The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034250	Salmonella enterica subsp. enterica serovar Derby strain Sa64 chromosome, complete genome	4824198	1473613	1482786	4824198	tRNA	Enterobacteria_phage(66.67%)	8	NA	NA
AZK50300.1|1473613_1474561_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
AZK50301.1|1475257_1475365_-	protein YohO	NA	NA	NA	NA	NA
AZK50302.1|1476379_1478065_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.8e-278
AZK50303.1|1478061_1478781_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AZK50304.1|1478827_1479295_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AZK50305.1|1479351_1479882_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	32.4	7.2e-16
AZK50306.1|1480053_1480512_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AZK50307.1|1480752_1482786_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 2
CP034250	Salmonella enterica subsp. enterica serovar Derby strain Sa64 chromosome, complete genome	4824198	1562375	1572886	4824198		Enterobacteria_phage(37.5%)	9	NA	NA
AZK50370.1|1562375_1563779_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	2.3e-21
AZK50371.1|1563956_1564850_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AZK50372.1|1565226_1566312_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	4.7e-102
AZK50373.1|1566311_1567211_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
AZK52984.1|1567258_1568137_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
AZK50374.1|1568137_1568689_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
AZK50375.1|1568694_1569669_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
AZK50376.1|1570463_1571546_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-14
AZK50377.1|1571572_1572886_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	9.1e-52
>prophage 3
CP034250	Salmonella enterica subsp. enterica serovar Derby strain Sa64 chromosome, complete genome	4824198	3340330	3379701	4824198	protease,terminase,plate,holin,integrase,capsid,tail,head,portal	Shigella_phage(65.31%)	51	3336809:3336855	3375809:3375855
3336809:3336855	attL	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
AZK51801.1|3340330_3340738_-|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	83.5	9.1e-59
AZK51802.1|3342408_3343467_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.6	5.2e-199
AZK53055.1|3343453_3343879_-|tail	phage tail protein	tail	U5P0R9	Shigella_phage	100.0	2.3e-81
AZK51803.1|3343878_3344427_-|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	97.8	1.9e-96
AZK51804.1|3345509_3346838_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	99.3	8.4e-247
AZK51805.1|3346928_3347441_-	hypothetical protein	NA	NA	NA	NA	NA
AZK51806.1|3347522_3349358_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.0	1.5e-302
AZK51807.1|3349350_3349533_-	hypothetical protein	NA	NA	NA	NA	NA
AZK51808.1|3349769_3350126_-|tail	phage tail protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
AZK51809.1|3351608_3351779_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
AZK51810.1|3351787_3352348_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	2.3e-105
AZK51811.1|3352344_3352851_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	5.0e-91
AZK51812.1|3352825_3353236_-|head,tail	head-tail adaptor protein	head,tail	M1FJ87	Enterobacteria_phage	97.8	5.9e-74
AZK51813.1|3353232_3353556_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
AZK51814.1|3353530_3353758_-	hypothetical protein	NA	S5FNU1	Shigella_phage	94.9	2.2e-22
AZK51815.1|3353807_3355013_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.8	3.1e-224
AZK51816.1|3355027_3355687_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	98.6	1.8e-117
AZK51817.1|3355664_3356906_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	3.2e-240
AZK51818.1|3356905_3357088_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	98.3	1.4e-24
AZK51819.1|3357099_3358833_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	99.8	0.0e+00
AZK51820.1|3358846_3359332_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	99.4	2.1e-86
AZK51821.1|3359457_3359808_-	HNH endonuclease	NA	Q8SBD7	Shigella_phage	99.1	3.6e-64
AZK51822.1|3359834_3360107_-	peptidase	NA	Q8SBD8	Shigella_phage	98.9	6.3e-40
AZK51823.1|3359991_3360384_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	89.2	3.1e-56
AZK51824.1|3360367_3360844_-	lysozyme	NA	S5FV07	Shigella_phage	97.5	2.4e-87
AZK53056.1|3360847_3361183_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	100.0	5.2e-60
AZK51825.1|3361259_3362312_-	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	98.9	9.8e-206
AZK51826.1|3362461_3362740_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	90.7	1.0e-29
AZK51827.1|3362905_3363658_-	antitermination protein	NA	Q8SBE4	Shigella_phage	100.0	2.8e-138
AZK51828.1|3363671_3364661_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	8.1e-194
AZK51829.1|3364668_3365478_-	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	99.6	1.8e-151
AZK51830.1|3365497_3365887_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
AZK51831.1|3365883_3366210_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	4.5e-53
AZK51832.1|3366206_3366860_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	9.6e-127
AZK51833.1|3366859_3367354_-	PerC family transcriptional regulator	NA	K7PJR0	Enterobacteria_phage	98.8	3.3e-87
AZK51834.1|3367350_3368169_-	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	100.0	1.8e-122
AZK53057.1|3368165_3368390_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	95.9	5.9e-36
AZK51835.1|3368394_3369231_-	ash family protein	NA	A0A291AWU3	Escherichia_phage	99.6	2.2e-152
AZK51836.1|3369227_3369779_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
AZK51837.1|3369822_3370023_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
AZK51838.1|3370113_3370788_+	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
AZK51839.1|3371200_3371392_-	hypothetical protein	NA	S5FM78	Shigella_phage	100.0	3.3e-27
AZK51840.1|3371812_3372193_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-63
AZK51841.1|3372258_3373083_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.7e-149
AZK51842.1|3373210_3373747_+	HD family hydrolase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
AZK51843.1|3373737_3374100_+	hypothetical protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
AZK51844.1|3374099_3374405_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
AZK51845.1|3374631_3375795_+|integrase	integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
AZK51846.1|3376000_3377251_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.2	7.3e-99
3375809:3375855	attR	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
AZK51847.1|3377262_3378366_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
AZK51848.1|3378648_3379701_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	1.5e-113
>prophage 4
CP034250	Salmonella enterica subsp. enterica serovar Derby strain Sa64 chromosome, complete genome	4824198	4158566	4205598	4824198	plate,tail,tRNA	Burkholderia_phage(38.1%)	47	NA	NA
AZK52440.1|4158566_4159565_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AZK52441.1|4159652_4160963_-	conjugal transfer protein	NA	NA	NA	NA	NA
AZK52442.1|4161209_4161725_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
AZK53087.1|4161824_4162034_-	CsbD family protein	NA	NA	NA	NA	NA
AZK52443.1|4162055_4162169_-	hypothetical protein	NA	NA	NA	NA	NA
AZK52444.1|4162165_4163491_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
AZK52445.1|4163669_4164278_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
AZK52446.1|4164386_4164755_-	diacylglycerol kinase	NA	NA	NA	NA	NA
AZK52447.1|4164925_4167346_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
AZK52448.1|4167444_4168317_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
AZK52449.1|4168330_4168828_-	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
AZK52450.1|4169008_4169926_-	maltose operon protein MalM	NA	NA	NA	NA	NA
AZK52451.1|4170089_4171448_-	maltoporin	NA	NA	NA	NA	NA
AZK52452.1|4171536_4172646_-	maltose/maltodextrin import ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
AZK52453.1|4173007_4174198_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
AZK52454.1|4174329_4175874_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
AZK52455.1|4175888_4176779_+	maltose ABC transporter permease	NA	NA	NA	NA	NA
AZK52456.1|4176944_4177355_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
AZK52457.1|4177497_4179600_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
AZK52458.1|4180334_4180973_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
AZK53088.1|4181036_4181279_-	outer membrane protein	NA	NA	NA	NA	NA
AZK52459.1|4181722_4183372_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AZK52460.1|4183760_4185110_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
AZK52461.1|4185240_4185588_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
AZK52462.1|4186164_4186452_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
AZK52463.1|4186454_4187060_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	3.2e-60
AZK52464.1|4187072_4187387_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
AZK52465.1|4187546_4188002_+	hypothetical protein	NA	NA	NA	NA	NA
AZK52466.1|4187998_4188196_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
AZK52467.1|4188185_4189613_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	1.4e-194
AZK52468.1|4189612_4190137_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
AZK52469.1|4190188_4190506_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AZK52470.1|4190465_4190594_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AZK52471.1|4190690_4193045_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	5.8e-65
AZK52472.1|4193044_4193998_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
AZK52473.1|4193997_4194207_+	hypothetical protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
AZK52474.1|4194194_4195238_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	46.2	5.9e-78
AZK52475.1|4196231_4196594_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
AZK52476.1|4196590_4197520_+	glycosyltransferase	NA	S5FKN0	Shigella_phage	84.4	6.1e-151
AZK52477.1|4197519_4199067_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	4.2e-48
AZK52478.1|4199230_4199590_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
AZK52479.1|4199580_4200696_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	4.1e-101
AZK52480.1|4200688_4201321_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	55.6	5.6e-23
AZK52481.1|4201323_4203069_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	4.2e-52
AZK52482.1|4203073_4203679_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
AZK52483.1|4203675_4204131_+	hypothetical protein	NA	NA	NA	NA	NA
AZK52484.1|4204869_4205598_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 1
CP034252	Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64-96, complete sequence	96517	27707	35484	96517	integrase	Escherichia_phage(28.57%)	11	27639:27653	38644:38658
27639:27653	attL	GACAGCCAGAAACGG	NA	NA	NA	NA
AZK53367.1|27707_28490_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.4e-52
AZK53368.1|28627_28903_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AZK53369.1|28896_29541_-	chromosome partitioning protein ParA	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
AZK53370.1|29769_30741_+	plasmid segregation protein parM	NA	A0A222YXF2	Escherichia_phage	42.9	7.4e-67
AZK53371.1|30745_31138_+	plasmid stability protein	NA	NA	NA	NA	NA
AZK53372.1|31142_32414_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.5	1.9e-142
AZK53373.1|32413_32851_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
AZK53374.1|32847_33096_-	protein ImpC	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
AZK53375.1|33206_33476_+	hypothetical protein	NA	NA	NA	NA	NA
AZK53440.1|33513_34416_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AZK53376.1|34800_35484_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.1e-29
38644:38658	attR	CCGTTTCTGGCTGTC	NA	NA	NA	NA
>prophage 2
CP034252	Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64-96, complete sequence	96517	38747	47177	96517		Pseudomonas_phage(16.67%)	9	NA	NA
AZK53383.1|38747_40415_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.3	1.7e-164
AZK53441.1|41128_41635_-	hypothetical protein	NA	NA	NA	NA	NA
AZK53384.1|41581_42109_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.5	3.5e-47
AZK53385.1|42166_42400_+	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	53.2	1.7e-06
AZK53386.1|42458_44417_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	28.0	9.2e-24
AZK53442.1|44471_44906_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
AZK53387.1|44902_45622_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AZK53388.1|45618_46077_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	56.6	9.0e-15
AZK53389.1|46286_47177_+	DUF1472 domain-containing protein	NA	G9FHQ1	Rhodococcus_virus	27.3	4.3e-05
>prophage 1
CP034251	Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64T-188, complete sequence	188966	5441	13871	188966		Rhodococcus_virus(16.67%)	9	NA	NA
AZK53127.1|5441_6332_-	DUF1472 domain-containing protein	NA	G9FHQ1	Rhodococcus_virus	27.3	4.3e-05
AZK53128.1|6541_7000_-	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	56.6	9.0e-15
AZK53129.1|6996_7716_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AZK53317.1|7712_8147_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
AZK53130.1|8201_10160_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	28.0	9.2e-24
AZK53131.1|10218_10452_-	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	53.2	1.7e-06
AZK53132.1|10509_11037_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.5	3.5e-47
AZK53133.1|11033_11240_-	hypothetical protein	NA	NA	NA	NA	NA
AZK53134.1|12203_13871_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.3	1.7e-164
>prophage 2
CP034251	Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64T-188, complete sequence	188966	17134	24911	188966	integrase	Escherichia_phage(28.57%)	11	13961:13975	24966:24980
13961:13975	attL	GACAGCCAGAAACGG	NA	NA	NA	NA
AZK53141.1|17134_17818_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.1e-29
AZK53318.1|18202_19105_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AZK53142.1|19142_19412_-	hypothetical protein	NA	NA	NA	NA	NA
AZK53143.1|19522_19771_+	protein ImpC	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
AZK53144.1|19767_20205_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
AZK53145.1|20204_21476_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.5	1.9e-142
AZK53146.1|21480_21873_-	plasmid stability protein	NA	NA	NA	NA	NA
AZK53147.1|21877_22849_-	plasmid segregation protein parM	NA	A0A222YXF2	Escherichia_phage	42.9	7.4e-67
AZK53148.1|23077_23722_+	chromosome partitioning protein ParA	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
AZK53149.1|23715_23991_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AZK53150.1|24128_24911_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.4e-52
24966:24980	attR	CCGTTTCTGGCTGTC	NA	NA	NA	NA
>prophage 3
CP034251	Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64T-188, complete sequence	188966	30600	124774	188966	integrase,transposase	Escherichia_phage(33.33%)	99	100271:100330	124778:125597
AZK53159.1|30600_31305_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AZK53160.1|31651_31951_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZK53161.1|32514_34341_+	OLD family endonuclease	NA	E5E3R2	Burkholderia_phage	22.8	4.7e-14
AZK53162.1|34509_34860_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	50.5	1.8e-18
AZK53163.1|35007_35439_-	silver-binding protein SilE	NA	NA	NA	NA	NA
AZK53164.1|35683_37165_-	Cu(+)/Ag(+) sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.8e-27
AZK53165.1|37157_37838_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
AZK53166.1|38027_39413_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
AZK53167.1|39440_39794_+	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZK53168.1|39907_41200_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AZK53169.1|41210_44357_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.4	2.1e-62
AZK53170.1|44443_44884_+	hypothetical protein	NA	NA	NA	NA	NA
AZK53171.1|45011_47459_+	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.4	2.9e-83
AZK53172.1|47499_47697_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AZK53173.1|47730_48468_-	peptidase	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	31.9	1.3e-10
AZK53174.1|48756_49206_-	copper resistance protein	NA	NA	NA	NA	NA
AZK53175.1|49440_51258_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
AZK53319.1|51257_52154_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
AZK53176.1|52193_52574_+	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
AZK53177.1|52578_53508_+	copper resistance protein D	NA	NA	NA	NA	NA
AZK53178.1|53562_54243_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AZK53179.1|54239_55640_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
AZK53180.1|55857_56292_+	copper-binding protein	NA	NA	NA	NA	NA
AZK53181.1|56670_57489_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AZK53182.1|57485_58691_+	ATP/GTP-binding protein	NA	NA	NA	NA	NA
AZK53183.1|58754_58958_-	hypothetical protein	NA	NA	NA	NA	NA
AZK53184.1|58970_60290_-	DUF1173 family protein	NA	NA	NA	NA	NA
AZK53185.1|60540_61968_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
AZK53320.1|62182_62698_+	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
AZK53186.1|62700_63597_+	hypothetical protein	NA	NA	NA	NA	NA
AZK53321.1|63818_64052_+	hypothetical protein	NA	NA	NA	NA	NA
AZK53187.1|64097_64352_+	hypothetical protein	NA	NA	NA	NA	NA
AZK53188.1|64389_64677_+	hypothetical protein	NA	NA	NA	NA	NA
AZK53189.1|64713_64944_+	hypothetical protein	NA	NA	NA	NA	NA
AZK53190.1|65280_65742_+	hypothetical protein	NA	NA	NA	NA	NA
AZK53191.1|65771_66179_+	hypothetical protein	NA	NA	NA	NA	NA
AZK53322.1|66229_66547_-	hypothetical protein	NA	NA	NA	NA	NA
AZK53323.1|66923_67274_-	hypothetical protein	NA	NA	NA	NA	NA
AZK53192.1|69138_69531_+	cysteine hydrolase	NA	NA	NA	NA	NA
AZK53193.1|69668_70553_+	EamA family transporter	NA	NA	NA	NA	NA
AZK53194.1|70584_71784_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AZK53195.1|71862_72540_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZK53196.1|72571_72814_-	relaxase	NA	NA	NA	NA	NA
AZK53197.1|74451_75156_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZK53198.1|75101_75662_-	hypothetical protein	NA	NA	NA	NA	NA
AZK53199.1|76044_76701_-	quinolone resistance pentapeptide repeat protein QnrS2	NA	NA	NA	NA	NA
AZK53200.1|77257_77962_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZK53201.1|78253_78601_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AZK53202.1|78823_79276_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
AZK53203.1|79360_79993_-	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
AZK53324.1|80130_80961_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
AZK53325.1|81091_81646_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AZK53204.1|81789_82494_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZK53326.1|82607_83384_+	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
AZK53205.1|83404_83626_+	hypothetical protein	NA	NA	NA	NA	NA
AZK53206.1|83612_84638_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
AZK53207.1|85059_85812_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
AZK53208.1|87622_88108_+	phenol hydroxylase	NA	NA	NA	NA	NA
AZK53209.1|88304_89395_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
AZK53210.1|89484_90300_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AZK53211.1|90386_90689_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AZK53212.1|90582_90834_-	hypothetical protein	NA	NA	NA	NA	NA
AZK53213.1|90864_92358_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AZK53214.1|92469_92775_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZK53215.1|92802_94017_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
AZK53216.1|94233_95118_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AZK53217.1|96042_96747_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
AZK53327.1|96831_97233_-	hypothetical protein	NA	NA	NA	NA	NA
AZK53218.1|97241_100193_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
AZK53219.1|100195_100357_-	hypothetical protein	NA	NA	NA	NA	NA
100271:100330	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
AZK53220.1|100333_101038_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AZK53221.1|101372_101765_+	NimC/NimA family protein	NA	NA	NA	NA	NA
AZK53222.1|102084_102471_-	bleomycin binding protein	NA	NA	NA	NA	NA
AZK53223.1|102539_102719_+	hypothetical protein	NA	Q1MVP5	Enterobacteria_phage	85.7	7.3e-05
AZK53224.1|104758_104923_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AZK53225.1|105103_105943_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AZK53226.1|105872_106052_-	hypothetical protein	NA	NA	NA	NA	NA
AZK53227.1|106070_106274_+	hypothetical protein	NA	NA	NA	NA	NA
AZK53228.1|106498_107203_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZK53229.1|107849_108140_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
AZK53230.1|108251_108749_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
AZK53231.1|109153_109858_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZK53232.1|110047_110863_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
AZK53233.1|111013_111718_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZK53234.1|111925_112111_+	hypothetical protein	NA	NA	NA	NA	NA
AZK53235.1|112965_113757_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
AZK53236.1|114225_114471_-	hypothetical protein	NA	NA	NA	NA	NA
AZK53237.1|114508_115372_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
AZK53238.1|115602_116307_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZK53239.1|116353_116695_-	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
AZK53240.1|116864_117656_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AZK53241.1|117748_119008_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
AZK53242.1|119269_120061_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AZK53243.1|120118_120727_-	HAD family hydrolase	NA	NA	NA	NA	NA
AZK53244.1|120822_121665_-	alpha/beta fold putative hydrolase EstX	NA	NA	NA	NA	NA
AZK53245.1|121831_122845_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AZK53328.1|123047_123398_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AZK53246.1|123523_124036_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	84.8	4.5e-39
AZK53247.1|124069_124774_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
124778:125597	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGTCCAGCAAACGGGATGTTCCGGAAGATAATAAGTATCATGATGTTCGTTCTGTAGCCTCAGATAATTTTCAACATCACTGAGCTGCCAGCTAGAATAAATAATATTTGAAAATCCGACGTTATACATATCAATTGTTGACATAACCTGATCAATATAATCATAGGAGCATTTATAAACTTTGATTCGTGACATGTCTTTTGTAAGTAGTTTCTGAGGGTCCGGGCTGAATACATTAATTTCCAGTGGGGTGAAAAACCCGTGTTCCGGGTACTGATAAAACTTAAGAGCCAAATTATGAGCAAGGGGAAGGTACAGGACGCGTTCTTCTGTCATTTTGCAAAATACATTAGGTGATACTGTAAATACCGGACGTGGTTCTGTACTGTAAAAGTGGTGCCCGGTATGAAATATATCCACACGATGTATTCCGGAAAAAACCTCTCCGCGTAGCCAGGCCATAGTGTCAATCATTGTTATTTTACCCTGAAGTGCGAGAAGGGAAAATAATACAAACATGGCCTTAGCTTTTTCGTCATCCCCAGAAGAAGAACGAGCTATACGAATCAGTTTCTGATAGATACTTAAAGCCGCCAACTCCGGCATAACGTCAGACAAAGAAATTGTTTCGGAAATGATATGCTGAAGGTTGTTTTTTACTAGGTTAATGAATGACTGAAATAACTCATTTTTACCCGGAAATCTGCTTTGCGGGTTATTGAGGTTAAGTAACATCTGAAATATAGCAAAACTTGCAAGCT	NA	NA	NA	NA
