Bacillus_phage	62.3	2.6e-29
AZJ23972.1|310424_311591_+	cell division protein FtsK	NA	A0A0S2GLG9	Bacillus_phage	77.3	3.8e-174
AZJ24106.1|311613_312189_+	hypothetical protein	NA	W8CZ47	Bacillus_phage	74.1	1.1e-81
AZJ23973.1|313213_315028_+	acetyltransferase	NA	B5WZU0	Pseudomonas_phage	35.4	1.4e-42
AZJ23974.1|315525_315882_+	DUF1093 domain-containing protein	NA	NA	NA	NA	NA
AZJ23975.1|316272_316920_+	hypothetical protein	NA	A0A223LKM8	Bacillus_phage	34.3	1.5e-15
AZJ23976.1|317542_318010_-	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
AZJ23977.1|318343_319984_+	peptidase S8	NA	A0A217EQY2	Bacillus_phage	23.5	3.8e-07
>prophage 17
CP024685	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence	490693	323973	326995	490693		Bacillus_phage(100.0%)	3	NA	NA
AZJ23981.1|323973_324189_+	acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	71.6	1.3e-19
AZJ23982.1|324258_324678_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ23983.1|325624_326995_+	chitin-binding protein	NA	A7KUU1	Bacillus_phage	29.2	1.5e-09
>prophage 18
CP024685	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence	490693	331601	334037	490693		Salmonella_phage(50.0%)	3	NA	NA
AZJ23987.1|331601_332597_+	hypothetical protein	NA	I6R0L8	Salmonella_phage	32.6	1.8e-07
AZJ23988.1|333278_333491_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ23989.1|333779_334037_-	hypothetical protein	NA	A0A288WFY7	Bacillus_phage	92.2	7.0e-33
>prophage 19
CP024685	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence	490693	340724	340949	490693		Bacillus_phage(100.0%)	1	NA	NA
AZJ23996.1|340724_340949_+	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	89.2	1.5e-26
>prophage 20
CP024685	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence	490693	348534	351132	490693		Hokovirus(50.0%)	2	NA	NA
AZJ24002.1|348534_350361_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	27.8	4.9e-35
AZJ24109.1|350577_351132_+	N-acetyltransferase	NA	E4ZFP7	Streptococcus_phage	47.7	1.2e-24
>prophage 21
CP024685	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence	490693	354465	358707	490693		Bacillus_phage(100.0%)	1	NA	NA
AZJ24004.1|354465_358707_+	peptidase S8	NA	A0A217EQY2	Bacillus_phage	31.1	1.2e-15
>prophage 22
CP024685	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence	490693	366007	367950	490693		Bacillus_phage(50.0%)	3	NA	NA
AZJ24010.1|366007_366280_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	67.8	6.3e-24
AZJ24011.1|366418_366784_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ24012.1|367524_367950_+	GTP pyrophosphokinase	NA	A0A141E1X8	Streptococcus_phage	63.4	1.9e-38
>prophage 23
CP024685	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence	490693	373116	374537	490693		uncultured_Caudovirales_phage(100.0%)	2	NA	NA
AZJ24019.1|373116_373443_-	hypothetical protein	NA	A0A2H4JBB8	uncultured_Caudovirales_phage	45.6	4.9e-07
AZJ24020.1|373442_374537_-	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	54.4	1.2e-102
>prophage 24
CP024685	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence	490693	396726	397968	490693		Streptococcus_phage(100.0%)	1	NA	NA
AZJ24032.1|396726_397968_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1S5S8U7	Streptococcus_phage	28.6	1.9e-30
>prophage 25
CP024685	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence	490693	403837	410002	490693		Tupanvirus(100.0%)	1	NA	NA
AZJ24037.1|403837_410002_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	31.6	4.9e-204
>prophage 26
CP024685	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence	490693	413849	416408	490693		Catovirus(100.0%)	1	NA	NA
AZJ24041.1|413849_416408_+	glycosyl transferase family 2	NA	A0A1V0SAH6	Catovirus	32.0	2.6e-10
>prophage 27
CP024685	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence	490693	419999	431027	490693		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
AZJ24046.1|419999_421652_-	aspartate aminotransferase family protein	NA	M1HWX9	Paramecium_bursaria_Chlorella_virus	33.6	1.2e-05
AZJ24047.1|422135_423062_-	aldo/keto reductase	NA	NA	NA	NA	NA
AZJ24048.1|423428_431027_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	28.3	2.9e-166
>prophage 28
CP024685	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence	490693	436593	437595	490693		Enterobacteria_phage(100.0%)	1	NA	NA
AZJ24055.1|436593_437595_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	2.3e-23
>prophage 29
CP024685	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence	490693	452131	453136	490693		Aeropyrum_coil-shaped_virus(100.0%)	1	NA	NA
AZJ24065.1|452131_453136_+	hypothetical protein	NA	J7Q326	Aeropyrum_coil-shaped_virus	35.8	1.1e-12
>prophage 30
CP024685	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence	490693	461411	462494	490693		Proteus_phage(100.0%)	1	NA	NA
AZJ24070.1|461411_462494_+	peptidase U32	NA	A0A249XWF7	Proteus_phage	28.8	5.2e-29
>prophage 31
CP024685	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence	490693	466744	475996	490693		Acinetobacter_phage(25.0%)	10	NA	NA
AZJ24075.1|466744_467311_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	43.2	1.8e-41
AZJ24076.1|467331_468573_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24077.1|469162_469618_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZJ24078.1|469820_470711_+	3-deoxy-7-phosphoheptulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	30.7	4.6e-15
AZJ24079.1|471671_472037_+	hypothetical protein	NA	A0A0K2CYS5	Paenibacillus_phage	39.5	3.7e-11
AZJ24080.1|472233_472674_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
AZJ24081.1|473121_473703_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24082.1|473863_474091_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24083.1|474622_474814_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ24084.1|474922_475996_+	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	41.8	2.4e-74
>prophage 32
CP024685	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence	490693	483659	485087	490693		Mycobacterium_phage(100.0%)	1	NA	NA
AZJ24090.1|483659_485087_-	serine hydrolase	NA	A0A2P1JR59	Mycobacterium_phage	22.2	5.2e-08
>prophage 1
CP024686	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-2-313K, complete sequence	313432	194692	200453	313432		Streptococcus_virus(33.33%)	8	NA	NA
AZJ24263.1|194692_195280_-	GTP cyclohydrolase I FolE	NA	A0A1W7AF02	Streptococcus_virus	47.4	6.3e-45
AZJ24264.1|195323_196040_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.7	7.7e-53
AZJ24265.1|196032_196524_-	6-carboxytetrahydropterin synthase QueD	NA	J9PV91	Bacillus_phage	71.1	3.1e-61
AZJ24266.1|196523_197189_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	56.3	4.8e-65
AZJ24267.1|197201_197990_-	multidrug transporter permease	NA	NA	NA	NA	NA
AZJ24268.1|197992_198784_-	ABC transporter permease	NA	NA	NA	NA	NA
AZJ24269.1|198780_199779_-	ATPase	NA	A0A2R8FG22	Brazilian_cedratvirus	27.8	6.1e-16
AZJ24270.1|199796_200453_-	hypothetical protein	NA	D5GVF5	Campylobacter_virus	24.2	4.9e-06
>prophage 1
CP024687	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence	257021	8166	77526	257021	transposase,protease,integrase	Streptococcus_phage(20.0%)	57	NA	NA
AZJ24542.1|8166_9036_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AZJ24543.1|9594_9945_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24370.1|9901_10093_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24371.1|10591_14845_+	fusion protein (includes pXO2-28-29-30)	NA	NA	NA	NA	NA
AZJ24372.1|14863_15238_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24373.1|15576_15960_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24374.1|15976_17302_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24375.1|17319_18153_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24376.1|18149_18899_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24377.1|18951_19314_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24378.1|19498_19795_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24379.1|19812_20091_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24380.1|20175_22101_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24381.1|22127_24755_+	conjugal transfer protein	NA	NA	NA	NA	NA
AZJ24382.1|24785_28157_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24383.1|28153_28432_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24384.1|28428_28638_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24385.1|28606_29452_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24386.1|29555_29870_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24544.1|29932_30601_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24387.1|30617_32555_+	ATP-binding protein	NA	NA	NA	NA	NA
AZJ24388.1|32556_33690_+	lysozyme	NA	A0A1S5SEZ8	Streptococcus_phage	36.0	3.3e-50
AZJ24389.1|33712_34321_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24390.1|34409_34685_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24391.1|34681_35539_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24392.1|35817_36105_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24393.1|36116_36725_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24394.1|36743_38300_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24395.1|38365_39847_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24396.1|39921_40350_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24397.1|40417_40894_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24398.1|40913_41342_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24399.1|41392_47626_+	helicase SNF2	NA	A0A248SL14	Klebsiella_phage	35.3	1.4e-270
AZJ24400.1|47653_48028_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24401.1|48098_49082_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24402.1|49105_49657_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AZJ24403.1|49736_50762_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24404.1|51012_51585_+	type III toxin-antitoxin system ToxN/AbiQ family toxin	NA	NA	NA	NA	NA
AZJ24405.1|51773_53921_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	44.6	1.9e-107
AZJ24406.1|53973_54324_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24545.1|54467_54905_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AZJ24407.1|54955_55189_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ24546.1|55847_57221_+|transposase	IS21 family transposase ISSau9	transposase	NA	NA	NA	NA
AZJ24408.1|57220_57973_+	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	34.5	4.0e-36
AZJ24409.1|58121_59108_-|integrase	integrase	integrase	A0A1B1P793	Bacillus_phage	34.5	4.5e-35
AZJ24410.1|59085_59703_-	DNA recombinase	NA	A0A1V0E035	Clostridioides_phage	30.9	6.1e-14
AZJ24411.1|60276_60987_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ24412.1|61607_62681_-	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	44.2	6.1e-78
AZJ24413.1|63385_63631_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24414.1|64587_64962_-	hypothetical protein	NA	D2XQ01	Bacillus_virus	44.4	1.2e-25
AZJ24415.1|65008_65356_-	YolD-like family protein	NA	NA	NA	NA	NA
AZJ24416.1|65757_66351_+	hypothetical protein	NA	A0A1Z1LZN4	Bacillus_phage	34.1	6.7e-10
AZJ24417.1|66347_66545_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24418.1|66862_68503_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZJ24419.1|70049_71483_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AZJ24420.1|72699_76215_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ24421.1|76818_77526_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	47.9	4.0e-46
>prophage 2
CP024687	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence	257021	82883	161200	257021	transposase,tRNA	Escherichia_phage(38.1%)	57	NA	NA
AZJ24424.1|82883_83591_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	47.9	4.0e-46
AZJ24425.1|84228_85731_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ24426.1|86483_87191_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	47.9	4.0e-46
AZJ24427.1|89474_90182_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	47.9	4.0e-46
AZJ24428.1|90726_91092_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24429.1|91254_91461_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24430.1|92811_93519_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	47.9	4.0e-46
AZJ24431.1|93813_94410_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24432.1|95120_95384_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ24433.1|95839_96997_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ24434.1|98205_98466_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ24435.1|98794_99502_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	47.9	4.0e-46
AZJ24436.1|101071_101338_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24437.1|101381_101609_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24438.1|101705_102713_-	capsular biosynthesis protein CpsI	NA	A0A2K9L0I7	Tupanvirus	34.5	3.6e-40
AZJ24439.1|103235_104393_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ24440.1|104425_105766_-	colanic acid biosynthesis glycosyltransferase WcaL	NA	NA	NA	NA	NA
AZJ24547.1|107213_108524_-	UDP-glucose 6-dehydrogenase	NA	A0A127AXI2	Bacillus_phage	41.9	3.8e-90
AZJ24441.1|108525_109434_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	55.4	7.9e-79
AZJ24442.1|110129_110483_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24443.1|113303_115379_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ24444.1|115708_116416_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	47.9	4.0e-46
AZJ24445.1|116850_118293_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZJ24446.1|118418_119318_+	kinase	NA	NA	NA	NA	NA
AZJ24447.1|119365_120073_+|tRNA	alanyl-tRNA editing protein	tRNA	NA	NA	NA	NA
AZJ24448.1|120380_121418_+	pyridoxal-5'-phosphate-dependent protein	NA	A0A1W6JHY1	Lactococcus_phage	35.4	1.1e-39
AZJ24449.1|121451_122636_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
AZJ24450.1|123027_123927_+	EamA family transporter	NA	NA	NA	NA	NA
AZJ24548.1|124218_124362_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ24451.1|124469_124751_+	AbrB family transcriptional regulator	NA	A0A2I7SC16	Paenibacillus_phage	63.9	8.8e-13
AZJ24452.1|124772_125006_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
AZJ24453.1|125058_125337_-	DNA-binding protein	NA	A7KV42	Bacillus_phage	62.2	5.1e-21
AZJ24454.1|125487_125778_+	transcriptional regulator	NA	A0A218MNF3	uncultured_virus	39.1	1.1e-05
AZJ24455.1|125847_126156_+	50S ribosomal protein L7ae	NA	NA	NA	NA	NA
AZJ24456.1|126522_127440_+	ATPase	NA	NA	NA	NA	NA
AZJ24457.1|128059_128632_-	resolvase	NA	M9Q1K0	Clostridium_phage	36.0	2.1e-24
AZJ24458.1|128942_130004_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24459.1|130177_132475_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24460.1|132546_133419_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24461.1|136410_136791_-|transposase	transposase	transposase	NA	NA	NA	NA
AZJ24549.1|138509_139379_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AZJ24550.1|139981_141355_+|transposase	IS21 family transposase ISSau9	transposase	NA	NA	NA	NA
AZJ24462.1|141354_142107_+	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	34.5	4.0e-36
AZJ24463.1|142258_143341_-|transposase	transposase	transposase	A0A1B1IQT7	uncultured_Mediterranean_phage	23.5	6.9e-05
AZJ24464.1|143700_145767_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24465.1|145834_147508_+	pesticidial crystal protein	NA	NA	NA	NA	NA
AZJ24466.1|149445_150153_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	47.9	4.0e-46
AZJ24467.1|150486_151902_+	tyrosine phenol-lyase	NA	NA	NA	NA	NA
AZJ24468.1|151898_153140_+	transporter	NA	NA	NA	NA	NA
AZJ24469.1|153325_154627_+	tryptophan halogenase	NA	NA	NA	NA	NA
AZJ24470.1|154805_155357_-	DNA invertase	NA	A0A0C4UR34	Shigella_phage	49.4	2.2e-39
AZJ24471.1|155599_156307_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	47.9	4.0e-46
AZJ24472.1|157631_158195_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24551.1|158313_158493_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P878	Bacillus_phage	77.6	6.8e-19
AZJ24473.1|158651_158951_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24474.1|159070_159400_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AZJ24475.1|160492_161200_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.9	3.7e-39
>prophage 3
CP024687	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence	257021	166610	226746	257021	transposase,integrase	Bacillus_phage(40.0%)	46	194652:194711	218825:219820
AZJ24479.1|166610_167318_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.9	3.7e-39
AZJ24480.1|167745_168015_-	hypothetical protein	NA	H0USV6	Bacillus_phage	63.1	1.1e-23
AZJ24481.1|168446_169364_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ24552.1|171665_172535_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AZJ24482.1|172772_174200_+	collagen-like protein	NA	NA	NA	NA	NA
AZJ24483.1|174525_174786_-	DNA-binding protein	NA	NA	NA	NA	NA
AZJ24484.1|175609_176317_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	47.9	4.0e-46
AZJ24485.1|181070_181778_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	47.9	4.0e-46
AZJ24486.1|182784_184134_+	YVTN family beta-propeller repeat-containing protein	NA	NA	NA	NA	NA
AZJ24487.1|184322_185399_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24488.1|186437_187145_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	47.9	4.0e-46
AZJ24553.1|187214_188594_-|transposase	IS21 family transposase ISSau9	transposase	NA	NA	NA	NA
AZJ24489.1|189078_189642_-	resolvase	NA	A0A219Y9V9	Aeromonas_phage	41.2	1.3e-31
AZJ24490.1|192058_192748_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	58.4	1.1e-69
AZJ24491.1|193292_194273_-	hypothetical protein	NA	NA	NA	NA	NA
194652:194711	attL	AGAGGGTGTTGCAAAACTCATAAGTATTCAAAAATGAATGCATAAAAAAATCCGTTTTCC	NA	NA	NA	NA
AZJ24492.1|195807_196497_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	57.9	2.5e-69
AZJ24493.1|198739_198949_-	preprotein translocase	NA	NA	NA	NA	NA
AZJ24494.1|199253_199868_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24495.1|200062_201073_+	plasmid segregation protein ParM	NA	A0A2H4IZP5	uncultured_Caudovirales_phage	27.4	6.6e-26
AZJ24496.1|201062_201302_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24497.1|201396_201636_+	hypothetical protein	NA	A0A1B1P789	Bacillus_phage	52.6	5.0e-17
AZJ24498.1|202194_202386_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24499.1|202401_202668_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24500.1|203574_203874_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ24554.1|203964_204159_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P878	Bacillus_phage	79.4	5.0e-23
AZJ24501.1|205660_205930_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ24502.1|206314_206719_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24503.1|206958_207150_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24504.1|207437_209267_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	24.8	2.1e-30
AZJ24505.1|209878_210223_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24506.1|210268_210679_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ24507.1|211363_212536_-|integrase	integrase	integrase	A0A142F1N9	Bacillus_phage	24.4	2.3e-06
AZJ24508.1|213068_213491_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24509.1|213575_214016_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24510.1|214724_215432_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	47.9	4.0e-46
AZJ24511.1|215556_215922_+	hypothetical protein	NA	A0A0S2MVJ1	Bacillus_phage	78.2	2.5e-52
AZJ24512.1|215918_216500_+	dUTPase	NA	A0A0S2MVD0	Bacillus_phage	82.9	2.1e-93
AZJ24513.1|216539_217196_+	hypothetical protein	NA	A0A0A7AR03	Bacillus_phage	63.6	2.3e-35
AZJ24555.1|220811_221003_+	hypothetical protein	NA	NA	NA	NA	NA
218825:219820	attR	AGAGGGTGTTGCAAAACTCATAAGTATTCAAAAATGAATGCATAAAAAAATCCGTTTTCCTGGAAGAATGATAGTAACCCAAACTATCAGTGGAAAGGACGGATTTACTAGTATGATAACCAATTTTGATCAGAATCAATCCATTTTACAAATTTTATTTGCATATGTAGACAGTTTAACTATTGGAGGCGTTCCGCCTATTACAGGTCGTCCACCTATCTGTAAAAAAGCTTTACTTAAATGTTTTTTGTAAAAACGGTATTCCAAATCAATTCTTTGCGTAAATTAACTCGTTTTTTGCATCAATACCCTTCATTTCGTGTATCTTGTGGCCTTTCTTTTGTTCCTCATATATCTACTTTTTCACGTGTAGGTACTTGGTTTCGCAACGAAGGGATTCCGTTGATCCATAAACAAACTCTTCAAGAAATGAATTTAGGATTGATTCCATGCGTTTTAATTGATAGCACAGCTTTGCGGAGTAGTTTATATGATTCCCAAGCAAAATGGGGGAAATCTACTCGTTATGGTTGGTATAAGGGATATAAAGTACATGTCTGTTCTACACCAGAAGGTGTTATTTTGTCGTATGCATTTACAACAGCGAACGTACATGATAGCAAAATGGCTCCTGTATTACTTCAAGATATACAAGACAGAAACGTGTTATTTTCCGTCGCAGATGCTGCTTATGATAGTCAGCACATTTATGAAATTGCACGAATATGTAACATCTTTGCTATGAATCCAATCAACCCAAGAAATGGTGAACAAATCAAGAGTACACATCGTCGTGTATTGTCTCAGTTTGCACAAACCATCTTTGGTAAACAGTTGATGAGAGAGCGTGGAAAAATTGAACAACAGTTTAGTAATCTCAAAGATAAAGGGCTGGAACAGCCCCGTTGGTATGGTCAAAACCGCTATCTATTGCATGTTCAGCTAGTTTTTCTGATTCATAACATTGCATATTTATTTTAGTTTTGCAACACCCTC	NA	NA	NA	NA
AZJ24514.1|221021_221396_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24515.1|221915_222173_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24516.1|222361_222556_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24517.1|222805_223336_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	82.4	1.5e-77
AZJ24518.1|223335_223680_+	hypothetical protein	NA	A0A2H4JAV2	uncultured_Caudovirales_phage	45.8	5.7e-22
AZJ24519.1|224798_225023_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24520.1|226038_226746_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	47.9	4.0e-46
>prophage 1
CP024689	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-5-125K, complete sequence	124955	42690	69185	124955	transposase	Escherichia_phage(42.86%)	34	NA	NA
AZJ24805.1|42690_43560_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AZJ24737.1|43836_44193_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24738.1|44146_44479_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AZJ24739.1|44768_45362_+	cell division protein FtsN	NA	NA	NA	NA	NA
AZJ24740.1|45495_45687_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ24741.1|45892_46126_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
AZJ24742.1|46147_46429_-	AbrB family transcriptional regulator	NA	A0A1B1P791	Bacillus_phage	31.4	6.3e-11
AZJ24743.1|46553_46844_-	transcriptional regulator	NA	NA	NA	NA	NA
AZJ24806.1|47481_48351_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AZJ24744.1|48342_48525_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ24745.1|48842_49709_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24746.1|49784_50843_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24747.1|52236_52527_-	transcriptional regulator	NA	NA	NA	NA	NA
AZJ24748.1|52619_53192_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ24749.1|53440_53653_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ24750.1|54412_54694_+	AbrB family transcriptional regulator	NA	A0A2I7SC16	Paenibacillus_phage	59.0	1.1e-10
AZJ24751.1|54715_54949_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
AZJ24752.1|55002_55281_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	62.2	5.1e-21
AZJ24753.1|55420_55606_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AZJ24754.1|55673_55982_+	50S ribosomal protein L7ae	NA	NA	NA	NA	NA
AZJ24755.1|56555_57263_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	47.9	4.0e-46
AZJ24756.1|57319_57466_+	Spo0E family sporulation regulatory protein-aspartic acid phosphatase	NA	NA	NA	NA	NA
AZJ24757.1|58053_58377_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ24807.1|58364_59234_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AZJ24758.1|59912_60131_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ24808.1|60304_60544_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ24759.1|60637_60895_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ24760.1|61062_61560_-	hypothetical protein	NA	NA	NA	NA	NA
AZJ24761.1|62278_62626_+	hypothetical protein	NA	NA	NA	NA	NA
AZJ24762.1|62695_63403_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	47.9	4.0e-46
AZJ24763.1|63560_65372_-	enterotoxin C	NA	Q38196	Clostridium_botulinum_phage	37.6	4.0e-05
AZJ24764.1|65477_66680_-	enterotoxin	NA	NA	NA	NA	NA
AZJ24765.1|66734_67895_-	enterotoxin	NA	NA	NA	NA	NA
AZJ24766.1|68477_69185_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	47.9	4.0e-46
