The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
AP019189	Escherichia coli M217 DNA, complete genome	4825589	449710	516878	4825589	transposase,tRNA,protease	uncultured_Mediterranean_phage(15.38%)	60	NA	NA
BBG76226.1|449710_450658_-|tRNA	L-methionyl-tRNA(fMet) N-formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
BBG76227.1|450672_451182_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.0e-19
BBG76228.1|451311_452436_+	hypothetical protein	NA	NA	NA	NA	NA
BBG76229.1|452407_452881_+	hypothetical protein	NA	NA	NA	NA	NA
BBG76230.1|453125_453362_-	hypothetical protein	NA	NA	NA	NA	NA
BBG76231.1|453456_454029_+|tRNA	tRNA(ANN) t(6)A37 threonylcarbamoyladenosine modification protein	tRNA	NA	NA	NA	NA
BBG76232.1|454033_454852_+	dehydroshikimate reductase NAD(P)-binding	NA	NA	NA	NA	NA
BBG76233.1|454848_455106_+	hypothetical protein	NA	NA	NA	NA	NA
BBG76234.1|455081_455636_-	hypothetical protein	NA	NA	NA	NA	NA
BBG76235.1|461677_462436_-	amino acid ABC transporter ATPase	NA	G3M9Y6	Bacillus_virus	30.8	9.1e-20
BBG76236.1|462443_463547_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
BBG76237.1|463556_464756_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
BBG76238.1|464805_465831_-	periplasmic binding transport protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	1.8e-71
BBG76239.1|466261_466483_-	outer membrane protein	NA	NA	NA	NA	NA
BBG76240.1|466735_469840_-	multidrug efflux system protein	NA	NA	NA	NA	NA
BBG76241.1|469851_470754_-	multidrug transporter	NA	NA	NA	NA	NA
BBG76242.1|470870_471839_-|transposase	IS4 transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	1.0e-185
BBG76243.1|472020_472905_-	DNA adenine methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.9e-24
BBG76244.1|472990_473287_-	global DNA-binding transcriptional dual regulator	NA	NA	NA	NA	NA
BBG76245.1|473312_474185_-|tRNA	tRNA-dihydrouridine synthase B	tRNA	NA	NA	NA	NA
BBG76246.1|474606_475488_-	methyltransferase for 50S ribosomal subunit protein L11	NA	NA	NA	NA	NA
BBG76247.1|475499_476951_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
BBG76248.1|476940_477183_-	inner membrane protein	NA	NA	NA	NA	NA
BBG76249.1|477291_478641_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
BBG76250.1|478651_479122_-	acetyl CoA carboxylase	NA	NA	NA	NA	NA
BBG76251.1|479094_479283_-	hypothetical protein	NA	NA	NA	NA	NA
BBG76252.1|480099_481074_-	acryloyl-CoA reductase	NA	NA	NA	NA	NA
BBG76253.1|481225_483166_+	regulatory protein CsrD	NA	NA	NA	NA	NA
BBG76254.1|483470_484514_+	cell wall structural complex MreBCD actin-like component MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
BBG76255.1|484579_485683_+	cell wall structural complex MreBCD transmembrane component MreC	NA	NA	NA	NA	NA
BBG76256.1|485682_486171_+	cell wall structural complex MreBCD transmembrane component MreD	NA	NA	NA	NA	NA
BBG76257.1|486179_486773_+	septum formation inhibitor	NA	NA	NA	NA	NA
BBG76258.1|486762_488232_+	ribonuclease G	NA	NA	NA	NA	NA
BBG76259.1|488299_492100_+	hypothetical protein	NA	NA	NA	NA	NA
BBG76260.1|492529_493975_+|protease	protease TldD	protease	NA	NA	NA	NA
BBG76261.1|494108_495038_-	transcriptional regulator	NA	NA	NA	NA	NA
BBG76262.1|495151_495424_+	hypothetical protein	NA	NA	NA	NA	NA
BBG76263.1|495431_496364_+	p-hydroxybenzoic acid efflux system component	NA	NA	NA	NA	NA
BBG76264.1|496369_498337_+	p-hydroxybenzoic acid efflux system component	NA	NA	NA	NA	NA
BBG76265.1|498428_498701_+	barnase inhibitor	NA	NA	NA	NA	NA
BBG76266.1|498756_499071_-	cadmium and peroxide resistance protein	NA	NA	NA	NA	NA
BBG76267.1|499384_499855_-	l-arginine-responsive arginine metabolism regulon transcriptional regulator	NA	NA	NA	NA	NA
BBG76268.1|500289_501228_+	malate dehydrogenase	NA	NA	NA	NA	NA
BBG76269.1|501290_502358_-|protease	serine endoprotease	protease	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
BBG76270.1|502447_503815_-|protease	serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
BBG76271.1|503968_504367_-	inner membrane-anchored protein	NA	NA	NA	NA	NA
BBG76272.1|504716_505688_+	cell division protein ZapE	NA	NA	NA	NA	NA
BBG76273.1|505906_506335_+	50S ribosomal subunit protein L13	NA	NA	NA	NA	NA
BBG76274.1|506350_506743_+	30S ribosomal subunit protein S9	NA	NA	NA	NA	NA
BBG76275.1|507137_507776_+	stringent starvation protein A	NA	NA	NA	NA	NA
BBG76276.1|507781_508279_+|protease	ClpXP protease specificity enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
BBG76277.1|508321_509689_-	transporter	NA	NA	NA	NA	NA
BBG76278.1|510077_510860_+	sialic acid-inducible nan operon repressor	NA	NA	NA	NA	NA
BBG76279.1|510981_511875_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
BBG76280.1|511983_513474_+	sialic acid transporter	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
BBG76281.1|513521_514211_+	N-acetylmannosamine-6-P epimerase	NA	NA	NA	NA	NA
BBG76282.1|514207_515083_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
BBG76283.1|515079_515544_+	hypothetical protein	NA	NA	NA	NA	NA
BBG76284.1|515603_516152_-	hypothetical protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	2.3e-73
BBG76285.1|516551_516878_+|transposase	transposase	transposase	Q6H9S4	Enterobacteria_phage	97.2	2.4e-54
>prophage 2
AP019189	Escherichia coli M217 DNA, complete genome	4825589	583573	638060	4825589	transposase,protease	Escherichia_phage(30.0%)	57	NA	NA
BBG76348.1|583573_584452_-|protease	protease	protease	NA	NA	NA	NA
BBG76349.1|584460_585456_-|protease	protease	protease	NA	NA	NA	NA
BBG76350.1|585664_586189_+	SCP-2 sterol transfer family protein	NA	NA	NA	NA	NA
BBG76351.1|586182_586686_+	acetyltransferase	NA	NA	NA	NA	NA
BBG76352.1|586672_586975_-	GIY-YIG nuclease	NA	F2NZ06	Diadromus_pulchellus_ascovirus	53.8	7.8e-15
BBG76353.1|587025_587469_+	hypothetical protein	NA	NA	NA	NA	NA
BBG76354.1|587448_587967_-	general stress protein	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
BBG76355.1|588094_588730_+	nucleoside-diphosphate-sugar epimerase	NA	NA	NA	NA	NA
BBG76356.1|588802_589843_+	inner membrane permease	NA	NA	NA	NA	NA
BBG76357.1|589956_590532_-	outer membrane lipoprotein	NA	NA	NA	NA	NA
BBG76358.1|590541_591132_-	DnaA initiator-associating factor for replication initiation	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
BBG76359.1|591151_591547_-	hypothetical protein	NA	NA	NA	NA	NA
BBG76360.1|591504_593541_-	OM lipoprotein stimulator of MrcA transpeptidase	NA	NA	NA	NA	NA
BBG76361.1|593605_594466_+	ribosomal RNA small subunit methyltransferase I	NA	M1PLC5	Streptococcus_phage	43.6	9.5e-50
BBG76362.1|594508_595600_-	fimbrial-like adhesin protein	NA	NA	NA	NA	NA
BBG76363.1|595610_598052_-	outer membrane usher protein FimD	NA	NA	NA	NA	NA
BBG76364.1|598155_598830_-	periplasmic pilin chaperone	NA	NA	NA	NA	NA
BBG76365.1|598930_599515_-	fimbrial-like adhesin protein	NA	NA	NA	NA	NA
BBG76366.1|599915_600617_-	galactosamine-6-phosphate isomerase	NA	NA	NA	NA	NA
BBG76367.1|600671_601463_-	N-acetylgalactosamine-specific enzyme IID component of PTS	NA	NA	NA	NA	NA
BBG76368.1|601452_602082_-	N-acetylgalactosamine-specific enzyme IIC component of PTS	NA	NA	NA	NA	NA
BBG76369.1|602220_602496_+|transposase	transposase	transposase	Q71TE9	Escherichia_phage	97.8	7.7e-46
BBG76370.1|602540_602918_+|transposase	IS1 family transposase InsB	transposase	Q71TF0	Escherichia_phage	100.0	1.3e-67
BBG76371.1|603071_603548_-	N-acetylgalactosamine-specific enzyme IIB component of PTS	NA	NA	NA	NA	NA
BBG76372.1|603714_604575_-	tagatose-1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
BBG76373.1|604587_605742_-	tagatose-6-phosphate ketose isomerase	NA	NA	NA	NA	NA
BBG76374.1|606092_607226_-	N-acetylgalactosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
BBG76375.1|607222_607657_-	N-acetyl-galactosamine/galactosamine PTS system enzyme IIA component	NA	NA	NA	NA	NA
BBG76376.1|607674_608553_-	N-acetylgalactosamine-specific PTS system enzyme IID component	NA	NA	NA	NA	NA
BBG76377.1|608542_609322_-	N-acetylgalactosamine-specific enzyme IIC component of PTS	NA	NA	NA	NA	NA
BBG76378.1|609332_609806_-	N-acetylgalactosamine-specific enzyme IIB component of PTS	NA	NA	NA	NA	NA
BBG76379.1|609828_611109_-	tagatose-1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
BBG76380.1|611357_612167_+	transcriptional repressor of the aga regulon	NA	NA	NA	NA	NA
BBG76381.1|612221_612686_-	toxin of the SohB(PrlF)-YhaV toxin-antitoxin system	NA	NA	NA	NA	NA
BBG76382.1|612685_613021_-	antitoxin of the SohA(PrlF)-YhaV toxin-antitoxin system	NA	NA	NA	NA	NA
BBG76383.1|613169_614741_-	D-galactarate dehydrogenase	NA	NA	NA	NA	NA
BBG76384.1|615115_616450_+	(D)-galactarate transporter	NA	NA	NA	NA	NA
BBG76385.1|616465_617236_+	alpha-dehydro-beta-deoxy-D-glucarate aldolase	NA	NA	NA	NA	NA
BBG76386.1|617256_618156_+	tartronate semialdehyde reductase	NA	NA	NA	NA	NA
BBG76387.1|618252_619398_+	glycerate kinase I	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
BBG76388.1|620420_621608_-	hypothetical protein	NA	NA	NA	NA	NA
BBG76389.1|621629_622169_-	hypothetical protein	NA	NA	NA	NA	NA
BBG76390.1|622957_623896_+	tdc operon transcriptional activator	NA	NA	NA	NA	NA
BBG76391.1|623994_624984_+	L-threonine dehydratase	NA	NA	NA	NA	NA
BBG76392.1|625005_626337_+	L-threonine/L-serine transporter	NA	NA	NA	NA	NA
BBG76393.1|626362_627571_+	propionate kinase/acetate kinase C	NA	NA	NA	NA	NA
BBG76394.1|627604_629899_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
BBG76395.1|629912_630302_+	reactive intermediate deaminase	NA	NA	NA	NA	NA
BBG76396.1|630373_631738_+	L-serine dehydratase 3	NA	NA	NA	NA	NA
BBG76397.1|632012_633344_+	transporter	NA	NA	NA	NA	NA
BBG76398.1|633371_634682_+	L-serine dehydratase alpha chain	NA	NA	NA	NA	NA
BBG76399.1|634815_634980_-	hypothetical protein	NA	NA	NA	NA	NA
BBG76400.1|635002_635704_-	redox-sensitive bicupin	NA	NA	NA	NA	NA
BBG76401.1|635808_636705_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
BBG76402.1|636755_637112_-	inner membrane protein	NA	NA	NA	NA	NA
BBG76403.1|637362_637638_+|transposase	IS1 family transposase InsA	transposase	Q71TE9	Escherichia_phage	95.6	2.9e-45
BBG76404.1|637766_638060_+|transposase	IS1 family transposase InsB	transposase	U5P0U6	Shigella_phage	90.7	2.7e-44
>prophage 3
AP019189	Escherichia coli M217 DNA, complete genome	4825589	1117192	1130375	4825589		Escherichia_phage(50.0%)	12	NA	NA
BBG76857.1|1117192_1117954_+	broad specificity 5'(3')-nucleotidase and polyphosphatase	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
BBG76858.1|1117947_1118574_+	L-isoaspartate protein carboxylmethyltransferase type II	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
BBG76859.1|1118713_1119853_+	lipoprotein	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
BBG76860.1|1119915_1120908_+	RNA polymerase sigma S factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
BBG76861.1|1121001_1122366_-	transporter	NA	NA	NA	NA	NA
BBG76862.1|1122454_1123231_-	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
BBG76863.1|1123235_1123874_-	class II aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
BBG76864.1|1123870_1125133_-	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
BBG76865.1|1125129_1126038_-	dehydrogenase	NA	A0A077SLF7	Escherichia_phage	76.5	5.1e-118
BBG76866.1|1126233_1127001_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
BBG76867.1|1127051_1127708_-	serine/threonine-specific protein phosphatase 2	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
BBG76868.1|1127813_1130375_-	methyl-directed mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 4
AP019189	Escherichia coli M217 DNA, complete genome	4825589	1733256	1742699	4825589		Enterobacteria_phage(85.71%)	9	NA	NA
BBG77409.1|1733256_1734183_+	transporter subunit: ATP-binding component of ABC superfamily	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
BBG77410.1|1734187_1734919_+	ABC transporter permease	NA	NA	NA	NA	NA
BBG77411.1|1735066_1735798_-	transcriptional activator of csgD and csgBA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
BBG77412.1|1736004_1737705_+	histidine kinase	NA	B6DZC2	Enterobacteria_phage	99.5	2.4e-307
BBG77413.1|1737701_1738421_+	two-component regulatory system response regulator YehT	NA	NA	NA	NA	NA
BBG77414.1|1738467_1738938_+	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	99.4	5.2e-82
BBG77415.1|1738979_1739441_-	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
BBG77416.1|1739565_1741566_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
BBG77417.1|1741562_1742699_-	VMA domain YehL ATPase stimulator	NA	Q9EYF7	Enterobacteria_phage	97.4	5.0e-163
>prophage 5
AP019189	Escherichia coli M217 DNA, complete genome	4825589	1808839	1847728	4825589	transposase	Bacillus_phage(14.29%)	33	NA	NA
BBG77468.1|1808839_1810036_+|transposase	transposase	transposase	NA	NA	NA	NA
BBG77469.1|1810030_1810480_-	hypothetical protein	NA	NA	NA	NA	NA
BBG77470.1|1810797_1811439_+	uridine/cytidine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
BBG77471.1|1811530_1812112_+	deoxycytidine triphosphate deaminase dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
BBG77472.1|1812133_1813987_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
BBG77473.1|1814438_1817129_-	hypothetical protein	NA	A0A0R6PEZ3	Moraxella_phage	43.5	5.5e-35
BBG77474.1|1817781_1817979_+	hypothetical protein	NA	NA	NA	NA	NA
BBG77475.1|1817881_1818772_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	40.3	9.6e-45
BBG77476.1|1819047_1819866_-|transposase	IS600 transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.1	1.1e-63
BBG77477.1|1819950_1820217_-	hypothetical protein	NA	Q9MBM9	Staphylococcus_prophage	56.1	3.6e-16
BBG77478.1|1821058_1821427_-|transposase	transposase	transposase	NA	NA	NA	NA
BBG77479.1|1821962_1822283_-|transposase	IS602 transposase	transposase	NA	NA	NA	NA
BBG77480.1|1822863_1824297_+	membrane protein	NA	NA	NA	NA	NA
BBG77481.1|1824442_1825576_+	O-antigen capsule outer membrane auxiliary protein export channel	NA	NA	NA	NA	NA
BBG77482.1|1825582_1826014_+	O-antigen capsule forming protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
BBG77483.1|1826032_1828204_+	colanic acid production tyrosine-protein kinase	NA	NA	NA	NA	NA
BBG77484.1|1828218_1828722_-|transposase	IS1 family transposase InsB	transposase	U5P0U6	Shigella_phage	99.4	3.7e-94
BBG77485.1|1829063_1830014_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
BBG77486.1|1830017_1831184_+	hypothetical protein	NA	NA	NA	NA	NA
BBG77487.1|1831194_1832349_+	glycosyl transferase	NA	NA	NA	NA	NA
BBG77488.1|1832335_1833598_+	hypothetical protein	NA	NA	NA	NA	NA
BBG77489.1|1833597_1834686_+	glycosyltransferase group 1 protein	NA	NA	NA	NA	NA
BBG77490.1|1834697_1835867_+	glycosyl transferase	NA	NA	NA	NA	NA
BBG77491.1|1835876_1836644_+	hypothetical protein	NA	NA	NA	NA	NA
BBG77492.1|1836679_1838413_+	hypothetical protein	NA	A0A0A8J9B0	Klebsiella_phage	33.0	7.6e-54
BBG77493.1|1838420_1839374_+	acyltransferase/acetyltransferase	NA	NA	NA	NA	NA
BBG77494.1|1839592_1840990_+	colanic biosynthesis UDP-glucose lipid carrier transferase	NA	NA	NA	NA	NA
BBG77495.1|1841156_1842563_+	6-phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	8.0e-38
BBG77496.1|1842790_1844206_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	30.6	5.8e-52
BBG77497.1|1844228_1845599_+	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	25.6	9.3e-31
BBG77498.1|1845762_1846929_+	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	53.7	1.8e-112
BBG77499.1|1847030_1847306_+|transposase	transposase	transposase	Q71TE9	Escherichia_phage	98.9	2.0e-46
BBG77500.1|1847350_1847728_+	hypothetical protein	NA	U5P0U6	Shigella_phage	100.0	1.3e-67
>prophage 6
AP019189	Escherichia coli M217 DNA, complete genome	4825589	1864687	1893592	4825589	transposase	Stx2-converting_phage(30.0%)	33	NA	NA
BBG77519.1|1864687_1865908_-|transposase	transposase	transposase	NA	NA	NA	NA
BBG77520.1|1866003_1866477_+	DNA gyrase inhibitor	NA	NA	NA	NA	NA
BBG77521.1|1866674_1867733_+	transporter	NA	NA	NA	NA	NA
BBG77522.1|1867904_1868234_+	hypothetical protein	NA	NA	NA	NA	NA
BBG77523.1|1868334_1868601_-	hypothetical protein	NA	NA	NA	NA	NA
BBG77524.1|1869301_1869442_-	hypothetical protein	NA	NA	NA	NA	NA
BBG77525.1|1869853_1870258_+	hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
BBG77526.1|1870254_1870602_+|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
BBG77527.1|1870650_1872186_+|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
BBG77528.1|1872945_1873323_-	hypothetical protein	NA	NA	NA	NA	NA
BBG77529.1|1873412_1873781_-	hypothetical protein	NA	NA	NA	NA	NA
BBG77530.1|1873943_1874165_-	hypothetical protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
BBG77531.1|1874227_1874704_-	DNA repair protein	NA	NA	NA	NA	NA
BBG77532.1|1874719_1875193_-	hypothetical protein	NA	A9J566	Pseudomonas_phage	30.3	1.5e-12
BBG77533.1|1875534_1876353_-	hypothetical protein	NA	A0A2C9CX26	Yersinia_phage	40.1	4.2e-47
BBG77534.1|1876507_1876666_-	hypothetical protein	NA	NA	NA	NA	NA
BBG77535.1|1876736_1879523_-	AidA-I family adhesin	NA	NA	NA	NA	NA
BBG77536.1|1879746_1881288_+|transposase	transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
BBG77537.1|1881299_1882049_+|transposase	transposase	transposase	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
BBG77538.1|1882540_1883413_-	GTP-binding protein	NA	NA	NA	NA	NA
BBG77539.1|1883497_1884415_-	hypothetical protein	NA	NA	NA	NA	NA
BBG77540.1|1885614_1886217_-	hypothetical protein	NA	NA	NA	NA	NA
BBG77541.1|1886311_1886518_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
BBG77542.1|1886658_1886925_+	hypothetical protein	NA	NA	NA	NA	NA
BBG77543.1|1887261_1887402_+	haemolysin expression modulating protein	NA	NA	NA	NA	NA
BBG77544.1|1888146_1888716_+	hypothetical protein	NA	NA	NA	NA	NA
BBG77545.1|1888881_1889274_+	hypothetical protein	NA	NA	NA	NA	NA
BBG77546.1|1889283_1889706_-	hypothetical protein	NA	NA	NA	NA	NA
BBG77547.1|1889772_1890252_-	hypothetical protein	NA	NA	NA	NA	NA
BBG77548.1|1890436_1890841_+	hypothetical protein	NA	NA	NA	NA	NA
BBG77549.1|1891857_1892208_+|transposase	transposase	transposase	NA	NA	NA	NA
BBG77550.1|1892127_1892394_-	hypothetical protein	NA	Q9MBM9	Staphylococcus_prophage	56.1	6.2e-16
BBG77551.1|1893235_1893592_-|transposase	putative transposase YkgN	transposase	U5P4I9	Shigella_phage	92.5	4.4e-33
>prophage 7
AP019189	Escherichia coli M217 DNA, complete genome	4825589	2735048	2791135	4825589	terminase,lysis,tail,integrase,head,transposase,tRNA,portal	Escherichia_phage(42.86%)	64	2743285:2743299	2791237:2791251
BBG78347.1|2735048_2736200_+|tRNA	tRNA(Gln,Lys,Glu) U34 2-thiouridylase	tRNA	NA	NA	NA	NA
BBG78348.1|2736235_2736877_+	lysogenization regulator	NA	NA	NA	NA	NA
BBG78349.1|2736880_2738251_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
BBG78350.1|2738419_2739091_+	two-component regulatory system response regulator PhoP	NA	NA	NA	NA	NA
BBG78351.1|2739090_2740551_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
BBG78352.1|2740626_2741748_+	50S ribosomal protein L16 arginine hydroxylase	NA	NA	NA	NA	NA
BBG78353.1|2741796_2743023_-	peptidase T	NA	NA	NA	NA	NA
BBG78354.1|2743078_2743294_+	hypothetical protein	NA	NA	NA	NA	NA
2743285:2743299	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
BBG78355.1|2743290_2744409_+	spermidine/putrescine ABC transporter ATPase	NA	Q6GZ03	Mycoplasma_phage	39.8	5.4e-29
BBG78356.1|2744392_2745256_+	spermidine/putrescine ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
BBG78357.1|2745822_2746479_+	hypothetical protein	NA	NA	NA	NA	NA
BBG78358.1|2746716_2746968_-	hypothetical protein	NA	A0A2D1UII2	Escherichia_phage	96.4	2.3e-36
BBG78359.1|2747248_2747575_+|transposase	transposase	transposase	Q6H9S4	Enterobacteria_phage	97.2	2.4e-54
BBG78360.1|2747574_2748054_+|transposase	transposase	transposase	Q6H9S3	Enterobacteria_phage	100.0	1.4e-74
BBG78361.1|2748660_2750169_+	reverse transcriptase-like protein	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
BBG78362.1|2750360_2750732_+|transposase	IS629 transposase	transposase	Q6H9S3	Enterobacteria_phage	99.2	1.6e-65
BBG78363.1|2750734_2754058_-	hypothetical protein	NA	A0A2D1UII2	Escherichia_phage	87.5	0.0e+00
BBG78364.1|2754122_2754722_-	outer membrane precursor Lom	NA	H6WZM8	Escherichia_phage	95.0	1.6e-107
BBG78365.1|2754789_2758269_-	phage host specificity protein	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
BBG78366.1|2758329_2758977_-|tail	phage tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.4	2.6e-108
BBG78367.1|2758874_2759510_-|tail	phage tail assembly protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.5e-127
BBG78368.1|2759623_2760322_-|tail	phage minor tail protein	tail	A0A1B5FP81	Escherichia_phage	97.0	3.4e-130
BBG78369.1|2760321_2760663_-|tail	phage minor tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.4	1.2e-40
BBG78370.1|2760655_2763883_-|tail	phage tail length tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
BBG78371.1|2763929_2764220_-|tail	phage minor tail protein	tail	A0A1B5FP87	Escherichia_phage	95.7	7.2e-42
BBG78372.1|2764231_2764603_-|tail	phage minor tail protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
BBG78373.1|2764617_2765322_-|tail	phage major tail subunit	tail	A0A1B5FP82	Escherichia_phage	92.7	1.4e-112
BBG78374.1|2765382_2765727_-|tail	phage minor tail protein	tail	A0A1B5FP84	Escherichia_phage	96.5	5.1e-55
BBG78375.1|2765723_2766170_-|tail	phage minor tail protein	tail	S4TR46	Salmonella_phage	81.1	2.3e-63
BBG78376.1|2766169_2766508_-|head,tail	phage head-tail adaptor	head,tail	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
BBG78377.1|2766516_2766834_-	phage DNA packaging protein	NA	A0A1W6JNZ5	Morganella_phage	49.5	5.3e-22
BBG78378.1|2766910_2768128_-|head	major head protein	head	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
BBG78379.1|2768142_2768559_-	hypothetical protein	NA	Q8SBH9	Shigella_phage	83.3	7.6e-61
BBG78380.1|2768733_2769960_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.3	3.7e-204
BBG78381.1|2770107_2771865_-|terminase	phage terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
BBG78382.1|2771864_2772347_-|terminase	phage terminase small subunit	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
BBG78383.1|2772724_2772874_-	hypothetical protein	NA	NA	NA	NA	NA
BBG78384.1|2773370_2773664_+	Bor protein precursor	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
BBG78385.1|2773695_2774157_-	phage murein endopeptidase	NA	A0A0K2FJD0	Enterobacteria_phage	87.6	9.6e-65
BBG78386.1|2774153_2774687_-	phage endolysin	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
BBG78387.1|2774750_2775101_-	hypothetical protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
BBG78388.1|2775105_2775321_-|lysis	phage lysis protein	lysis	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
BBG78389.1|2775470_2775632_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	87.0	5.9e-14
BBG78390.1|2775628_2775832_-	hypothetical protein	NA	H6WZJ9	Escherichia_phage	95.2	7.7e-27
BBG78391.1|2776077_2776413_+	RpoS stabilzer during Mg starvation	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
BBG78392.1|2777665_2778487_-	phage antitermination protein Q	NA	K7P7B9	Enterobacteria_phage	58.2	5.1e-77
BBG78393.1|2778483_2778864_-	phage endonuclease RUS	NA	V5URS4	Shigella_phage	63.6	1.3e-35
BBG78394.1|2778864_2779923_-	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
BBG78395.1|2780370_2780526_-	small toxic polypeptide	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
BBG78396.1|2781448_2781625_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	94.8	6.7e-27
BBG78397.1|2781617_2781800_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
BBG78398.1|2781893_2782250_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
BBG78399.1|2782307_2782730_-	phage exclusion protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
BBG78400.1|2782770_2783841_-	phage replication protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
BBG78401.1|2783912_2784338_-	hypothetical protein	NA	NA	NA	NA	NA
BBG78402.1|2784321_2784564_-	phage antirepressor protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
BBG78403.1|2784655_2785294_+	phage repressor protein	NA	H9C160	Pectobacterium_phage	26.7	8.7e-16
BBG78404.1|2785647_2785947_+	hypothetical protein	NA	NA	NA	NA	NA
BBG78405.1|2786018_2786237_+	hypothetical protein	NA	NA	NA	NA	NA
BBG78406.1|2786805_2786994_+	hypothetical protein	NA	NA	NA	NA	NA
BBG78407.1|2786990_2787182_+	hypothetical protein	NA	NA	NA	NA	NA
BBG78408.1|2787275_2789717_+	exodeoxyribonuclease VIII	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
BBG78409.1|2789778_2790048_+	phage excisionase	NA	NA	NA	NA	NA
BBG78410.1|2790016_2791135_+|integrase	integrase	integrase	Q77Z04	Phage_21	44.4	1.6e-84
2791237:2791251	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 8
AP019189	Escherichia coli M217 DNA, complete genome	4825589	3364209	3386076	4825589	transposase	Macacine_betaherpesvirus(18.18%)	21	NA	NA
BBG78933.1|3364209_3365328_-|transposase	IS186 transposase	transposase	NA	NA	NA	NA
BBG78934.1|3365398_3365551_-	protein HokE	NA	NA	NA	NA	NA
BBG78935.1|3365648_3366500_-|transposase	IS150 transposase B	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	7.8e-113
BBG78936.1|3366496_3367018_-|transposase	IS150 transposase A	transposase	A0A2I6AZV8	Macacine_betaherpesvirus	100.0	2.7e-92
BBG78937.1|3367449_3368568_+	weak gamma-glutamyl:cysteine ligase	NA	NA	NA	NA	NA
BBG78938.1|3368705_3369410_+|transposase	IS26 transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
BBG78939.1|3369494_3369857_+	hypothetical protein	NA	NA	NA	NA	NA
BBG78940.1|3369942_3370434_-	hypothetical protein	NA	NA	NA	NA	NA
BBG78941.1|3370604_3370856_-	DNA-binding protein	NA	A0A2I7S995	Vibrio_phage	65.7	8.1e-18
BBG78942.1|3371150_3371279_-	hypothetical protein	NA	NA	NA	NA	NA
BBG78943.1|3371460_3372429_+|transposase	IS4 transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	1.0e-185
BBG78944.1|3372646_3374728_-	hypothetical protein	NA	A0A2K9L4U1	Tupanvirus	27.7	2.5e-19
BBG78945.1|3374731_3375922_-	hypothetical protein	NA	NA	NA	NA	NA
BBG78946.1|3375969_3377124_-	glycosyl transferase wbdM	NA	NA	NA	NA	NA
BBG78947.1|3377133_3378213_-	glycosyl transferase	NA	NA	NA	NA	NA
BBG78948.1|3378230_3378983_-	lipopolysaccharide transport system ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.4	1.1e-12
BBG78949.1|3379765_3381982_-	hypothetical protein	NA	NA	NA	NA	NA
BBG78950.1|3382015_3383032_-	UDP-galactose-4-epimerase	NA	A0A2K9L5H6	Tupanvirus	47.6	9.1e-84
BBG78951.1|3383476_3384370_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	40.3	3.3e-45
BBG78952.1|3384534_3385332_-	hypothetical protein	NA	A0A291LBB9	Klebsiella_phage	41.7	7.8e-14
BBG78953.1|3385371_3386076_-|transposase	IS26 transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 9
AP019189	Escherichia coli M217 DNA, complete genome	4825589	3709174	3736669	4825589	transposase,integrase,protease	Escherichia_phage(55.56%)	23	3726056:3726071	3745700:3745715
BBG79245.1|3709174_3709525_-|transposase	IS911 transposase	transposase	Q716C1	Shigella_phage	98.9	1.8e-39
BBG79246.1|3709594_3709888_-	hypothetical protein	NA	NA	NA	NA	NA
BBG79247.1|3709976_3712847_-	PstII restriction-modification enzyme Res subunit	NA	NA	NA	NA	NA
BBG79248.1|3712849_3714478_-	adenine-specific DNA-methyltransferase	NA	A0A0K1LNZ9	Escherichia_phage	42.2	2.3e-84
BBG79249.1|3714487_3716758_-|protease	serine protease	protease	NA	NA	NA	NA
BBG79250.1|3716884_3717865_-	AAA family ATPase	NA	A0A1B2RW50	Lymphocystis_disease_virus	30.2	5.5e-17
BBG79251.1|3717890_3720740_-	Helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	39.6	2.9e-183
BBG79252.1|3721016_3721211_+	hypothetical protein	NA	NA	NA	NA	NA
BBG79253.1|3721138_3721624_+	hypothetical protein	NA	NA	NA	NA	NA
BBG79254.1|3721745_3721931_-	hypothetical protein	NA	NA	NA	NA	NA
BBG79255.1|3722005_3722407_+	hypothetical protein	NA	NA	NA	NA	NA
BBG79256.1|3722394_3722829_+	hypothetical protein	NA	NA	NA	NA	NA
BBG79257.1|3723802_3724162_-|transposase	IS1nuxi transposase	transposase	A0A0U2RK18	Escherichia_phage	95.3	4.5e-54
BBG79258.1|3724188_3724461_-|transposase	transposase	transposase	A0A0U2RK18	Escherichia_phage	97.6	4.6e-43
BBG79259.1|3724713_3726183_+	arginine/agmatine antiporter	NA	NA	NA	NA	NA
3726056:3726071	attL	GGGCAAGAAAAAAAGA	NA	NA	NA	NA
BBG79260.1|3726287_3728657_+	arginine decarboxylase	NA	NA	NA	NA	NA
BBG79261.1|3728731_3730231_+	arginine/agmatine antiporter	NA	NA	NA	NA	NA
BBG79262.1|3730373_3730649_+|transposase	IS1 family transposase InsA	transposase	Q71TE9	Escherichia_phage	93.4	6.6e-45
BBG79263.1|3730693_3730885_+	hypothetical protein	NA	Q71TF0	Escherichia_phage	83.6	2.2e-23
BBG79264.1|3731263_3732241_-	hypothetical protein	NA	NA	NA	NA	NA
BBG79265.1|3732311_3734018_-	hypothetical protein	NA	NA	NA	NA	NA
BBG79266.1|3734010_3735219_-	hypothetical protein	NA	NA	NA	NA	NA
BBG79267.1|3735460_3736669_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	56.5	7.7e-130
3745700:3745715	attR	GGGCAAGAAAAAAAGA	NA	NA	NA	NA
>prophage 10
AP019189	Escherichia coli M217 DNA, complete genome	4825589	4013692	4021631	4825589	transposase	Macacine_betaherpesvirus(33.33%)	7	NA	NA
BBG79506.1|4013692_4014859_-	pH-dependent sodium/proton antiporter	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	7.5e-90
BBG79507.1|4015421_4015943_+|transposase	IS150 transposase A	transposase	A0A2I6AZV8	Macacine_betaherpesvirus	100.0	2.7e-92
BBG79508.1|4015939_4016791_+|transposase	IS150 transposase B	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	7.8e-113
BBG79509.1|4016890_4017043_+	hypothetical protein	NA	A0A0U2QV81	Escherichia_phage	78.0	1.6e-13
BBG79510.1|4017114_4018233_+|transposase	IS186 transposase	transposase	NA	NA	NA	NA
BBG79511.1|4018495_4019626_-	chaperone Hsp40	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	3.6e-28
BBG79512.1|4019714_4021631_-	chaperone Hsp70	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
>prophage 11
AP019189	Escherichia coli M217 DNA, complete genome	4825589	4087464	4115520	4825589	transposase	Escherichia_phage(30.0%)	30	NA	NA
BBG79577.1|4087464_4087674_-|transposase	transposase	transposase	U5P0U6	Shigella_phage	100.0	4.4e-33
BBG79578.1|4087885_4088110_-|transposase	IS1 family transposase InsA	transposase	A0A2L1IV22	Escherichia_phage	97.3	1.2e-36
BBG79579.1|4088475_4089708_+	multidrug efflux system protein	NA	NA	NA	NA	NA
BBG79580.1|4089748_4091029_+	zinc-type alcohol dehydrogenase-like protein	NA	NA	NA	NA	NA
BBG79581.1|4091144_4092296_+	2-hydroxyglutaryl-CoA dehydratase	NA	NA	NA	NA	NA
BBG79582.1|4092305_4093073_+	activator of (R)-hydroxyglutaryl-CoA dehydratase	NA	NA	NA	NA	NA
BBG79583.1|4093069_4093327_+	hypothetical protein	NA	NA	NA	NA	NA
BBG79584.1|4093391_4094252_+	hypothetical protein	NA	NA	NA	NA	NA
BBG79585.1|4094319_4095498_+	transport protein	NA	NA	NA	NA	NA
BBG79586.1|4095510_4096065_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
BBG79587.1|4096313_4096997_+	nucleoside recognition pore and gate family inner membrane transporter	NA	NA	NA	NA	NA
BBG79588.1|4096993_4097455_+	SpmB family inner membrane protein	NA	NA	NA	NA	NA
BBG79589.1|4097467_4098640_+	isoaspartyl dipeptidase	NA	NA	NA	NA	NA
BBG79590.1|4098704_4099616_+	hypochlorite-responsive transcription factor	NA	NA	NA	NA	NA
BBG79591.1|4099608_4099860_-	hypothetical protein	NA	NA	NA	NA	NA
BBG79592.1|4100783_4101362_+	hypothetical protein	NA	NA	NA	NA	NA
BBG79593.1|4101599_4102373_-	fructuronate-inducible hexuronate regulon transcriptional repressor	NA	NA	NA	NA	NA
BBG79594.1|4102587_4104048_-	NAD-dependent D-mannonate oxidoreductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.4	1.4e-48
BBG79595.1|4104128_4105313_-	mannonate hydrolase	NA	NA	NA	NA	NA
BBG79596.1|4105652_4106996_+	fructuronate transporter	NA	NA	NA	NA	NA
BBG79597.1|4107394_4107670_+|transposase	transposase	transposase	Q71TE9	Escherichia_phage	97.8	1.7e-45
BBG79598.1|4107714_4108092_+|transposase	IS1 family transposase InsB	transposase	Q71TF0	Escherichia_phage	100.0	1.3e-67
BBG79599.1|4109297_4110014_+	N-acetylneuraminic acid outer membrane channel protein	NA	NA	NA	NA	NA
BBG79600.1|4110033_4111140_+	N-acetylneuraminic acid mutarotase	NA	NA	NA	NA	NA
BBG79601.1|4111756_4112185_+	hypothetical protein	NA	Q9EYC8	Enterobacteria_phage	46.7	1.4e-25
BBG79602.1|4112674_4112833_+	hypothetical protein	NA	NA	NA	NA	NA
BBG79603.1|4113145_4113313_+	hypothetical protein	NA	NA	NA	NA	NA
BBG79604.1|4113360_4113741_+	hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
BBG79605.1|4113737_4114085_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	99.1	6.3e-61
BBG79606.1|4114134_4115520_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.1	1.9e-257
>prophage 12
AP019189	Escherichia coli M217 DNA, complete genome	4825589	4118886	4170293	4825589	integrase,capsid,transposase,tRNA,holin	Enterobacteria_phage(23.08%)	52	4150806:4150820	4164278:4164292
BBG79610.1|4118886_4119096_-|transposase	transposase	transposase	U5P0U6	Shigella_phage	100.0	4.4e-33
BBG79611.1|4119096_4119282_-	hypothetical protein	NA	Q71TF0	Escherichia_phage	85.2	7.3e-24
BBG79612.1|4119308_4119533_-|transposase	IS1 family transposase InsA	transposase	A0A2L1IV22	Escherichia_phage	97.3	1.2e-36
BBG79613.1|4119875_4120397_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
BBG79614.1|4120393_4121347_+	anti-sigma transmembrane signal transducer for ferric citrate transport	NA	NA	NA	NA	NA
BBG79615.1|4121433_4123758_+	TonB-dependent outer membrane ferric citrate transporter and signal transducer	NA	NA	NA	NA	NA
BBG79616.1|4123802_4124705_+	ferric citrate ABC transporter periplasmic binding protein	NA	NA	NA	NA	NA
BBG79617.1|4124701_4125700_+	ferric citrate ABC transporter permease	NA	NA	NA	NA	NA
BBG79618.1|4125696_4126653_+	ferric citrate ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
BBG79619.1|4126653_4127421_+	ferric citrate ABC transporter ATPase	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
BBG79620.1|4127978_4128236_-	hypothetical protein	NA	NA	NA	NA	NA
BBG79621.1|4128886_4130395_-	reverse transcriptase-like protein	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
BBG79622.1|4131001_4131481_-|transposase	transposase	transposase	Q6H9S3	Enterobacteria_phage	100.0	1.4e-74
BBG79623.1|4131480_4131807_-|transposase	transposase	transposase	Q6H9S4	Enterobacteria_phage	97.2	2.4e-54
BBG79624.1|4131981_4132275_+|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	99.0	5.2e-48
BBG79625.1|4132325_4132544_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
BBG79626.1|4132610_4132910_+|transposase	IS3 family transposase OrfA	transposase	NA	NA	NA	NA
BBG79627.1|4132906_4133773_+|transposase	IS3 family transposase OrfB	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	1.1e-50
BBG79628.1|4134052_4135330_-	hypothetical protein	NA	NA	NA	NA	NA
BBG79629.1|4135392_4137396_-|holin	choline transporter of high affinity	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.5e-21
BBG79630.1|4137543_4138683_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.5e-68
BBG79631.1|4138863_4139517_-	hypothetical protein	NA	NA	NA	NA	NA
BBG79632.1|4139872_4140391_-	hypothetical protein	NA	NA	NA	NA	NA
BBG79633.1|4140827_4141340_-	hypothetical protein	NA	NA	NA	NA	NA
BBG79634.1|4141918_4142644_-	polysaccharide deacetylase Ecf1	NA	NA	NA	NA	NA
BBG79635.1|4142946_4143249_+|transposase	IS911 transposase	transposase	Q716C1	Shigella_phage	96.5	1.2e-36
BBG79636.1|4143466_4143730_+	hypothetical protein	NA	Q716C2	Shigella_phage	97.0	4.2e-33
BBG79637.1|4144336_4145845_+	reverse transcriptase-like protein	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
BBG79638.1|4146036_4146408_+|transposase	IS629 transposase	transposase	Q6H9S3	Enterobacteria_phage	99.2	1.6e-65
BBG79639.1|4146638_4147190_-	hypothetical protein	NA	B7SYF8	Stenotrophomonas_phage	40.6	2.3e-28
BBG79640.1|4147249_4147552_-	hypothetical protein	NA	Q7M297	Enterobacteria_phage	50.5	1.9e-21
BBG79641.1|4148006_4148939_-	RNA-directed DNA polymerase	NA	Q7M2A9	Enterobacteria_phage	29.4	1.8e-25
BBG79642.1|4148940_4149927_-	hypothetical protein	NA	NA	NA	NA	NA
BBG79643.1|4150554_4150827_-	transcription activator	NA	A0A2I8TV89	Erwinia_phage	44.9	6.3e-08
4150806:4150820	attL	ATTCCGGACATTTAA	NA	NA	NA	NA
BBG79644.1|4150832_4151384_-	phage polarity suppression protein	NA	NA	NA	NA	NA
BBG79645.1|4151380_4152124_-|capsid	phage capsid size determining protein	capsid	NA	NA	NA	NA
BBG79646.1|4152524_4155197_-	phage DNA replication protein	NA	A0A1B0VP75	Pseudomonas_phage	34.6	4.1e-59
BBG79647.1|4155193_4155577_-	hypothetical protein	NA	NA	NA	NA	NA
BBG79648.1|4155573_4155858_-	hypothetical protein	NA	NA	NA	NA	NA
BBG79649.1|4155889_4156249_-	hypothetical protein	NA	NA	NA	NA	NA
BBG79650.1|4156605_4156791_+	hypothetical protein	NA	NA	NA	NA	NA
BBG79651.1|4156887_4157118_-	hypothetical phage protein	NA	NA	NA	NA	NA
BBG79652.1|4157495_4158134_-	hypothetical protein	NA	NA	NA	NA	NA
BBG79653.1|4158163_4159426_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	35.6	2.4e-65
BBG79654.1|4159870_4160890_+	alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	8.4e-45
BBG79655.1|4161017_4162520_+	hypothetical protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	1.4e-83
BBG79656.1|4162680_4163763_-	lipopolysaccharide export ABC permease	NA	NA	NA	NA	NA
BBG79657.1|4163762_4164770_-	lipopolysaccharide export ABC permease	NA	NA	NA	NA	NA
4164278:4164292	attR	TTAAATGTCCGGAAT	NA	NA	NA	NA
BBG79658.1|4165129_4166641_+	multifunctional aminopeptidase A	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
BBG79659.1|4166676_4166910_+	hypothetical protein	NA	NA	NA	NA	NA
BBG79660.1|4166994_4167438_+	DNA polymerase III chi subunit HolC	NA	NA	NA	NA	NA
BBG79661.1|4167437_4170293_+|tRNA	valyl-tRNA synthetase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
>prophage 13
AP019189	Escherichia coli M217 DNA, complete genome	4825589	4505445	4603350	4825589	terminase,protease,tail,integrase,capsid,transposase,tRNA,portal,plate,holin	Escherichia_phage(47.27%)	103	4515145:4515180	4612235:4612270
BBG79958.1|4505445_4506546_+|tRNA	tRNA m(5)U54 methyltransferase	tRNA	NA	NA	NA	NA
BBG79959.1|4506585_4506945_-	inner membrane protein	NA	NA	NA	NA	NA
BBG79960.1|4506944_4507592_-	transcriptional repressor	NA	NA	NA	NA	NA
BBG79961.1|4507925_4509326_+	pyridine nucleotide transhydrogenase	NA	NA	NA	NA	NA
BBG79962.1|4509308_4510226_-	oxidative and nitrosative stress transcriptional regulator	NA	NA	NA	NA	NA
BBG79963.1|4510492_4511866_-	argininosuccinate lyase	NA	NA	NA	NA	NA
BBG79964.1|4511926_4512700_-	acetylglutamate kinase	NA	NA	NA	NA	NA
BBG79965.1|4512710_4513715_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
BBG79966.1|4513868_4515020_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
4515145:4515180	attL	CCGTAGGCCGGATAAGGCGCTCGCGCCGCATCCGGC	NA	NA	NA	NA
BBG79967.1|4515617_4518269_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
BBG79968.1|4518450_4520184_+	LPS heptose I phosphoethanolamine transferase	NA	NA	NA	NA	NA
BBG79969.1|4520398_4521250_+	AraC family transcriptional activator	NA	NA	NA	NA	NA
BBG79970.1|4521236_4521578_-	enzyme IIB component of PTS	NA	NA	NA	NA	NA
BBG79971.1|4521579_4522458_-	formate lyase II activase	NA	NA	NA	NA	NA
BBG79972.1|4522423_4524721_-	glycine radical domain-containing pyruvate formate-lyase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
BBG79973.1|4524771_4525092_-	enzyme IIB component of PTS	NA	NA	NA	NA	NA
BBG79974.1|4525106_4526186_-	enzyme IIC component of PTS	NA	NA	NA	NA	NA
BBG79975.1|4526494_4528996_+	PTS fructose transporter subunit IIA	NA	A0A1V0SGR7	Hokovirus	26.9	7.9e-12
BBG79976.1|4529007_4529670_+	fructose-6-phosphate aldolase 2	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
BBG79977.1|4529680_4530784_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
BBG79978.1|4531058_4531676_+	hypothetical protein	NA	NA	NA	NA	NA
BBG79979.1|4531702_4532608_-	hypothetical protein	NA	NA	NA	NA	NA
BBG79980.1|4532700_4534881_-	catalase-peroxidase HPI	NA	NA	NA	NA	NA
BBG79981.1|4535209_4536100_-	5,10-methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
BBG79982.1|4536448_4538881_-	aspartokinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
BBG79983.1|4538883_4540044_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
BBG79984.1|4540320_4540638_+	Met repressor	NA	NA	NA	NA	NA
BBG79985.1|4540821_4541430_+	lipid binding hydrolase	NA	NA	NA	NA	NA
BBG79986.1|4541490_4541703_-	50S ribosomal subunit protein L31	NA	NA	NA	NA	NA
BBG79987.1|4541905_4544104_+	primosome assembly protein PriA	NA	NA	NA	NA	NA
BBG79988.1|4544259_4545285_+	transcriptional regulator	NA	NA	NA	NA	NA
BBG79989.1|4545481_4546336_+	cell division protein FtsN	NA	NA	NA	NA	NA
BBG79990.1|4546428_4546959_+|protease	peptidase component of the HslUV protease	protease	NA	NA	NA	NA
BBG79991.1|4546968_4548300_+|protease	molecular chaperone and ATPase component of HslUV protease	protease	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
BBG79992.1|4548366_4549293_+	1,4-dihydroxy-2-naphthoate octaprenyltransferase	NA	NA	NA	NA	NA
BBG79993.1|4549385_4549871_+	ribonuclease E inhibitor protein	NA	NA	NA	NA	NA
BBG79994.1|4549955_4550195_-	cell division protein ZapB	NA	NA	NA	NA	NA
BBG79995.1|4550625_4551471_+	glycerol facilitator	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
BBG79996.1|4551472_4553002_+	glycerol kinase	NA	NA	NA	NA	NA
BBG79997.1|4553007_4554147_+	fructose 1,6-bisphosphatase II	NA	NA	NA	NA	NA
BBG79998.1|4554243_4554990_+	ferredoxin-NADP reductase	NA	NA	NA	NA	NA
BBG79999.1|4554994_4555423_-	universal stress protein UspD	NA	NA	NA	NA	NA
BBG80000.1|4555449_4555749_-	hypothetical protein	NA	NA	NA	NA	NA
BBG80001.1|4555960_4556401_-	inner membrane protein	NA	NA	NA	NA	NA
BBG80002.1|4556501_4557101_+	hypothetical protein	NA	NA	NA	NA	NA
BBG80003.1|4557208_4557976_+	triosephosphate isomerase	NA	NA	NA	NA	NA
BBG80004.1|4558030_4558786_-	CDP-diacylglycerol phosphotidylhydrolase	NA	NA	NA	NA	NA
BBG80005.1|4558892_4559882_-	sulfate transporter subunit	NA	NA	NA	NA	NA
BBG80006.1|4560201_4561164_-	6-phosphofructokinase I	NA	NA	NA	NA	NA
BBG80007.1|4561344_4562247_-	ferrous iron and zinc transporter	NA	NA	NA	NA	NA
BBG80008.1|4562454_4563096_-	hypothetical protein	NA	NA	NA	NA	NA
BBG80009.1|4563240_4564092_-|transposase	IS150 transposase B	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	7.8e-113
BBG80010.1|4564088_4564610_-|transposase	IS150 transposase A	transposase	A0A2I6AZV8	Macacine_betaherpesvirus	100.0	2.7e-92
BBG80011.1|4564982_4566146_-	phage late gene regulator	NA	U5N3V4	Enterobacteria_phage	99.5	4.8e-206
BBG80012.1|4566145_4566625_-|tail	phage tail assembly protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
BBG80013.1|4566639_4569087_-|tail	phage tail protein	tail	M1T2S3	Escherichia_phage	95.2	0.0e+00
BBG80014.1|4569231_4569507_-	hypothetical protein	NA	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
BBG80015.1|4569563_4570082_-|tail	phage tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
BBG80016.1|4570094_4571285_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	3.7e-225
BBG80017.1|4571344_4571890_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	95.6	4.0e-94
BBG80018.1|4571954_4573490_-|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
BBG80019.1|4573538_4573886_-|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
BBG80020.1|4573882_4574287_-	hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
BBG80021.1|4574428_4574944_+|tail	phage tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	56.8	5.0e-46
BBG80022.1|4574943_4575561_+|tail	phage tail fiber assembly protein	tail	M1SV83	Escherichia_phage	75.5	3.4e-81
BBG80023.1|4575532_4575949_-|tail	phage tail fiber assembly protein	tail	B6SCW7	Bacteriophage	46.0	3.4e-21
BBG80024.1|4575951_4577247_-|tail	phage variable tail fibre protein	tail	A0A0F7LBW5	Escherichia_phage	96.8	1.6e-141
BBG80025.1|4577243_4577855_-|tail	phage tail protein	tail	A0A0F7LA36	Escherichia_phage	99.5	1.4e-116
BBG80026.1|4577847_4578756_-|plate	phage baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	3.7e-161
BBG80027.1|4578760_4579108_-|plate	phage baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	3.8e-58
BBG80028.1|4579104_4579740_-|plate	phage baseplate assembly protein	plate	U5N3F0	Enterobacteria_phage	98.1	2.5e-111
BBG80029.1|4579806_4580259_-|tail	phage tail completion protein	tail	A0A0F7LDR6	Escherichia_phage	97.3	4.5e-75
BBG80030.1|4580251_4580719_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	3.3e-81
BBG80031.1|4580681_4580840_-	hypothetical protein	NA	M1RZ27	Escherichia_phage	100.0	2.6e-22
BBG80032.1|4580826_4581252_-	hypothetical protein	NA	A0A0F7L9Y0	Escherichia_phage	94.3	1.3e-63
BBG80033.1|4581239_4581665_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	92.9	3.7e-55
BBG80034.1|4581679_4582177_-	phage lysozyme	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.5e-92
BBG80035.1|4582176_4582458_-|holin	phage holin protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
BBG80036.1|4582461_4582665_-|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	98.5	2.6e-30
BBG80037.1|4582664_4583138_-|capsid	phage capsid completion protein	capsid	U5N0S3	Enterobacteria_phage	99.4	9.5e-84
BBG80038.1|4583273_4584017_-|terminase	phage terminase small subunit	terminase	Q94MJ2	Enterobacteria_phage	96.4	4.6e-125
BBG80039.1|4584020_4585094_-|capsid	phage major capsid protein	capsid	Q94MI3	Enterobacteria_phage	98.9	2.2e-200
BBG80040.1|4585152_4586007_-	phage scaffolding protein	NA	Q778Z1	Enterobacteria_phage	99.6	1.7e-136
BBG80041.1|4586180_4587953_+|terminase	phage terminase large subunit	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
BBG80042.1|4587952_4588987_+|portal	phage portal protein	portal	U5N087	Enterobacteria_phage	99.1	1.6e-200
BBG80043.1|4589025_4589235_-	hypothetical protein	NA	M1TAP7	Escherichia_phage	83.0	2.7e-14
BBG80044.1|4589358_4591842_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
BBG80045.1|4592081_4592855_-	hypothetical protein	NA	Q858T4	Yersinia_virus	93.0	2.1e-133
BBG80046.1|4593159_4593909_-|transposase	transposase	transposase	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
BBG80047.1|4593920_4595462_-|transposase	transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
BBG80048.1|4595576_4596947_-	hypothetical protein	NA	A0A0F7LA09	Escherichia_phage	99.5	1.3e-255
BBG80049.1|4596936_4597212_-	hypothetical protein	NA	A0A0F7LCM4	Escherichia_phage	100.0	2.3e-45
BBG80050.1|4597208_4597433_-	TraR family phage/conjugal plasmid C-4 type zinc finger protein	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
BBG80051.1|4597432_4597735_-	hypothetical protein	NA	A0A0F7LDT6	Escherichia_phage	96.0	2.5e-45
BBG80052.1|4597734_4597959_-	hypothetical protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
BBG80053.1|4598022_4598523_-	replication protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
BBG80054.1|4598519_4598690_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
BBG80055.1|4598692_4598965_-	regulatory protein Cox	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
BBG80056.1|4599101_4599395_+	repressor protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
BBG80057.1|4599464_4600445_+|integrase	integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
BBG80058.1|4600631_4601132_-	inhibitor of the cpx response periplasmic adaptor protein	NA	NA	NA	NA	NA
BBG80059.1|4601281_4601980_+	two-component regulatory system response regulator CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
BBG80060.1|4601976_4603350_+	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
4612235:4612270	attR	GCCGGATGCGGCGCGAGCGCCTTATCCGGCCTACGG	NA	NA	NA	NA
>prophage 1
AP018147	Escherichia coli plasmid pM217_FII DNA, complete genome, isolate: M217	102071	3429	48930	102071	transposase,integrase	Escherichia_phage(28.57%)	53	NA	NA
BAX83942.1|3429_4134_-|transposase	IS26 transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
BAX83943.1|4145_5627_-	InsE protein	NA	NA	NA	NA	NA
BAX83944.1|5853_6195_-	Chaperonin	NA	NA	NA	NA	NA
BAX83945.1|6155_6605_-	Uncharacterized protein	NA	NA	NA	NA	NA
BAX83946.1|7234_7972_-	erythromycin resistance protein	NA	E4ZFQ0	Streptococcus_phage	99.6	6.3e-135
BAX83947.1|8327_9032_+|transposase	IS26 transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
BAX83948.1|9153_10068_+	macrolide 2'-phosphotransferase I	NA	NA	NA	NA	NA
BAX83949.1|10064_11303_+	Mrx protein	NA	NA	NA	NA	NA
BAX83950.1|11302_11887_+	MphR(A) protein	NA	NA	NA	NA	NA
BAX83951.1|12379_13174_-|transposase	transposase of IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.5e-86
BAX83952.1|13183_13411_-|transposase	transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	1.1e-34
BAX83953.1|13445_14003_+	Tn3 resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
BAX83954.1|14185_15046_+	beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
BAX83955.1|15215_15971_+	RmtB protein	NA	NA	NA	NA	NA
BAX83956.1|16051_16600_-	sodium/proton antiporter, CPA1 family	NA	NA	NA	NA	NA
BAX83957.1|16635_17013_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	58.1	8.2e-22
BAX83958.1|17206_17911_-|transposase	IS26 transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
BAX83959.1|18174_18369_+|transposase	transposase	transposase	NA	NA	NA	NA
BAX83960.1|18469_19282_+	NDM-5	NA	NA	NA	NA	NA
BAX83961.1|19285_19651_+	bleomycin resistance protein	NA	NA	NA	NA	NA
BAX83962.1|19655_20294_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
BAX83963.1|20304_21336_-	oxidoreductase domain protein	NA	NA	NA	NA	NA
BAX83964.1|21648_23190_-|transposase	transposase	transposase	NA	NA	NA	NA
BAX83965.1|23594_24434_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
BAX83966.1|24427_24775_-	QacEdelta1	NA	NA	NA	NA	NA
BAX83967.1|24938_25718_-	aminoglycoside resistance protein	NA	NA	NA	NA	NA
BAX83968.1|26137_26635_-	dihydrofolate reductase	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
BAX83969.1|26779_27667_+	IntI1	NA	A0A1P8DJJ6	Virus_Rctr41k	42.2	9.2e-56
BAX83970.1|27700_28405_-|transposase	IS26 transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
BAX83971.1|28455_29985_+|transposase	transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	1.4e-293
BAX83972.1|30053_30938_+	Putative uncharacterized protein	NA	NA	NA	NA	NA
BAX83973.1|31448_34124_-	Uncharacterized protein	NA	NA	NA	NA	NA
BAX83974.1|34426_35428_+	hypothetical protein	NA	NA	NA	NA	NA
BAX83975.1|35652_36063_-	Uncharacterized protein	NA	E5AGG6	Erwinia_phage	54.8	2.9e-28
BAX83976.1|36223_36577_-	stable plasmid inheritance protein B	NA	NA	NA	NA	NA
BAX83977.1|36576_37539_-	plasmid segregation protein	NA	A0A222YXF2	Escherichia_phage	53.9	2.4e-94
BAX83978.1|38055_38739_+	DNA methylase family protein	NA	A0A2I7RE86	Vibrio_phage	38.2	3.3e-29
BAX83979.1|38739_38961_+	YfcA protein	NA	NA	NA	NA	NA
BAX83980.1|38973_39408_+	YcgB protein	NA	NA	NA	NA	NA
BAX83981.1|39452_40223_+	YchA protein	NA	NA	NA	NA	NA
BAX83982.1|40280_40502_-	Uncharacterized protein	NA	NA	NA	NA	NA
BAX83983.1|40582_41008_+	antirestriction protein	NA	NA	NA	NA	NA
BAX83984.1|41054_41477_+	YcjA protein	NA	NA	NA	NA	NA
BAX83985.1|41473_41665_+	YffA protein	NA	NA	NA	NA	NA
BAX83986.1|42016_42439_-	Uncharacterized protein	NA	NA	NA	NA	NA
BAX83987.1|42699_42930_+	YdaB protein	NA	NA	NA	NA	NA
BAX83988.1|42981_44343_+	YdbA protein	NA	NA	NA	NA	NA
BAX83989.1|44390_44954_+	YdcA protein	NA	A8HNV9	Thalassomonas_phage	37.3	1.0e-20
BAX83990.1|44979_45198_+	Uncharacterized protein	NA	NA	NA	NA	NA
BAX83991.1|46298_46868_-	Caspase domain protein	NA	NA	NA	NA	NA
BAX83992.1|46852_47692_-|transposase	insertion element IS2 transposase InsD	transposase	Q9ZXG3	Shigella_phage	98.6	4.0e-162
BAX83993.1|47715_48081_-	insertion sequence 2 OrfA protein	NA	Q76S41	Shigella_phage	100.0	9.6e-60
BAX83994.1|48186_48930_+|integrase	integrase family protein	integrase	Q7M297	Enterobacteria_phage	60.7	3.3e-83
>prophage 1
AP019190	Escherichia coli M217 plasmid pM217_I1 DNA, complete genome	72781	23443	58941	72781	integrase,transposase	Acidithiobacillus_phage(20.0%)	39	53477:53492	65481:65496
BBG80282.1|23443_24985_+|transposase	transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
BBG80283.1|24996_25746_+|transposase	transposase	transposase	K4HZD4	Acidithiobacillus_phage	48.3	3.9e-55
BBG80284.1|25887_26103_+	hypothetical protein	NA	NA	NA	NA	NA
BBG80285.1|26099_27002_+	hypothetical protein	NA	Q2A0A7	Sodalis_phage	53.8	9.0e-67
BBG80286.1|27063_27270_+	hypothetical protein	NA	NA	NA	NA	NA
BBG80287.1|27209_27551_-	hypothetical protein	NA	NA	NA	NA	NA
BBG80288.1|28130_28979_+	restriction methylase	NA	NA	NA	NA	NA
BBG80289.1|29065_29407_-	mobilization protein MobC	NA	NA	NA	NA	NA
BBG80290.1|29634_29967_+	plasmid conjugation system NikA protein	NA	NA	NA	NA	NA
BBG80291.1|30172_32677_+	plasmid conjugation system NikB protein	NA	NA	NA	NA	NA
BBG80292.1|32714_34748_-	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
BBG80293.1|34998_36069_-	conjugal transfer protein	NA	NA	NA	NA	NA
BBG80294.1|36087_37296_-	conjugal transfer protein TrbA	NA	NA	NA	NA	NA
BBG80295.1|37602_38385_-	hypothetical protein	NA	F8J1D6	Lactobacillus_phage	35.3	1.1e-12
BBG80296.1|38580_38898_+	multidrug efflux system protein	NA	NA	NA	NA	NA
BBG80297.1|38894_39428_-	outer membrane lipoprotein Blc	NA	A0A1W6JNX6	Morganella_phage	54.1	6.1e-47
BBG80298.1|39521_40667_-	class C extended-spectrum beta-lactamase CMY-42	NA	NA	NA	NA	NA
BBG80299.1|41119_41386_-	hypothetical protein	NA	U5P0U6	Shigella_phage	100.0	5.4e-44
BBG80300.1|41541_41817_-|transposase	transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
BBG80301.1|41901_42111_+	hypothetical protein	NA	NA	NA	NA	NA
BBG80302.1|42364_43048_+	conjugal transfer protein TraC	NA	NA	NA	NA	NA
BBG80303.1|43219_43474_+	pilus assembly protein	NA	NA	NA	NA	NA
BBG80304.1|44332_44524_+	hypothetical protein	NA	NA	NA	NA	NA
BBG80305.1|44978_45290_-	hypothetical protein	NA	NA	NA	NA	NA
BBG80306.1|45587_46025_+	pilus assembly protein	NA	NA	NA	NA	NA
BBG80307.1|46038_47721_+	lipoprotein	NA	NA	NA	NA	NA
BBG80308.1|47713_48424_+	hypothetical protein	NA	NA	NA	NA	NA
BBG80309.1|48739_49009_+	hypothetical protein	NA	NA	NA	NA	NA
BBG80310.1|48995_49448_+	pilus assembly protein PilP	NA	NA	NA	NA	NA
BBG80311.1|49458_51012_+	DNA-binding protein	NA	NA	NA	NA	NA
BBG80312.1|51024_52110_+	transmembrane protein	NA	NA	NA	NA	NA
BBG80313.1|52126_52741_+	type IV prepilin PilS	NA	NA	NA	NA	NA
53477:53492	attL	TGGCATTAATTATTTT	NA	NA	NA	NA
BBG80314.1|53951_55376_+	shufflon protein	NA	NA	NA	NA	NA
BBG80315.1|55679_55835_+	hypothetical protein	NA	NA	NA	NA	NA
BBG80316.1|56162_56297_-	hypothetical protein	NA	NA	NA	NA	NA
BBG80317.1|56699_57026_-	hypothetical protein	NA	NA	NA	NA	NA
BBG80318.1|57200_57476_+|transposase	transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
BBG80319.1|57631_57898_+|transposase	IS1 family transposase InsB	transposase	U5P0U6	Shigella_phage	94.3	7.3e-41
BBG80320.1|57930_58941_+|integrase	integrase	integrase	A0A1L7DQ84	Ralstonia_phage	42.6	2.8e-40
65481:65496	attR	TGGCATTAATTATTTT	NA	NA	NA	NA
>prophage 2
AP019190	Escherichia coli M217 plasmid pM217_I1 DNA, complete genome	72781	65517	71034	72781	transposase	Macacine_betaherpesvirus(33.33%)	9	NA	NA
BBG80327.1|65517_65694_+	hypothetical protein	NA	A0A2H4J7S3	uncultured_Caudovirales_phage	51.8	1.4e-11
BBG80328.1|65758_66055_-	hypothetical protein	NA	NA	NA	NA	NA
BBG80329.1|66354_66606_+	hypothetical protein	NA	NA	NA	NA	NA
BBG80330.1|66907_67429_+|transposase	IS150 transposase A	transposase	A0A2I6AZV8	Macacine_betaherpesvirus	100.0	2.7e-92
BBG80331.1|67425_68277_+|transposase	IS150 transposase B	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	7.8e-113
BBG80332.1|68596_68971_+	hypothetical protein	NA	NA	NA	NA	NA
BBG80333.1|69123_70308_+|transposase	ISEcp1 transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	8.3e-20
BBG80334.1|70336_70612_+|transposase	transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
BBG80335.1|70767_71034_+	hypothetical protein	NA	U5P0U6	Shigella_phage	100.0	5.4e-44
