The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	0	27327	5288676	integrase,terminase,capsid,portal	Clostridium_phage(29.63%)	37	11995:12008	29257:29270
AZK44776.1|36_468_-	hypothetical protein	NA	X5JAB5	Clostridium_phage	46.9	6.5e-31
AZK44777.1|460_952_-	HK97 gp10 family phage protein	NA	A0A0A8WFV8	Clostridium_phage	47.2	1.2e-33
AZK44778.1|955_1318_-	hypothetical protein	NA	X5JAV9	Clostridium_phage	50.4	6.0e-22
AZK44779.1|1311_1692_-	hypothetical protein	NA	A0A0A8WIE8	Clostridium_phage	48.1	7.0e-29
AZK44780.1|1703_2051_-	hypothetical protein	NA	NA	NA	NA	NA
AZK44781.1|2065_3022_-|capsid	phage capsid protein	capsid	A0A1J0MCK3	Streptomyces_phage	57.0	2.6e-88
AZK44782.1|3058_3643_-	hypothetical protein	NA	S5MUG0	Brevibacillus_phage	38.4	6.5e-18
AZK44783.1|3834_4083_-	hypothetical protein	NA	NA	NA	NA	NA
AZK44784.1|4100_6065_-	hypothetical protein	NA	X5JAI9	Clostridium_phage	50.1	3.6e-121
AZK48794.1|6051_7464_-|portal	phage portal protein	portal	S5MNW1	Brevibacillus_phage	46.9	6.3e-115
AZK48795.1|7552_8962_-|terminase	terminase	terminase	A0A090EUA8	Clostridium_phage	68.2	6.5e-181
AZK44785.1|8972_9482_-	helix-turn-helix domain-containing protein	NA	A5GYP7	Lactococcus_phage	57.7	3.2e-45
AZK44786.1|9616_10036_-	DUF1492 domain-containing protein	NA	A0A2K5B275	Erysipelothrix_phage	40.4	1.6e-21
AZK48796.1|10390_10963_-	hypothetical protein	NA	A0A1U9WR93	Streptococcus_virus	38.0	3.3e-22
AZK44787.1|10965_11181_-	hypothetical protein	NA	NA	NA	NA	NA
AZK44788.1|11177_11369_-	hypothetical protein	NA	NA	NA	NA	NA
AZK44789.1|11375_11699_-	nucleotide pyrophosphohydrolase	NA	A0A2H4J7H8	uncultured_Caudovirales_phage	48.6	1.4e-22
AZK44790.1|11685_11964_-	DUF1599 domain-containing protein	NA	A0A2H4J4N1	uncultured_Caudovirales_phage	53.9	1.1e-15
AZK44791.1|11978_13862_-	DNA primase	NA	H7BVJ4	unidentified_phage	58.0	4.3e-212
11995:12008	attL	ATTCTTCTTTTTCT	NA	NA	NA	NA
AZK48797.1|13901_15662_-	hypothetical protein	NA	A0A2H4J041	uncultured_Caudovirales_phage	54.0	5.7e-174
AZK44792.1|15664_15886_-	hypothetical protein	NA	NA	NA	NA	NA
AZK44793.1|15951_16407_-	DUF669 domain-containing protein	NA	A0A2H4J1S8	uncultured_Caudovirales_phage	58.7	2.0e-46
AZK44794.1|16486_18292_-	NTP-binding protein	NA	A0A2H4J7Q2	uncultured_Caudovirales_phage	52.7	1.8e-146
AZK44795.1|18210_18627_-	VRR-NUC domain-containing protein	NA	A0A2H4J095	uncultured_Caudovirales_phage	45.0	1.7e-20
AZK44796.1|18604_18958_-	hypothetical protein	NA	A0A219UQU1	Bacillus_phage	52.1	5.5e-20
AZK48798.1|18957_19263_-	hypothetical protein	NA	NA	NA	NA	NA
AZK44797.1|19249_19498_-	hypothetical protein	NA	NA	NA	NA	NA
AZK44798.1|19472_20831_-	DEAD/DEAH box helicase	NA	A0A2H4J064	uncultured_Caudovirales_phage	53.9	4.4e-134
AZK44799.1|20836_21223_-	hypothetical protein	NA	NA	NA	NA	NA
AZK44800.1|21373_21772_-	XRE family transcriptional regulator	NA	A0A2I6PDG6	Staphylococcus_phage	43.0	1.4e-08
AZK44801.1|21794_21983_-	helix-turn-helix domain-containing protein	NA	Q8SBM7	Clostridium_phage	44.6	3.1e-06
AZK44802.1|22004_22622_-	hypothetical protein	NA	NA	NA	NA	NA
AZK44803.1|22638_22836_-	XRE family transcriptional regulator	NA	A0A1C8E9A4	Bacillus_phage	43.1	1.9e-06
AZK44804.1|23103_23760_+	XRE family transcriptional regulator	NA	A0A1J0MG99	Staphylococcus_phage	36.4	4.3e-26
AZK44805.1|24054_24444_+	hypothetical protein	NA	NA	NA	NA	NA
AZK44806.1|24620_25706_+|integrase	site-specific integrase	integrase	Q8SBN2	Clostridium_phage	57.5	7.4e-116
AZK44807.1|25788_27327_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.6	3.0e-22
29257:29270	attR	AGAAAAAGAAGAAT	NA	NA	NA	NA
>prophage 2
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	40373	41375	5288676		Bacillus_virus(100.0%)	1	NA	NA
AZK44818.1|40373_41375_-	UV DNA damage repair endonuclease UvsE	NA	G3MAQ2	Bacillus_virus	32.0	1.7e-37
>prophage 3
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	50843	56503	5288676		Bacillus_thuringiensis_phage(25.0%)	5	NA	NA
AZK44827.1|50843_52112_+	DUF2935 domain-containing protein	NA	Q56AR7	Bacillus_thuringiensis_phage	43.1	1.0e-39
AZK44828.1|52279_53503_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
AZK44829.1|53671_54361_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.5	2.2e-28
AZK44830.1|54357_55833_+	sensor histidine kinase	NA	Q6XLV6	Feldmannia_irregularis_virus	24.8	8.2e-09
AZK44831.1|55909_56503_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	55.8	5.6e-49
>prophage 4
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	59799	60240	5288676		Pseudomonas_phage(100.0%)	1	NA	NA
AZK44835.1|59799_60240_-	ribonuclease HI	NA	Q2Z0V7	Pseudomonas_phage	37.4	1.1e-17
>prophage 5
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	66278	79999	5288676		Planktothrix_phage(40.0%)	13	NA	NA
AZK44843.1|66278_66968_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.0	9.7e-37
AZK44844.1|66964_68026_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AZK44845.1|68049_68697_-	DUF1282 domain-containing protein	NA	NA	NA	NA	NA
AZK48801.1|68893_69703_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	41.3	6.0e-46
AZK44846.1|69826_70261_-	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
AZK44847.1|70387_72103_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
AZK44848.1|72251_73514_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	57.8	2.0e-27
AZK44849.1|73534_74776_-	hypothetical protein	NA	NA	NA	NA	NA
AZK44850.1|74798_75503_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.7	4.8e-15
AZK48802.1|75806_76274_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZK44851.1|76384_76729_-	hypothetical protein	NA	NA	NA	NA	NA
AZK44852.1|76788_78321_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
AZK44853.1|78376_79999_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.5	5.5e-14
>prophage 6
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	83475	87393	5288676		Catovirus(50.0%)	2	NA	NA
AZK44857.1|83475_85002_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	25.9	7.2e-16
AZK48805.1|85560_87393_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	29.7	2.4e-50
>prophage 7
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	122052	122958	5288676		Staphylococcus_phage(100.0%)	1	NA	NA
AZK44889.1|122052_122958_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.6	3.3e-24
>prophage 8
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	142651	148759	5288676		Dasychira_pudibunda_nucleopolyhedrovirus(50.0%)	4	NA	NA
AZK44912.1|142651_145750_-	DEAD/DEAH box helicase	NA	A0A0N7D8L3	Dasychira_pudibunda_nucleopolyhedrovirus	31.8	6.3e-43
AZK44913.1|146024_146780_+	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
AZK44914.1|146870_147248_-	RidA family protein	NA	NA	NA	NA	NA
AZK48813.1|147286_148759_-	sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	35.4	1.9e-26
>prophage 9
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	160141	167135	5288676		Planktothrix_phage(50.0%)	5	NA	NA
AZK48817.1|160141_161428_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.8	7.6e-27
AZK44921.1|162248_164312_-	U32 family peptidase	NA	Q6DW11	Phage_TP	31.7	1.5e-16
AZK44922.1|164615_165419_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
AZK44923.1|165400_166309_-	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	31.8	3.6e-15
AZK44924.1|166313_167135_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.8	5.9e-25
>prophage 10
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	171818	172544	5288676		Escherichia_phage(100.0%)	1	NA	NA
AZK44929.1|171818_172544_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	38.7	4.9e-39
>prophage 11
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	181759	190428	5288676		Clostridium_phage(50.0%)	3	NA	NA
AZK44940.1|181759_184099_+	hypothetical protein	NA	A0A1L2BY82	Clostridium_phage	44.3	8.1e-168
AZK44941.1|184384_185026_-	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
AZK44942.1|185559_190428_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	31.2	1.0e-10
>prophage 12
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	197033	206494	5288676		uncultured_virus(40.0%)	6	NA	NA
AZK44949.1|197033_198770_+	sulfate permease	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.1	5.4e-44
AZK44950.1|198873_199632_-	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.4	2.1e-08
AZK44951.1|199928_201626_-	cellulase	NA	NA	NA	NA	NA
AZK44952.1|201870_203343_-	hypothetical protein	NA	A0A2D1GD28	Mycobacterium_phage	46.7	1.9e-05
AZK44953.1|203804_206216_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	39.5	3.0e-125
AZK44954.1|206287_206494_-	copper chaperone	NA	A0A218MNH0	uncultured_virus	35.4	9.0e-07
>prophage 13
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	212545	218550	5288676		Enterobacteria_phage(33.33%)	7	NA	NA
AZK44960.1|212545_214132_-	ATP-binding protein	NA	K7PHD1	Enterobacteria_phage	39.0	1.0e-97
AZK48820.1|214318_214564_+	dehydrogenase	NA	NA	NA	NA	NA
AZK44961.1|214800_215880_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0U4JD08	Gordonia_phage	32.3	3.6e-38
AZK44962.1|215863_216487_-	hypothetical protein	NA	NA	NA	NA	NA
AZK44963.1|216837_217110_+	hypothetical protein	NA	NA	NA	NA	NA
AZK48821.1|217016_217310_+	N-acetyltransferase	NA	NA	NA	NA	NA
AZK44964.1|217686_218550_+	ATP-dependent DNA ligase	NA	A0A2H4JD86	uncultured_Caudovirales_phage	34.8	3.8e-22
>prophage 14
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	224293	235571	5288676		Cedratvirus(20.0%)	7	NA	NA
AZK44972.1|224293_226270_-	ABC transporter ATP-binding protein	NA	A0A2R8FFL6	Cedratvirus	28.2	2.7e-15
AZK48822.1|226290_227118_-	cell division protein FtsQ	NA	NA	NA	NA	NA
AZK44973.1|227378_228209_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AZK44974.1|228770_230747_+	anaerobic ribonucleoside triphosphate reductase	NA	A0A0A8WEK0	Clostridium_phage	38.6	7.4e-138
AZK44975.1|230743_231262_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A2D0YLR2	Vibrio_phage	43.2	4.6e-31
AZK44976.1|231518_233852_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0Y0AS84	Bacillus_phage	61.7	2.2e-258
AZK44977.1|234539_235571_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A059T7I4	Listeria_phage	50.6	3.3e-89
>prophage 15
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	241965	247861	5288676		Bacillus_phage(66.67%)	4	NA	NA
AZK44983.1|241965_243804_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.9	8.6e-56
AZK44984.1|243784_245611_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.4	1.0e-40
AZK44985.1|245768_246005_-	hypothetical protein	NA	NA	NA	NA	NA
AZK44986.1|246496_247861_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	37.2	4.2e-68
>prophage 16
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	271272	272196	5288676		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AZK48824.1|271272_272196_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	42.4	1.1e-48
>prophage 17
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	289193	293196	5288676		Staphylococcus_phage(33.33%)	5	NA	NA
AZK45016.1|289193_290129_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.6e-26
AZK45017.1|290311_291469_+	sensor histidine kinase	NA	NA	NA	NA	NA
AZK48825.1|291494_292184_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	30.5	5.5e-08
AZK45018.1|292515_292749_-	cold-shock protein	NA	NA	NA	NA	NA
AZK45019.1|292995_293196_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	64.6	8.4e-18
>prophage 18
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	299821	303598	5288676		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
AZK45026.1|299821_301504_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	26.8	6.3e-13
AZK45027.1|301524_302754_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
AZK45028.1|302891_303116_-	hypothetical protein	NA	NA	NA	NA	NA
AZK45029.1|303370_303598_+	XRE family transcriptional regulator	NA	A0A0A7RUJ9	Clostridium_phage	38.6	1.8e-08
>prophage 19
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	333780	334518	5288676		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AZK45056.1|333780_334518_-	glycerophosphodiester phosphodiesterase	NA	M1HUL1	Acanthocystis_turfacea_Chlorella_virus	34.8	2.7e-21
>prophage 20
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	341667	343737	5288676		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AZK45064.1|341667_343737_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	4.5e-05
>prophage 21
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	360835	364679	5288676		Synechococcus_phage(50.0%)	3	NA	NA
AZK45072.1|360835_361498_+	beta-phosphoglucomutase	NA	A0A1D8KPI1	Synechococcus_phage	27.3	6.5e-14
AZK45073.1|361578_363897_+	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
AZK45074.1|364100_364679_-	TIGR00730 family Rossman fold protein	NA	A0A1V0S9E9	Catovirus	25.7	1.2e-08
>prophage 22
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	379382	380096	5288676		Planktothrix_phage(100.0%)	1	NA	NA
AZK45087.1|379382_380096_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.4	1.5e-32
>prophage 23
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	384419	390222	5288676		Streptococcus_phage(33.33%)	5	NA	NA
AZK45091.1|384419_385511_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.9	3.9e-80
AZK45092.1|385614_386511_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZK45093.1|386507_387632_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	31.9	1.1e-34
AZK45094.1|387644_388961_-	glutamate-1-semialdehyde-2,1-aminomutase	NA	NA	NA	NA	NA
AZK45095.1|388974_390222_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	49.0	2.9e-92
>prophage 24
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	403794	405540	5288676		Enterobacteria_phage(100.0%)	1	NA	NA
AZK48830.1|403794_405540_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	30.9	2.1e-19
>prophage 25
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	408795	502360	5288676	transposase	Clostridium_phage(28.57%)	94	NA	NA
AZK45107.1|408795_410154_+|transposase	transposase	transposase	NA	NA	NA	NA
AZK45108.1|410378_410603_+	hypothetical protein	NA	NA	NA	NA	NA
AZK45109.1|412235_413147_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AZK45110.1|413167_413494_-|transposase	transposase	transposase	NA	NA	NA	NA
AZK45111.1|413515_413704_-	hypothetical protein	NA	NA	NA	NA	NA
AZK45112.1|413827_414100_-|transposase	transposase	transposase	NA	NA	NA	NA
AZK45113.1|414208_416203_-	carbohydrate-binding protein	NA	NA	NA	NA	NA
AZK45114.1|416265_418308_-	glycoside hydrolase	NA	NA	NA	NA	NA
AZK45115.1|418697_419840_+	xylanase	NA	NA	NA	NA	NA
AZK45116.1|419897_421196_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZK45117.1|421384_421897_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZK45118.1|422149_423244_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
AZK45119.1|423285_424020_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	43.5	1.7e-31
AZK45120.1|424046_424688_-	hypothetical protein	NA	NA	NA	NA	NA
AZK45121.1|425004_428370_-	hypothetical protein	NA	NA	NA	NA	NA
AZK45122.1|428520_431091_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AZK45123.1|431493_432204_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
AZK45124.1|432407_433004_+	hypothetical protein	NA	NA	NA	NA	NA
AZK45125.1|433201_433966_-	ChbG/HpnK family deacetylase	NA	NA	NA	NA	NA
AZK45126.1|433985_435848_-	PTS beta-glucoside transporter subunit EIIBCA	NA	NA	NA	NA	NA
AZK45127.1|435995_436832_-	PRD domain-containing protein	NA	NA	NA	NA	NA
AZK45128.1|437563_437968_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AZK45129.1|437957_438650_-	hypothetical protein	NA	NA	NA	NA	NA
AZK45130.1|438841_439168_-	hypothetical protein	NA	NA	NA	NA	NA
AZK45131.1|439702_440002_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AZK45132.1|440007_440574_+	DUF2812 domain-containing protein	NA	NA	NA	NA	NA
AZK45133.1|440592_441843_+	erythromycin esterase family protein	NA	NA	NA	NA	NA
AZK45134.1|442031_442472_-	DUF1569 domain-containing protein	NA	NA	NA	NA	NA
AZK45135.1|442815_444009_+|transposase	transposase	transposase	NA	NA	NA	NA
AZK45136.1|444480_444696_-	hypothetical protein	NA	NA	NA	NA	NA
AZK45137.1|444750_445443_-	hypothetical protein	NA	NA	NA	NA	NA
AZK45138.1|445611_445791_-	hypothetical protein	NA	NA	NA	NA	NA
AZK45139.1|445787_446759_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
AZK45140.1|446847_447789_+	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
AZK45141.1|447816_448320_+	hypothetical protein	NA	NA	NA	NA	NA
AZK45142.1|448415_449561_-	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
AZK45143.1|449980_450790_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
AZK45144.1|450868_451234_-	hypothetical protein	NA	NA	NA	NA	NA
AZK45145.1|451421_452333_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AZK45146.1|452353_452680_-|transposase	transposase	transposase	NA	NA	NA	NA
AZK45147.1|452701_453685_-	M56 family metallopeptidase	NA	NA	NA	NA	NA
AZK45148.1|453694_454051_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
AZK45149.1|454391_454763_-	hypothetical protein	NA	NA	NA	NA	NA
AZK45150.1|454752_455010_-	hypothetical protein	NA	A0A0A8WF72	Clostridium_phage	47.9	4.4e-11
AZK45151.1|455131_455983_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AZK45152.1|456004_457162_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZK45153.1|457133_458516_-	adenylate cyclase	NA	NA	NA	NA	NA
AZK45154.1|458526_459390_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AZK45155.1|459352_460357_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A220T6L0	Eptesipox_virus	25.6	1.1e-15
AZK45156.1|460353_461694_-	hypothetical protein	NA	NA	NA	NA	NA
AZK45157.1|461707_462700_-	beta-ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
AZK45158.1|463420_464146_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	38.7	4.9e-39
AZK45159.1|464147_465722_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AZK45160.1|465916_466678_+	hypothetical protein	NA	NA	NA	NA	NA
AZK45161.1|466761_467673_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AZK45162.1|467693_468020_-|transposase	transposase	transposase	NA	NA	NA	NA
AZK45163.1|468199_468640_+	hypothetical protein	NA	NA	NA	NA	NA
AZK45164.1|470217_470544_-	DUF5071 domain-containing protein	NA	NA	NA	NA	NA
AZK45165.1|470554_471088_-	hypothetical protein	NA	NA	NA	NA	NA
AZK45166.1|471216_473613_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
AZK45167.1|473648_474311_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.2	2.1e-28
AZK45168.1|474448_474592_-	pseudouridine synthase	NA	NA	NA	NA	NA
AZK45169.1|474739_475225_-	hypothetical protein	NA	NA	NA	NA	NA
AZK45170.1|475527_475791_-	hypothetical protein	NA	NA	NA	NA	NA
AZK45171.1|475836_476196_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
AZK45172.1|476271_477465_+|transposase	transposase	transposase	NA	NA	NA	NA
AZK45173.1|477564_478041_-	hypothetical protein	NA	NA	NA	NA	NA
AZK45174.1|478340_478535_+	hypothetical protein	NA	NA	NA	NA	NA
AZK45175.1|478949_479162_-	hypothetical protein	NA	NA	NA	NA	NA
AZK45176.1|479414_479876_+	hypothetical protein	NA	NA	NA	NA	NA
AZK45177.1|480057_480441_-	hypothetical protein	NA	NA	NA	NA	NA
AZK45178.1|480585_481497_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AZK45179.1|481517_481844_-|transposase	transposase	transposase	NA	NA	NA	NA
AZK45180.1|481995_482565_-	hypothetical protein	NA	NA	NA	NA	NA
AZK45181.1|482977_484273_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZK45182.1|484402_484996_-	hypothetical protein	NA	NA	NA	NA	NA
AZK45183.1|485548_486058_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZK45184.1|486950_487556_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZK45185.1|488099_488279_+	CopG family transcriptional regulator	NA	A0A0A8WED4	Clostridium_phage	47.3	1.6e-07
AZK45186.1|489241_489652_-	hypothetical protein	NA	NA	NA	NA	NA
AZK45187.1|489864_491058_-|transposase	transposase	transposase	NA	NA	NA	NA
AZK45188.1|491162_491747_-	hypothetical protein	NA	NA	NA	NA	NA
AZK45189.1|491853_492396_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZK45190.1|492652_492865_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZK45191.1|493022_493322_+	hypothetical protein	NA	NA	NA	NA	NA
AZK45192.1|493417_494611_-|transposase	transposase	transposase	NA	NA	NA	NA
AZK45193.1|494949_495525_-	hypothetical protein	NA	NA	NA	NA	NA
AZK45194.1|496016_496901_-	hypothetical protein	NA	NA	NA	NA	NA
AZK45195.1|497212_497539_+|transposase	transposase	transposase	NA	NA	NA	NA
AZK45196.1|497559_498471_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AZK45197.1|498562_499147_-	hypothetical protein	NA	NA	NA	NA	NA
AZK45198.1|499347_500040_-	hypothetical protein	NA	NA	NA	NA	NA
AZK45199.1|500214_501243_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZK45200.1|501298_502360_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	33.5	3.8e-24
>prophage 26
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	541816	542590	5288676		Planktothrix_phage(100.0%)	1	NA	NA
AZK45226.1|541816_542590_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.9	1.0e-26
>prophage 27
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	558766	561535	5288676		Bacillus_virus(100.0%)	1	NA	NA
AZK45238.1|558766_561535_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	37.4	2.4e-25
>prophage 28
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	583539	585462	5288676		Streptococcus_phage(100.0%)	1	NA	NA
AZK48834.1|583539_585462_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	27.8	4.9e-46
>prophage 29
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	589940	592573	5288676		Aeromonas_phage(50.0%)	3	NA	NA
AZK48835.1|589940_590153_-	TM2 domain-containing protein	NA	A0A240F358	Aeromonas_phage	56.9	6.7e-05
AZK45257.1|590272_591040_-	protein-glutamine gamma-glutamyltransferase	NA	NA	NA	NA	NA
AZK48836.1|591379_592573_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	39.6	1.5e-56
>prophage 30
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	618125	619829	5288676		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AZK45276.1|618125_619829_+	molecular chaperone HscC	NA	F2Y0P3	Organic_Lake_phycodnavirus	39.0	1.3e-93
>prophage 31
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	632533	633010	5288676		Molluscum_contagiosum_virus(100.0%)	1	NA	NA
AZK45287.1|632533_633010_+	glutathione peroxidase	NA	A0A1S7DLQ4	Molluscum_contagiosum_virus	29.7	3.2e-07
>prophage 32
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	639508	641494	5288676		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AZK45292.1|639508_641494_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	48.9	1.5e-13
>prophage 33
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	659131	661891	5288676		Vaccinia_virus(100.0%)	1	NA	NA
AZK45303.1|659131_661891_-	glycoside hydrolase family 2 protein	NA	B9U1V4	Vaccinia_virus	23.1	3.9e-20
>prophage 34
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	690992	693456	5288676		Microbacterium_phage(50.0%)	2	NA	NA
AZK45328.1|690992_691367_-	PH domain-containing protein	NA	A6N235	Microbacterium_phage	71.7	7.8e-41
AZK45329.1|691608_693456_-	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	28.5	4.3e-47
>prophage 35
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	726467	729881	5288676		Bacillus_phage(100.0%)	2	NA	NA
AZK45352.1|726467_727970_+	glycoside hydrolase family 32 protein	NA	S6ATV4	Bacillus_phage	27.1	6.0e-31
AZK45353.1|727982_729881_+	levanase	NA	S6ATV4	Bacillus_phage	37.4	2.7e-73
>prophage 36
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	745982	747512	5288676		Lactococcus_phage(100.0%)	1	NA	NA
AZK45367.1|745982_747512_-	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JNB4	Lactococcus_phage	31.0	6.7e-22
>prophage 37
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	759068	759827	5288676		Brazilian_cedratvirus(100.0%)	1	NA	NA
AZK45372.1|759068_759827_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.8	3.9e-15
>prophage 38
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	772097	782842	5288676		uncultured_Mediterranean_phage(25.0%)	11	NA	NA
AZK45387.1|772097_772823_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	28.5	3.0e-20
AZK45388.1|773021_773237_-	hypothetical protein	NA	NA	NA	NA	NA
AZK45389.1|773577_774600_+	hypothetical protein	NA	NA	NA	NA	NA
AZK45390.1|775190_776048_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	30.6	1.5e-07
AZK45391.1|776177_777167_+	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
AZK45392.1|777527_777713_-	hypothetical protein	NA	NA	NA	NA	NA
AZK45393.1|777915_778785_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
AZK45394.1|778806_779559_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	6.0e-32
AZK45395.1|779583_780261_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AZK45396.1|780241_780907_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AZK45397.1|781282_782842_+	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	30.8	7.6e-21
>prophage 39
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	787184	789099	5288676		uncultured_virus(50.0%)	2	NA	NA
AZK45400.1|787184_788345_-	5-methyltetrahydropteroyltriglutamate-- homocysteine methyltransferase	NA	A0A218MNE0	uncultured_virus	31.2	4.3e-45
AZK45401.1|788673_789099_-	HNH endonuclease	NA	A0A2H4JGM1	uncultured_Caudovirales_phage	47.3	3.4e-08
>prophage 40
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	792936	801471	5288676	transposase	Macacine_betaherpesvirus(33.33%)	4	NA	NA
AZK45405.1|792936_794089_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	40.9	5.6e-29
AZK45406.1|794181_796854_-	type III restriction endonuclease subunit R	NA	NA	NA	NA	NA
AZK45407.1|796850_798569_-	site-specific DNA-methyltransferase	NA	H6W8D6	Escherichia_phage	45.2	3.8e-98
AZK45408.1|798585_801471_-	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	42.9	2.3e-212
>prophage 41
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	806710	812426	5288676		Staphylococcus_phage(33.33%)	4	NA	NA
AZK45412.1|806710_807190_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	54.5	1.4e-42
AZK45413.1|807621_810240_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	41.4	1.1e-88
AZK45414.1|810536_810770_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
AZK45415.1|811139_812426_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	73.3	2.1e-173
>prophage 42
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	822076	822673	5288676		Agrobacterium_phage(100.0%)	1	NA	NA
AZK45424.1|822076_822673_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.6	4.0e-55
>prophage 43
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	829737	835115	5288676		Streptococcus_phage(50.0%)	6	NA	NA
AZK45431.1|829737_830706_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	8.0e-29
AZK45432.1|830973_831729_-	DUF541 domain-containing protein	NA	NA	NA	NA	NA
AZK45433.1|831902_832172_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AZK45434.1|832273_833212_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	37.3	4.5e-53
AZK45435.1|833217_834204_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	39.7	3.2e-57
AZK45436.1|834221_835115_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	33.6	8.5e-09
>prophage 44
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	838273	847179	5288676		Bacillus_phage(25.0%)	8	NA	NA
AZK45440.1|838273_838951_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.2	9.2e-32
AZK45441.1|838947_840384_+	sensor histidine kinase	NA	NA	NA	NA	NA
AZK45442.1|840487_841399_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.0	1.8e-46
AZK48847.1|841398_842112_+	permease	NA	NA	NA	NA	NA
AZK45443.1|842114_842849_+	hypothetical protein	NA	NA	NA	NA	NA
AZK45444.1|843028_843985_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	49.5	4.1e-70
AZK48848.1|844134_845844_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AZK45445.1|846231_847179_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	35.8	7.5e-48
>prophage 45
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	861028	862147	5288676		Bacillus_virus(100.0%)	1	NA	NA
AZK45460.1|861028_862147_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	33.7	4.0e-24
>prophage 46
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	872173	873943	5288676		Bacteriophage(100.0%)	1	NA	NA
AZK45465.1|872173_873943_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	35.5	3.2e-52
>prophage 47
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	882235	886359	5288676		Only_Syngen_Nebraska_virus(50.0%)	3	NA	NA
AZK45473.1|882235_883837_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.4	2.1e-151
AZK45474.1|884122_884665_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
AZK45475.1|885207_886359_+	peptidase S8	NA	A0A217EQY2	Bacillus_phage	39.3	4.0e-43
>prophage 48
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	898858	901177	5288676		Streptococcus_phage(100.0%)	1	NA	NA
AZK45485.1|898858_901177_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	41.2	5.0e-154
>prophage 49
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	905479	906781	5288676		Bacillus_phage(50.0%)	2	NA	NA
AZK45489.1|905479_905971_+	NlpC/P60 family protein	NA	A0A068EMN7	Bacillus_phage	39.8	4.5e-12
AZK45490.1|906304_906781_+	NlpC/P60 family protein	NA	A0A0A8WF62	Clostridium_phage	45.6	3.3e-20
>prophage 50
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	916929	923078	5288676	tRNA	uncultured_Mediterranean_phage(33.33%)	5	NA	NA
AZK45501.1|916929_918228_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.0	4.7e-93
AZK45502.1|918391_918976_-	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
AZK45503.1|919020_919902_-	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
AZK45504.1|920079_921489_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	31.3	2.1e-30
AZK45505.1|921620_923078_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.3	1.8e-101
>prophage 51
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	933852	935361	5288676	tRNA	Tupanvirus(100.0%)	1	NA	NA
AZK45508.1|933852_935361_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	42.0	8.5e-94
>prophage 52
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	938557	943633	5288676		Pandoravirus(50.0%)	5	NA	NA
AZK45513.1|938557_939394_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	31.5	1.6e-25
AZK45514.1|939452_940340_-	4-amino-4-deoxychorismate lyase	NA	NA	NA	NA	NA
AZK45515.1|940336_940918_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	58.6	7.6e-67
AZK45516.1|940914_942498_-	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	31.5	1.8e-38
AZK45517.1|942694_943633_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	58.3	1.3e-97
>prophage 53
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	949480	952268	5288676		Micromonas_pusilla_virus(50.0%)	2	NA	NA
AZK45523.1|949480_951625_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	G8DDJ2	Micromonas_pusilla_virus	43.6	1.2e-109
AZK45524.1|951728_952268_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	30.8	1.5e-13
>prophage 54
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	955694	961331	5288676		Tupanvirus(50.0%)	2	NA	NA
AZK45528.1|955694_959489_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	29.2	9.4e-65
AZK45529.1|959567_961331_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.4	3.4e-09
>prophage 55
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	966969	967242	5288676		Bacillus_phage(100.0%)	1	NA	NA
AZK45536.1|966969_967242_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	61.1	9.1e-23
>prophage 56
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	970954	971497	5288676		Paenibacillus_phage(100.0%)	1	NA	NA
AZK45538.1|970954_971497_-	stage V sporulation protein T	NA	A0A2I7SC16	Paenibacillus_phage	70.6	4.2e-11
>prophage 57
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	978230	980794	5288676		Hokovirus(50.0%)	2	NA	NA
AZK48857.1|978230_979184_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	35.3	1.7e-44
AZK45543.1|979393_980794_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.8	4.5e-33
>prophage 58
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	986692	997057	5288676	tRNA	Streptococcus_phage(50.0%)	12	NA	NA
AZK45552.1|986692_987829_-	DUF348 domain-containing protein	NA	A0A0H3UZG2	Geobacillus_virus	47.4	6.8e-11
AZK45553.1|988523_989291_-	TatD family deoxyribonuclease	NA	NA	NA	NA	NA
AZK45554.1|989308_990595_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.2	1.3e-23
AZK45555.1|990933_991188_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	69.2	2.2e-23
AZK45556.1|991361_992252_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	44.8	6.2e-60
AZK45557.1|992248_993016_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
AZK45558.1|993108_993489_-	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
AZK45559.1|993533_994334_-	stage 0 sporulation protein	NA	NA	NA	NA	NA
AZK45560.1|994458_995439_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	36.5	3.5e-24
AZK45561.1|995511_995955_-	DUF327 family protein	NA	NA	NA	NA	NA
AZK45562.1|996000_996330_-	hypothetical protein	NA	NA	NA	NA	NA
AZK45563.1|996412_997057_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	56.5	8.2e-54
>prophage 59
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1001639	1005332	5288676	transposase	Escherichia_phage(50.0%)	3	NA	NA
AZK45568.1|1001639_1002365_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	38.7	4.9e-39
AZK45569.1|1002366_1003941_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AZK45570.1|1003994_1005332_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	35.4	1.9e-65
>prophage 60
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1012658	1021361	5288676		Bacillus_virus(66.67%)	7	NA	NA
AZK45572.1|1012658_1015223_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	36.5	9.6e-114
AZK45573.1|1015572_1016352_+	YheC/YheD family protein	NA	NA	NA	NA	NA
AZK45574.1|1016517_1018431_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	47.5	6.6e-160
AZK45575.1|1018482_1018731_-	DUF370 domain-containing protein	NA	NA	NA	NA	NA
AZK45576.1|1018747_1019860_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
AZK45577.1|1019929_1020145_-	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
AZK45578.1|1020218_1021361_-	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	35.7	1.9e-21
>prophage 61
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1026193	1027093	5288676		Cyanophage(100.0%)	1	NA	NA
AZK45582.1|1026193_1027093_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	M4QGJ9	Cyanophage	38.3	5.8e-58
>prophage 62
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1035380	1040611	5288676	protease	Leptospira_phage(50.0%)	6	NA	NA
AZK45590.1|1035380_1036199_+	nucleoid occlusion protein	NA	S5VSZ7	Leptospira_phage	34.5	7.0e-18
AZK45591.1|1036441_1037203_+	ParA family protein	NA	Q8JL10	Natrialba_phage	29.3	1.4e-23
AZK45592.1|1037195_1038035_+	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	31.7	7.4e-15
AZK48858.1|1038349_1039507_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
AZK45593.1|1039530_1040031_+	DUF4446 family protein	NA	NA	NA	NA	NA
AZK45594.1|1040002_1040611_-|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	41.8	3.0e-21
>prophage 63
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1044282	1047373	5288676		Paenibacillus_phage(33.33%)	4	NA	NA
AZK45600.1|1044282_1044765_+	single-stranded DNA-binding protein	NA	A0A0K2CYR2	Paenibacillus_phage	63.4	1.0e-48
AZK45601.1|1044785_1045055_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
AZK45602.1|1045416_1046433_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	2.0e-14
AZK45603.1|1046437_1047373_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.0	1.5e-11
>prophage 64
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1056812	1081583	5288676		Bacillus_phage(33.33%)	19	NA	NA
AZK45611.1|1056812_1058174_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.9	8.7e-114
AZK45612.1|1058409_1059696_+	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	37.8	4.6e-72
AZK45613.1|1059850_1060645_+	hypothetical protein	NA	NA	NA	NA	NA
AZK45614.1|1060885_1062442_+	LysM peptidoglycan-binding domain-containing protein	NA	A8ATH6	Listeria_phage	49.5	7.1e-19
AZK45615.1|1062539_1063589_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AZK45616.1|1063585_1066696_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	24.5	7.7e-73
AZK45617.1|1066801_1068151_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	48.9	4.2e-68
AZK45618.1|1068147_1068834_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	57.0	1.7e-70
AZK45619.1|1069047_1069761_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	39.6	5.1e-41
AZK45620.1|1069762_1071586_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	36.2	7.5e-36
AZK45621.1|1071582_1072863_+	hypothetical protein	NA	NA	NA	NA	NA
AZK45622.1|1072892_1073642_+	hypothetical protein	NA	NA	NA	NA	NA
AZK45623.1|1073650_1074457_+	MBL fold metallo-hydrolase	NA	A0A2I7SDH3	Paenibacillus_phage	37.7	3.4e-41
AZK45624.1|1074425_1074632_-	hypothetical protein	NA	NA	NA	NA	NA
AZK45625.1|1075143_1076433_+	PDZ domain-containing protein	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	30.5	1.5e-11
AZK45626.1|1076586_1078194_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
AZK45627.1|1078358_1078526_+	CxxH/CxxC protein	NA	NA	NA	NA	NA
AZK45628.1|1078998_1080171_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.6	7.2e-40
AZK45629.1|1080215_1081583_+	glucarate dehydratase	NA	Q6A202	Oenococcus_phage	22.4	5.1e-05
>prophage 65
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1101645	1105288	5288676		Bacillus_phage(50.0%)	4	NA	NA
AZK45649.1|1101645_1102347_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	43.0	3.6e-39
AZK45650.1|1102514_1103219_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
AZK45651.1|1103247_1103769_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AZK45652.1|1103986_1105288_-	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	60.7	2.2e-135
>prophage 66
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1110887	1114583	5288676		Bacillus_virus(100.0%)	1	NA	NA
AZK45657.1|1110887_1114583_+	AAA family ATPase	NA	G3MAX6	Bacillus_virus	40.3	7.7e-48
>prophage 67
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1125003	1129567	5288676	transposase	uncultured_virus(50.0%)	5	NA	NA
AZK45667.1|1125003_1126224_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	52.4	3.7e-55
AZK45668.1|1126319_1126598_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AZK45669.1|1126770_1127430_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZK45670.1|1127449_1128139_-	diphthine--ammonia ligase	NA	NA	NA	NA	NA
AZK45671.1|1128805_1129567_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	47.9	1.1e-20
>prophage 68
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1134868	1135858	5288676		Staphylococcus_phage(100.0%)	1	NA	NA
AZK45676.1|1134868_1135858_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.4	9.7e-22
>prophage 69
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1145041	1146706	5288676		Lactobacillus_phage(50.0%)	2	NA	NA
AZK45684.1|1145041_1145932_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.4	5.5e-08
AZK45685.1|1145989_1146706_-	glycosyltransferase	NA	A0A0N9QZQ5	Chrysochromulina_ericina_virus	33.3	1.7e-23
>prophage 70
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1155870	1161449	5288676		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
AZK45694.1|1155870_1157928_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.4	1.0e-09
AZK48867.1|1158226_1159075_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
AZK45695.1|1159260_1160322_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
AZK45696.1|1160678_1161449_+	hypothetical protein	NA	A0A068EP98	Bacillus_phage	42.2	2.2e-29
>prophage 71
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1167031	1172850	5288676		Phormidium_phage(33.33%)	4	NA	NA
AZK48868.1|1167031_1168732_+	AAA family ATPase	NA	U5XGM6	Phormidium_phage	42.9	3.2e-97
AZK45703.1|1169024_1170968_-	ABC transporter permease	NA	NA	NA	NA	NA
AZK45704.1|1170957_1171719_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	5.5e-33
AZK45705.1|1171845_1172850_-	sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	23.0	5.8e-06
>prophage 72
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1185158	1191936	5288676		Enterobacteria_phage(50.0%)	5	NA	NA
AZK45714.1|1185158_1186973_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	29.0	5.4e-18
AZK45715.1|1187547_1188018_+	SRPBCC family protein	NA	NA	NA	NA	NA
AZK45716.1|1188157_1188772_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZK45717.1|1188976_1189783_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AZK45718.1|1189968_1191936_+	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	26.8	3.6e-36
>prophage 73
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1194962	1196759	5288676		Enterobacteria_phage(100.0%)	1	NA	NA
AZK45721.1|1194962_1196759_+	HAMP domain-containing protein	NA	Q9EYF3	Enterobacteria_phage	31.2	6.9e-18
>prophage 74
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1209308	1214499	5288676		Anomala_cuprea_entomopoxvirus(50.0%)	4	NA	NA
AZK45732.1|1209308_1210859_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.1	7.1e-11
AZK45733.1|1210851_1211922_+	ABC transporter permease	NA	NA	NA	NA	NA
AZK45734.1|1211925_1212879_+	ABC transporter permease	NA	NA	NA	NA	NA
AZK45735.1|1213212_1214499_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	27.5	2.7e-32
>prophage 75
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1218458	1220349	5288676		Bacillus_phage(100.0%)	2	NA	NA
AZK45739.1|1218458_1219328_-	aminoglycoside N(3)-acetyltransferase	NA	O64018	Bacillus_phage	35.9	2.0e-39
AZK45740.1|1219587_1220349_+	aminoglycoside N(3)-acetyltransferase	NA	O64018	Bacillus_phage	31.0	8.3e-13
>prophage 76
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1224205	1225258	5288676		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
AZK45744.1|1224205_1225258_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.4	3.1e-18
>prophage 77
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1238067	1238841	5288676		Pithovirus(100.0%)	1	NA	NA
AZK48872.1|1238067_1238841_-	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	25.4	8.1e-08
>prophage 78
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1242566	1245341	5288676		Oenococcus_phage(50.0%)	3	NA	NA
AZK45758.1|1242566_1244441_+	SLC13 family permease	NA	Q6A201	Oenococcus_phage	35.9	5.5e-18
AZK45759.1|1244637_1245150_+	hypothetical protein	NA	NA	NA	NA	NA
AZK45760.1|1245146_1245341_+	transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	52.6	1.2e-08
>prophage 79
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1255276	1257745	5288676		Bacillus_phage(100.0%)	1	NA	NA
AZK45767.1|1255276_1257745_+	glycoside hydrolase	NA	F8WPR5	Bacillus_phage	33.2	1.1e-63
>prophage 80
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1267847	1269671	5288676		Enterobacteria_phage(100.0%)	1	NA	NA
AZK45771.1|1267847_1269671_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	25.3	4.3e-15
>prophage 81
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1272865	1273798	5288676		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AZK48876.1|1272865_1273798_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	43.5	3.0e-09
>prophage 82
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1277783	1281906	5288676		Moraxella_phage(50.0%)	4	NA	NA
AZK45776.1|1277783_1279085_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.4	3.4e-51
AZK48878.1|1279287_1279809_+	hypothetical protein	NA	NA	NA	NA	NA
AZK45777.1|1280005_1280326_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AZK45778.1|1280505_1281906_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	41.4	4.6e-25
>prophage 83
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1286676	1287432	5288676		Staphylococcus_phage(100.0%)	1	NA	NA
AZK45782.1|1286676_1287432_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	3.3e-22
>prophage 84
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1293036	1294257	5288676	transposase	uncultured_virus(100.0%)	1	NA	NA
AZK45790.1|1293036_1294257_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	52.4	3.7e-55
>prophage 85
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1299480	1302006	5288676		Tupanvirus(50.0%)	2	NA	NA
AZK48879.1|1299480_1300935_+	catalase	NA	A0A2K9L572	Tupanvirus	53.6	4.9e-123
AZK45794.1|1301214_1302006_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	4.7e-19
>prophage 86
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1309155	1312757	5288676		Bodo_saltans_virus(50.0%)	2	NA	NA
AZK45800.1|1309155_1310892_+	thiol reductant ABC exporter subunit CydD	NA	A0A2H4UU96	Bodo_saltans_virus	29.8	7.4e-17
AZK48880.1|1310894_1312757_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	23.3	4.7e-17
>prophage 87
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1324224	1325445	5288676	transposase	uncultured_virus(100.0%)	1	NA	NA
AZK45809.1|1324224_1325445_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	52.4	3.7e-55
>prophage 88
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1328649	1337893	5288676		Bacillus_phage(50.0%)	6	NA	NA
AZK45812.1|1328649_1330377_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.8	3.4e-46
AZK45813.1|1330373_1332308_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.4	8.4e-54
AZK45814.1|1332675_1334550_+	ABC-F type ribosomal protection protein	NA	A0A2K9L3Z8	Tupanvirus	28.4	3.1e-45
AZK45815.1|1334844_1335189_-	hypothetical protein	NA	NA	NA	NA	NA
AZK45816.1|1335823_1336858_+	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZK45817.1|1336879_1337893_+	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	37.9	1.1e-60
>prophage 89
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1352641	1369980	5288676	tRNA	Escherichia_phage(28.57%)	15	NA	NA
AZK45829.1|1352641_1353883_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.5	6.0e-13
AZK45830.1|1354242_1355076_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AZK45831.1|1355115_1355754_+	ThuA domain-containing protein	NA	NA	NA	NA	NA
AZK45832.1|1355887_1357297_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.4	1.5e-60
AZK45833.1|1357448_1358264_+	D-alanyl-D-alanine carboxypeptidase family protein	NA	NA	NA	NA	NA
AZK45834.1|1358475_1359327_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.0	7.1e-13
AZK48885.1|1359375_1360188_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
AZK45835.1|1360228_1360864_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AZK45836.1|1361111_1362473_+	NADH oxidase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.6	1.2e-17
AZK45837.1|1362656_1363478_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
AZK45838.1|1363744_1365820_+	molybdopterin oxidoreductase family protein	NA	A0A077SK27	Escherichia_phage	27.9	1.7e-60
AZK45839.1|1366000_1366516_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZK45840.1|1366721_1368449_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	53.9	1.1e-164
AZK45841.1|1368678_1368894_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
AZK45842.1|1369002_1369980_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	24.8	3.8e-10
>prophage 90
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1376768	1378508	5288676		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AZK45848.1|1376768_1378508_+	ATP-binding cassette domain-containing protein	NA	M1HRF1	Paramecium_bursaria_Chlorella_virus	23.1	3.2e-12
>prophage 91
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1395974	1397099	5288676		Pandoravirus(100.0%)	1	NA	NA
AZK48889.1|1395974_1397099_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	42.6	3.8e-54
>prophage 92
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1400286	1403666	5288676		Aeromonas_phage(50.0%)	3	NA	NA
AZK45862.1|1400286_1401537_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.8	1.6e-93
AZK45863.1|1401822_1402452_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AZK45864.1|1402499_1403666_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	25.9	1.1e-19
>prophage 93
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1418034	1420251	5288676		Pseudomonas_phage(50.0%)	3	NA	NA
AZK45877.1|1418034_1418970_+	stage II sporulation protein D	NA	Q2XU88	Pseudomonas_phage	34.8	2.8e-31
AZK45878.1|1419043_1419787_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
AZK45879.1|1419966_1420251_+	sporulation transcriptional regulator SpoIIID	NA	M9Q261	Clostridium_phage	45.3	6.8e-13
>prophage 94
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1424291	1426010	5288676		Streptococcus_phage(100.0%)	1	NA	NA
AZK45885.1|1424291_1426010_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	46.8	3.7e-146
>prophage 95
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1443718	1444921	5288676		Staphylococcus_phage(100.0%)	1	NA	NA
AZK45895.1|1443718_1444921_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	71.3	8.4e-161
>prophage 96
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1449672	1452855	5288676		Leptospira_phage(100.0%)	1	NA	NA
AZK45898.1|1449672_1452855_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	20.9	5.3e-45
>prophage 97
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1464982	1466965	5288676		Streptococcus_phage(100.0%)	1	NA	NA
AZK48894.1|1464982_1466965_+	hypothetical protein	NA	A0A1X9I5S6	Streptococcus_phage	43.7	2.3e-62
>prophage 98
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1482834	1483032	5288676		Lactococcus_phage(100.0%)	1	NA	NA
AZK45920.1|1482834_1483032_+	cold shock domain-containing protein	NA	Q9AZD3	Lactococcus_phage	67.7	1.7e-18
>prophage 99
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1486769	1488874	5288676		Pseudomonas_phage(50.0%)	2	NA	NA
AZK45923.1|1486769_1487879_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	37.1	7.1e-05
AZK45924.1|1487971_1488874_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	32.6	2.1e-31
>prophage 100
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1494019	1495255	5288676		Klosneuvirus(100.0%)	1	NA	NA
AZK45929.1|1494019_1495255_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.5	3.5e-29
>prophage 101
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1504302	1506300	5288676		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AZK45935.1|1504302_1506300_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.9	1.8e-06
>prophage 102
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1521901	1526402	5288676		Planktothrix_phage(33.33%)	4	NA	NA
AZK45944.1|1521901_1522588_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	35.1	4.5e-26
AZK45945.1|1522577_1523492_+	ABC transporter permease	NA	NA	NA	NA	NA
AZK48898.1|1523533_1524754_+	hypothetical protein	NA	Q8SBN9	Clostridium_phage	41.0	2.3e-20
AZK45946.1|1524956_1526402_+	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	33.0	2.7e-28
>prophage 103
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1532756	1543288	5288676		uncultured_Mediterranean_phage(33.33%)	5	NA	NA
AZK45951.1|1532756_1535615_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	58.6	0.0e+00
AZK45952.1|1535856_1537779_+	right-handed parallel beta-helix repeat-containing protein	NA	F8WPS8	Bacillus_phage	41.9	1.7e-126
AZK45953.1|1537968_1538181_+	hypothetical protein	NA	NA	NA	NA	NA
AZK45954.1|1538952_1540341_-	transcriptional regulator	NA	NA	NA	NA	NA
AZK45955.1|1540687_1543288_+	U32 family peptidase	NA	Q6DW11	Phage_TP	32.5	1.4e-27
>prophage 104
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1547719	1548310	5288676		Listeria_phage(100.0%)	1	NA	NA
AZK45961.1|1547719_1548310_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1S7FZ94	Listeria_phage	34.2	1.8e-15
>prophage 105
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1551682	1552576	5288676		Bacillus_phage(100.0%)	1	NA	NA
AZK45965.1|1551682_1552576_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.2	1.9e-80
>prophage 106
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1556092	1570828	5288676	transposase	Escherichia_phage(28.57%)	14	NA	NA
AZK45968.1|1556092_1556815_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	2.9e-15
AZK45969.1|1556819_1558322_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AZK45970.1|1558347_1559502_+	glycosyltransferase	NA	NA	NA	NA	NA
AZK45971.1|1559509_1561348_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.5	6.4e-11
AZK45972.1|1561363_1561774_+	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
AZK45973.1|1561793_1562747_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
AZK45974.1|1562721_1563381_+	HAD family hydrolase	NA	NA	NA	NA	NA
AZK45975.1|1563413_1564520_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	33.4	2.6e-39
AZK45976.1|1564549_1565449_+	hypothetical protein	NA	NA	NA	NA	NA
AZK45977.1|1565521_1566412_+	glucose-1-phosphate thymidylyltransferase	NA	A0A291LA53	Escherichia_phage	65.6	6.3e-105
AZK45978.1|1566574_1567123_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	44.5	7.0e-38
AZK45979.1|1567235_1568531_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZK45980.1|1568942_1569965_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.4	1.1e-79
AZK45981.1|1569961_1570828_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.6	4.1e-32
>prophage 107
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1577234	1581893	5288676		Bacillus_phage(50.0%)	2	NA	NA
AZK45985.1|1577234_1579553_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.2	1.8e-135
AZK45986.1|1579883_1581893_+	NAD-dependent DNA ligase LigA	NA	Q332J4	Clostridium_botulinum_C_phage	33.7	7.3e-93
>prophage 108
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1585153	1586392	5288676	transposase	Streptococcus_phage(100.0%)	1	NA	NA
AZK45989.1|1585153_1586392_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	41.9	6.8e-65
>prophage 109
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1599754	1602202	5288676	protease	Enterobacteria_phage(100.0%)	1	NA	NA
AZK45996.1|1599754_1602202_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	39.7	2.3e-133
>prophage 110
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1611787	1613191	5288676	tRNA	Moumouvirus(100.0%)	1	NA	NA
AZK46004.1|1611787_1613191_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	28.9	1.9e-47
>prophage 111
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1616689	1617223	5288676		Bacillus_virus(100.0%)	1	NA	NA
AZK46009.1|1616689_1617223_+	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	31.3	7.5e-13
>prophage 112
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1621122	1633682	5288676		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
AZK46015.1|1621122_1624668_+	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	22.6	1.1e-48
AZK46016.1|1624852_1628470_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	25.5	1.2e-61
AZK46017.1|1628920_1629172_+	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
AZK46018.1|1629318_1629738_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
AZK46019.1|1629795_1630266_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
AZK46020.1|1630316_1632395_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.8	5.7e-64
AZK46021.1|1632488_1633682_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.2	4.8e-15
>prophage 113
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1653218	1654388	5288676		Tupanvirus(100.0%)	1	NA	NA
AZK46056.1|1653218_1654388_+	sulfate adenylyltransferase	NA	A0A2K9L4R9	Tupanvirus	29.8	2.7e-47
>prophage 114
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1678741	1680574	5288676		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AZK46070.1|1678741_1680574_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HVL7	Paramecium_bursaria_Chlorella_virus	40.2	4.0e-114
>prophage 115
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1698472	1724468	5288676		Tupanvirus(50.0%)	4	NA	NA
AZK46072.1|1698472_1701787_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.3	6.4e-86
AZK46073.1|1701776_1703603_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	4.0e-53
AZK46074.1|1703599_1705333_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	1.2e-51
AZK46075.1|1705475_1724468_+	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	28.3	6.5e-183
>prophage 116
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1731137	1731857	5288676		Staphylococcus_phage(100.0%)	1	NA	NA
AZK46079.1|1731137_1731857_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.2	7.5e-32
>prophage 117
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1746770	1750898	5288676		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AZK46087.1|1746770_1750898_+	glycosyl hydrolase family protein	NA	M1I0X9	Acanthocystis_turfacea_Chlorella_virus	38.1	1.6e-38
>prophage 118
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1765484	1767260	5288676		Enterobacteria_phage(100.0%)	1	NA	NA
AZK46101.1|1765484_1767260_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.2	4.4e-25
>prophage 119
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1797227	1798529	5288676		Geobacillus_virus(100.0%)	1	NA	NA
AZK46120.1|1797227_1798529_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	60.5	9.8e-131
>prophage 120
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1802944	1817508	5288676		Hokovirus(28.57%)	13	NA	NA
AZK46125.1|1802944_1804444_-	sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	28.6	1.6e-15
AZK46126.1|1804440_1805124_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.0	6.0e-39
AZK46127.1|1805354_1806287_+	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
AZK46128.1|1807275_1809654_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	35.0	1.9e-63
AZK46129.1|1809807_1811364_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	55.1	1.8e-131
AZK46130.1|1811443_1811752_-	hypothetical protein	NA	NA	NA	NA	NA
AZK46131.1|1811991_1812708_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	28.0	5.8e-08
AZK46132.1|1812751_1813315_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZK46133.1|1813676_1814246_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
AZK46134.1|1814520_1814778_+	DUF3886 domain-containing protein	NA	NA	NA	NA	NA
AZK46135.1|1814824_1815406_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.0	3.7e-13
AZK46136.1|1815506_1816430_-	AEC family transporter	NA	NA	NA	NA	NA
AZK46137.1|1816617_1817508_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.2	1.4e-19
>prophage 121
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1821921	1824416	5288676		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
AZK46142.1|1821921_1822782_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.1	4.6e-12
AZK46143.1|1823123_1824416_+	homocysteine synthase	NA	A0A0B5JD48	Pandoravirus	28.0	7.4e-22
>prophage 122
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1830221	1833289	5288676		Streptococcus_phage(50.0%)	2	NA	NA
AZK46146.1|1830221_1832159_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	41.2	6.3e-118
AZK46147.1|1832338_1833289_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	49.2	8.9e-73
>prophage 123
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1842246	1846994	5288676		Tupanvirus(50.0%)	4	NA	NA
AZK46152.1|1842246_1843872_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	28.9	4.4e-56
AZK46153.1|1843974_1844163_-	hypothetical protein	NA	NA	NA	NA	NA
AZK46154.1|1844357_1845230_+	cation transporter	NA	NA	NA	NA	NA
AZK46155.1|1845290_1846994_-	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	32.3	1.4e-65
>prophage 124
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1852395	1861533	5288676		Bacillus_phage(50.0%)	7	NA	NA
AZK46165.1|1852395_1853565_+	fused response regulator/phosphatase	NA	W8CYM9	Bacillus_phage	29.3	7.7e-10
AZK46166.1|1853561_1857233_+	response regulator	NA	A0A1V0SGX0	Hokovirus	37.1	2.3e-31
AZK46167.1|1857304_1858177_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
AZK46168.1|1858209_1859901_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	37.7	1.6e-64
AZK46169.1|1859953_1860292_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
AZK46170.1|1860310_1860763_+	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
AZK46171.1|1860759_1861533_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0Y0AU18	Bacillus_phage	28.8	2.6e-14
>prophage 125
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1866315	1867753	5288676	protease	Bacillus_virus(50.0%)	2	NA	NA
AZK46178.1|1866315_1866855_+|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	45.4	8.7e-17
AZK46179.1|1866952_1867753_+	alpha/beta hydrolase	NA	A0A2K9KZN8	Tupanvirus	27.9	2.4e-10
>prophage 126
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1876892	1877810	5288676		Staphylococcus_phage(100.0%)	1	NA	NA
AZK46192.1|1876892_1877810_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.9	8.7e-25
>prophage 127
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1905146	1908518	5288676		Synechococcus_phage(50.0%)	2	NA	NA
AZK46210.1|1905146_1906694_+	glucose-6-phosphate dehydrogenase	NA	C7BV85	Synechococcus_phage	37.3	3.5e-87
AZK46211.1|1906934_1908518_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	34.3	4.5e-13
>prophage 128
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1913878	1923000	5288676		Bacillus_virus(83.33%)	6	NA	NA
AZK46218.1|1913878_1916452_-	hypothetical protein	NA	A0A217EQY2	Bacillus_phage	38.5	6.6e-38
AZK46219.1|1916683_1917460_+	NUDIX domain-containing protein	NA	G3MA14	Bacillus_virus	41.5	2.1e-35
AZK48929.1|1917529_1918108_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	43.1	9.6e-30
AZK46220.1|1918104_1919616_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	47.2	3.3e-114
AZK46221.1|1919674_1920502_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	59.3	5.0e-88
AZK48930.1|1920705_1923000_+	ATP-dependent helicase	NA	G3MA40	Bacillus_virus	26.5	6.3e-48
>prophage 129
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1935177	1935405	5288676		Bacillus_phage(100.0%)	1	NA	NA
AZK46234.1|1935177_1935405_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	50.7	2.1e-09
>prophage 130
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1949161	1949920	5288676		Brazilian_cedratvirus(100.0%)	1	NA	NA
AZK46245.1|1949161_1949920_+	metal ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.2	1.0e-18
>prophage 131
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1959672	1960689	5288676		Planktothrix_phage(100.0%)	1	NA	NA
AZK46255.1|1959672_1960689_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	5.4e-28
>prophage 132
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1969286	1970248	5288676		Lake_Baikal_phage(50.0%)	2	NA	NA
AZK46264.1|1969286_1969643_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	42.7	3.7e-16
AZK46265.1|1970041_1970248_+	hypothetical protein	NA	D6R430	Bacillus_phage	60.0	3.5e-11
>prophage 133
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1973506	1974508	5288676		Streptococcus_phage(100.0%)	1	NA	NA
AZK46271.1|1973506_1974508_-	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	45.6	1.4e-23
>prophage 134
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	1982892	1984705	5288676		Brevibacillus_phage(50.0%)	3	NA	NA
AZK46282.1|1982892_1983846_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	36.2	6.4e-47
AZK46283.1|1983980_1984136_-	YqzM family protein	NA	NA	NA	NA	NA
AZK46284.1|1984387_1984705_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	41.9	2.9e-20
>prophage 135
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2004939	2010582	5288676	transposase	Brazilian_cedratvirus(33.33%)	5	NA	NA
AZK46298.1|2004939_2005716_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.4	1.8e-10
AZK46299.1|2005712_2006441_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	4.9e-15
AZK46300.1|2007273_2007831_+	hypothetical protein	NA	NA	NA	NA	NA
AZK46301.1|2007817_2009053_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
AZK46302.1|2009361_2010582_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	52.4	3.7e-55
>prophage 136
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2018486	2019404	5288676		Clostridium_botulinum_C_phage(100.0%)	1	NA	NA
AZK46306.1|2018486_2019404_+	MBL fold metallo-hydrolase	NA	Q332C0	Clostridium_botulinum_C_phage	22.1	1.9e-08
>prophage 137
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2025306	2029994	5288676		Planktothrix_phage(50.0%)	3	NA	NA
AZK46312.1|2025306_2026053_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	1.6e-29
AZK46313.1|2026535_2028173_-	response regulator	NA	NA	NA	NA	NA
AZK46314.1|2028179_2029994_-	HAMP domain-containing protein	NA	Q9EYF3	Enterobacteria_phage	28.8	1.2e-14
>prophage 138
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2035469	2039999	5288676		Pandoravirus(50.0%)	5	NA	NA
AZK46319.1|2035469_2036819_+	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	31.4	3.0e-66
AZK46320.1|2036955_2037786_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
AZK46321.1|2037735_2038461_-	HAD family hydrolase	NA	NA	NA	NA	NA
AZK46322.1|2038536_2039343_-	TPM domain-containing protein	NA	NA	NA	NA	NA
AZK46323.1|2039345_2039999_-	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	35.6	9.5e-18
>prophage 139
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2051933	2053100	5288676		Bacillus_phage(100.0%)	1	NA	NA
AZK46331.1|2051933_2053100_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.9	1.1e-21
>prophage 140
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2069580	2071485	5288676		Bacillus_phage(100.0%)	1	NA	NA
AZK46342.1|2069580_2071485_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	23.7	1.0e-11
>prophage 141
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2098037	2098502	5288676		Clostridium_phage(100.0%)	1	NA	NA
AZK46360.1|2098037_2098502_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	59.4	3.3e-41
>prophage 142
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2103562	2108759	5288676		Escherichia_phage(100.0%)	2	NA	NA
AZK46367.1|2103562_2107237_+	nitrate reductase subunit alpha	NA	A0A077SK27	Escherichia_phage	27.7	1.2e-13
AZK46368.1|2107226_2108759_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	49.5	4.4e-21
>prophage 143
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2116961	2135048	5288676	tRNA	Bacillus_phage(25.0%)	18	NA	NA
AZK46376.1|2116961_2118656_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	60.7	5.0e-10
AZK46377.1|2118806_2119376_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
AZK48956.1|2119775_2120387_+	cell wall hydrolase	NA	U5PWL4	Bacillus_phage	45.6	6.8e-18
AZK46378.1|2120377_2121532_-	UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase	NA	NA	NA	NA	NA
AZK46379.1|2121794_2122214_-	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
AZK46380.1|2122246_2123215_-	M23 family metallopeptidase	NA	A0A292GJG6	Xanthomonas_phage	39.8	9.8e-19
AZK46381.1|2123394_2124825_+	cardiolipin synthase	NA	NA	NA	NA	NA
AZK46382.1|2124851_2125736_-	DNA polymerase domain-containing protein	NA	NA	NA	NA	NA
AZK46383.1|2125951_2126899_+	DNA ligase	NA	A0A068CDF3	Rhizobium_phage	26.9	7.3e-27
AZK46384.1|2126903_2127833_-	Ku protein	NA	A0A218M9C0	Mycobacterium_phage	35.5	1.7e-39
AZK48957.1|2128114_2128579_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
AZK46385.1|2128575_2129400_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AZK46386.1|2129421_2129946_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
AZK46387.1|2129936_2130968_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	37.9	1.6e-59
AZK46388.1|2131061_2131475_-	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
AZK46389.1|2131474_2132497_-	peptidase M23	NA	G9BW84	Planktothrix_phage	40.2	3.7e-16
AZK48958.1|2132797_2133616_+	vancomycin resistance protein	NA	NA	NA	NA	NA
AZK46390.1|2134241_2135048_+	aminoglycoside N(3)-acetyltransferase	NA	O64018	Bacillus_phage	44.7	1.7e-53
>prophage 144
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2141128	2142913	5288676		Enterobacteria_phage(100.0%)	1	NA	NA
AZK46395.1|2141128_2142913_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	27.9	1.3e-16
>prophage 145
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2148008	2152705	5288676		Streptococcus_phage(33.33%)	3	NA	NA
AZK46399.1|2148008_2148932_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	54.1	2.0e-82
AZK46400.1|2149115_2150003_-	hypothetical protein	NA	H6WFX3	Cyanophage	60.0	2.1e-07
AZK46401.1|2150740_2152705_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	1.1e-56
>prophage 146
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2156185	2161274	5288676	integrase	uncultured_virus(50.0%)	5	2155685:2155698	2164414:2164427
2155685:2155698	attL	GCTGCGGAAAATGA	NA	NA	NA	NA
AZK46407.1|2156185_2156467_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.3	1.5e-20
AZK46408.1|2156528_2158148_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.0	6.4e-156
AZK46409.1|2158228_2159236_-|integrase	site-specific integrase	integrase	A0A0C5AN64	Paenibacillus_phage	39.6	1.6e-48
AZK46410.1|2160432_2160768_+	hypothetical protein	NA	NA	NA	NA	NA
AZK46411.1|2160812_2161274_+	ASCH domain-containing protein	NA	A0A1B3B1K5	Gordonia_phage	34.4	2.3e-10
2164414:2164427	attR	TCATTTTCCGCAGC	NA	NA	NA	NA
>prophage 147
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2166380	2168216	5288676		Brevibacillus_phage(50.0%)	2	NA	NA
AZK46417.1|2166380_2167247_+	hypothetical protein	NA	A0A0K2CNX3	Brevibacillus_phage	43.8	2.7e-12
AZK46418.1|2167805_2168216_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	46.1	6.6e-09
>prophage 148
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2190967	2192182	5288676		Bacillus_virus(100.0%)	1	NA	NA
AZK46437.1|2190967_2192182_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.9	8.2e-31
>prophage 149
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2195583	2196936	5288676		Apis_mellifera_filamentous_virus(100.0%)	1	NA	NA
AZK48962.1|2195583_2196936_-	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	35.6	1.4e-23
>prophage 150
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2205420	2208109	5288676		Staphylococcus_phage(33.33%)	3	NA	NA
AZK46445.1|2205420_2206359_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	42.0	5.7e-40
AZK46446.1|2206430_2207393_-	sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.2	1.0e-15
AZK46447.1|2207389_2208109_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	32.1	7.5e-32
>prophage 151
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2212830	2213181	5288676		Lactobacillus_phage(100.0%)	1	NA	NA
AZK46451.1|2212830_2213181_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A2P0ZKX3	Lactobacillus_phage	40.4	4.0e-15
>prophage 152
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2221403	2222441	5288676		Enterobacteria_phage(100.0%)	1	NA	NA
AZK46457.1|2221403_2222441_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.7	2.6e-33
>prophage 153
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2234419	2234911	5288676		Molluscum_contagiosum_virus(100.0%)	1	NA	NA
AZK46467.1|2234419_2234911_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	36.2	8.2e-14
>prophage 154
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2239652	2241512	5288676	protease	Agrobacterium_phage(50.0%)	2	NA	NA
AZK46471.1|2239652_2240243_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.2	2.3e-55
AZK46472.1|2240255_2241512_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.8	8.5e-148
>prophage 155
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2246619	2253131	5288676	protease	Moraxella_phage(66.67%)	5	NA	NA
AZK46474.1|2246619_2248329_+|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	26.5	3.3e-17
AZK46475.1|2248652_2250989_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.1	2.3e-178
AZK46476.1|2251004_2251625_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
AZK46477.1|2251834_2252422_+	non-ribosomal peptide synthetase module	NA	NA	NA	NA	NA
AZK46478.1|2252732_2253131_+	adenosylmethionine decarboxylase	NA	A0A222YVV4	Synechococcus_phage	36.2	9.0e-19
>prophage 156
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2261000	2261861	5288676		Bodo_saltans_virus(100.0%)	1	NA	NA
AZK48969.1|2261000_2261861_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	26.7	2.0e-07
>prophage 157
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2271170	2273840	5288676	tRNA	Klosneuvirus(100.0%)	1	NA	NA
AZK46487.1|2271170_2273840_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	42.7	1.6e-172
>prophage 158
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2277590	2279513	5288676		Brazilian_cedratvirus(100.0%)	1	NA	NA
AZK46491.1|2277590_2279513_-	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.7	1.8e-16
>prophage 159
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2301565	2303158	5288676		Bacillus_phage(100.0%)	1	NA	NA
AZK46514.1|2301565_2303158_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A222Z0F1	Bacillus_phage	31.0	4.4e-08
>prophage 160
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2313862	2321123	5288676	transposase	Staphylococcus_phage(40.0%)	6	NA	NA
AZK46517.1|2313862_2315015_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	40.9	5.6e-29
AZK46518.1|2315626_2316556_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	42.8	2.3e-41
AZK46519.1|2316548_2317238_+	hypothetical protein	NA	NA	NA	NA	NA
AZK46520.1|2318476_2319175_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	37.3	4.6e-34
AZK46521.1|2319177_2320101_+	sensor histidine kinase	NA	A0A1B0VMK3	Pseudomonas_phage	23.8	9.1e-06
AZK46522.1|2320199_2321123_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.4	3.3e-40
>prophage 161
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2333260	2334265	5288676		Bacillus_phage(100.0%)	1	NA	NA
AZK48973.1|2333260_2334265_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.1	1.6e-08
>prophage 162
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2337495	2338991	5288676	tRNA	uncultured_Mediterranean_phage(100.0%)	2	NA	NA
AZK48975.1|2337495_2338635_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.0	7.6e-87
AZK46534.1|2338670_2338991_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	42.9	2.4e-06
>prophage 163
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2343821	2348828	5288676		uncultured_Mediterranean_phage(33.33%)	4	NA	NA
AZK46540.1|2343821_2344724_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.0	9.1e-35
AZK46541.1|2344824_2345784_+	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
AZK46542.1|2345826_2348247_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	32.9	2.5e-87
AZK46543.1|2348315_2348828_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	42.3	1.2e-26
>prophage 164
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2352054	2362402	5288676	tRNA	Enterobacteria_phage(25.0%)	8	NA	NA
AZK46544.1|2352054_2353344_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	39.3	2.6e-67
AZK46545.1|2353508_2353859_-	hypothetical protein	NA	NA	NA	NA	NA
AZK46546.1|2354151_2356326_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	41.0	1.4e-09
AZK46547.1|2356364_2356829_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
AZK46548.1|2357223_2357733_+	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
AZK46549.1|2357783_2358245_+	hypothetical protein	NA	NA	NA	NA	NA
AZK46550.1|2358876_2360121_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	26.8	2.3e-20
AZK46551.1|2360620_2362402_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2I2L4Y8	Orpheovirus	26.9	1.1e-12
>prophage 165
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2380412	2381729	5288676		Bacillus_virus(100.0%)	1	NA	NA
AZK46563.1|2380412_2381729_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	48.7	1.9e-102
>prophage 166
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2389537	2399450	5288676	tRNA	Phage_TP(50.0%)	9	NA	NA
AZK46572.1|2389537_2392162_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	36.1	5.7e-69
AZK46573.1|2392292_2392553_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
AZK46574.1|2392562_2392979_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
AZK46575.1|2392990_2393299_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
AZK46576.1|2393298_2393598_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
AZK48980.1|2393693_2394725_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
AZK46577.1|2394741_2395680_+	U32 family peptidase	NA	Q6DW11	Phage_TP	28.8	2.5e-19
AZK46578.1|2395702_2397037_+	U32 family peptidase	NA	Q6DW11	Phage_TP	34.4	1.6e-43
AZK46579.1|2397278_2399450_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.0	2.5e-14
>prophage 167
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2409608	2410358	5288676		Bacillus_phage(100.0%)	1	NA	NA
AZK48982.1|2409608_2410358_+	NAD-dependent protein deacylase	NA	S5M4R0	Bacillus_phage	29.5	3.8e-26
>prophage 168
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2413738	2414731	5288676		Tupanvirus(100.0%)	1	NA	NA
AZK46589.1|2413738_2414731_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	39.0	9.3e-57
>prophage 169
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2418505	2420119	5288676		Orpheovirus(100.0%)	1	NA	NA
AZK48985.1|2418505_2420119_+	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	27.6	2.0e-08
>prophage 170
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2450297	2454643	5288676		Dickeya_phage(50.0%)	4	NA	NA
AZK48986.1|2450297_2451284_+	pectate lyase	NA	A0A140XB77	Dickeya_phage	35.9	2.2e-13
AZK46613.1|2451442_2452393_+	radical SAM protein	NA	NA	NA	NA	NA
AZK46614.1|2452536_2453649_-	ABC transporter permease	NA	NA	NA	NA	NA
AZK46615.1|2453620_2454643_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.3	3.9e-26
>prophage 171
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2475216	2476962	5288676		Enterobacteria_phage(100.0%)	1	NA	NA
AZK46629.1|2475216_2476962_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	30.3	2.7e-19
>prophage 172
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2491870	2492899	5288676		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
AZK46639.1|2491870_2492899_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	43.0	1.3e-61
>prophage 173
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2495997	2501301	5288676		Bacillus_phage(33.33%)	4	NA	NA
AZK46641.1|2495997_2496696_+	RNA polymerase sporulation sigma factor SigK	NA	S6ANS0	Bacillus_phage	29.3	6.8e-14
AZK46642.1|2496919_2498638_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	25.4	9.9e-06
AZK46643.1|2499249_2500182_+	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AZK46644.1|2500455_2501301_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.7	3.8e-19
>prophage 174
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2505091	2508277	5288676		Tupanvirus(100.0%)	1	NA	NA
AZK46647.1|2505091_2508277_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	26.9	6.2e-86
>prophage 175
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2511659	2571495	5288676	transposase	uncultured_Caudovirales_phage(40.0%)	52	NA	NA
AZK46650.1|2511659_2512334_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	47.3	5.9e-55
AZK46651.1|2512330_2513728_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	38.2	3.0e-45
AZK46652.1|2513837_2515031_+|transposase	transposase	transposase	NA	NA	NA	NA
AZK46653.1|2515336_2516617_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZK46654.1|2516720_2517563_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
AZK46655.1|2517562_2518453_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AZK46656.1|2518597_2520463_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	30.4	1.8e-13
AZK46657.1|2520440_2522057_+	response regulator	NA	NA	NA	NA	NA
AZK46658.1|2522090_2522603_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZK46659.1|2522700_2523798_-	glycoside hydrolase 105 family protein	NA	NA	NA	NA	NA
AZK46660.1|2523941_2524775_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZK46661.1|2524895_2525777_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.8	9.2e-24
AZK46662.1|2525773_2526868_+	hypothetical protein	NA	NA	NA	NA	NA
AZK46663.1|2526864_2527560_+	hypothetical protein	NA	NA	NA	NA	NA
AZK46664.1|2527689_2528160_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZK46665.1|2528426_2530121_-	hydroxylamine reductase	NA	NA	NA	NA	NA
AZK46666.1|2530357_2532208_+	sensor histidine kinase	NA	NA	NA	NA	NA
AZK46667.1|2532200_2533304_+	response regulator	NA	NA	NA	NA	NA
AZK46668.1|2533454_2534774_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
AZK46669.1|2534857_2535733_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
AZK46670.1|2535759_2536587_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
AZK46671.1|2536666_2536864_-	hypothetical protein	NA	NA	NA	NA	NA
AZK46672.1|2536924_2538547_+	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
AZK46673.1|2538595_2539642_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZK46674.1|2540355_2541492_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
AZK46675.1|2541493_2543263_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
AZK46676.1|2543508_2543835_-	hypothetical protein	NA	NA	NA	NA	NA
AZK46677.1|2543841_2544435_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	32.4	4.8e-16
AZK46678.1|2544546_2544900_-	XRE family transcriptional regulator	NA	A0A1L2JY18	Aeribacillus_phage	40.6	8.5e-13
AZK46679.1|2545190_2545688_+	transcriptional regulator	NA	A0A0S2GLJ9	Bacillus_phage	39.3	2.3e-19
AZK48991.1|2545830_2546550_+	hypothetical protein	NA	NA	NA	NA	NA
AZK46680.1|2546553_2548059_+	hypothetical protein	NA	NA	NA	NA	NA
AZK46681.1|2548067_2549195_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
AZK46682.1|2549214_2549703_+	hypothetical protein	NA	NA	NA	NA	NA
AZK48992.1|2549810_2550113_+	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
AZK46683.1|2550128_2555999_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	37.9	1.4e-22
AZK46684.1|2556014_2556290_+	hypothetical protein	NA	NA	NA	NA	NA
AZK46685.1|2557146_2557527_+	hypothetical protein	NA	NA	NA	NA	NA
AZK46686.1|2557766_2558618_+	hypothetical protein	NA	NA	NA	NA	NA
AZK46687.1|2558709_2559621_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AZK46688.1|2559641_2559968_-|transposase	transposase	transposase	NA	NA	NA	NA
AZK48993.1|2560039_2560396_+	hypothetical protein	NA	NA	NA	NA	NA
AZK46689.1|2560413_2560869_+	hypothetical protein	NA	NA	NA	NA	NA
AZK46690.1|2562476_2563772_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZK46691.1|2564180_2564618_+	hypothetical protein	NA	NA	NA	NA	NA
AZK46692.1|2564855_2565938_+	hypothetical protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	33.3	1.3e-22
AZK46693.1|2565939_2566182_+	hypothetical protein	NA	NA	NA	NA	NA
AZK46694.1|2566476_2567307_+	hypothetical protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	44.4	5.3e-21
AZK46695.1|2567310_2567631_+	hypothetical protein	NA	NA	NA	NA	NA
AZK46696.1|2567954_2568374_+	hypothetical protein	NA	NA	NA	NA	NA
AZK46697.1|2568463_2569759_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZK46698.1|2570301_2571495_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 176
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2574878	2578397	5288676		Bacillus_virus(33.33%)	5	NA	NA
AZK46701.1|2574878_2575595_-	N-acetylmuramoyl-L-alanine amidase	NA	U5PWK4	Bacillus_virus	48.9	2.2e-39
AZK46702.1|2575591_2575861_-	hypothetical protein	NA	NA	NA	NA	NA
AZK46703.1|2575892_2576171_-	hypothetical protein	NA	A0A0S2GM64	Bacillus_phage	44.6	8.7e-13
AZK46704.1|2576598_2577396_-	hypothetical protein	NA	NA	NA	NA	NA
AZK46705.1|2577392_2578397_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	46.8	2.5e-41
>prophage 177
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2581884	2586896	5288676	transposase	Streptococcus_phage(50.0%)	3	NA	NA
AZK46708.1|2581884_2583591_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	35.2	1.3e-74
AZK46709.1|2584872_2585157_+	hypothetical protein	NA	NA	NA	NA	NA
AZK46710.1|2585480_2586896_+	XRE family transcriptional regulator	NA	A0A0K2CP77	Brevibacillus_phage	31.7	2.3e-64
>prophage 178
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2590930	2592460	5288676		Bacillus_virus(100.0%)	1	NA	NA
AZK48996.1|2590930_2592460_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	27.6	5.9e-18
>prophage 179
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2596079	2597777	5288676		Paenibacillus_phage(100.0%)	1	NA	NA
AZK46717.1|2596079_2597777_+	AMIN domain-containing protein	NA	A0A0N9SGH1	Paenibacillus_phage	39.8	6.3e-21
>prophage 180
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2608122	2609361	5288676		Bacillus_phage(100.0%)	1	NA	NA
AZK46725.1|2608122_2609361_-	response regulator	NA	W8CYM9	Bacillus_phage	30.9	3.5e-05
>prophage 181
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2647569	2649357	5288676		Enterobacteria_phage(100.0%)	1	NA	NA
AZK46743.1|2647569_2649357_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	30.8	3.9e-21
>prophage 182
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2689527	2691291	5288676		Vaccinia_virus(100.0%)	1	NA	NA
AZK49007.1|2689527_2691291_+	glycoside hydrolase family 2	NA	B9U1V4	Vaccinia_virus	24.5	5.2e-34
>prophage 183
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2698029	2699427	5288676		Brevibacillus_phage(100.0%)	1	NA	NA
AZK46776.1|2698029_2699427_+	XRE family transcriptional regulator	NA	A0A0K2CP77	Brevibacillus_phage	35.1	1.1e-71
>prophage 184
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2713867	2714638	5288676		Escherichia_phage(100.0%)	1	NA	NA
AZK46788.1|2713867_2714638_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	33.7	8.9e-23
>prophage 185
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2717804	2725159	5288676	tRNA	Staphylococcus_phage(33.33%)	5	NA	NA
AZK46791.1|2717804_2720246_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	70.1	0.0e+00
AZK46792.1|2720262_2721144_-	late competence protein ComER	NA	NA	NA	NA	NA
AZK46793.1|2721218_2721851_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
AZK46794.1|2721866_2722385_+	dCMP deaminase family protein	NA	A0A222YXY3	Mycobacterium_phage	44.1	1.0e-22
AZK46795.1|2722489_2725159_+	ComEC family competence protein	NA	Q332C0	Clostridium_botulinum_C_phage	30.3	5.8e-29
>prophage 186
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2732087	2733155	5288676		Enterobacteria_phage(100.0%)	1	NA	NA
AZK49008.1|2732087_2733155_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	24.8	3.5e-17
>prophage 187
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2744000	2745818	5288676		Streptococcus_phage(100.0%)	1	NA	NA
AZK46811.1|2744000_2745818_+	elongation factor 4	NA	A0A1B0RXH7	Streptococcus_phage	25.6	7.2e-23
>prophage 188
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2749592	2756971	5288676		Chrysochromulina_ericina_virus(33.33%)	5	NA	NA
AZK46815.1|2749592_2751440_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	47.7	5.6e-140
AZK46816.1|2751589_2752708_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.4	1.3e-25
AZK46817.1|2752952_2754578_+	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
AZK46818.1|2754574_2755288_+	response regulator	NA	NA	NA	NA	NA
AZK49011.1|2755543_2756971_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	36.0	6.0e-49
>prophage 189
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2766006	2767377	5288676		Streptococcus_phage(100.0%)	1	NA	NA
AZK46830.1|2766006_2767377_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	22.6	2.1e-19
>prophage 190
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2771152	2784085	5288676		Bacillus_virus(40.0%)	9	NA	NA
AZK46832.1|2771152_2775157_+	helicase-exonuclease AddAB subunit AddA	NA	G3MA40	Bacillus_virus	23.8	9.1e-10
AZK46833.1|2775203_2776388_+	exonuclease SbcCD subunit D	NA	A0A076G8Y3	Bacillus_phage	33.0	1.5e-05
AZK46834.1|2776384_2779900_+	hypothetical protein	NA	G3MAB6	Bacillus_virus	25.9	1.2e-08
AZK46835.1|2780214_2780580_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
AZK46836.1|2780710_2780884_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AZK46837.1|2780900_2781344_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	37.4	5.0e-18
AZK46838.1|2781632_2781920_+	sporulation protein YqfC	NA	NA	NA	NA	NA
AZK46839.1|2781925_2783107_+	sporulation protein YqfD	NA	NA	NA	NA	NA
AZK46840.1|2783113_2784085_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.7	2.0e-48
>prophage 191
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2793681	2806383	5288676	tRNA	Helicobacter_phage(16.67%)	11	NA	NA
AZK46850.1|2793681_2795499_+	DNA primase	NA	A0A1S5RFI1	Helicobacter_phage	31.9	9.1e-42
AZK46851.1|2795544_2796675_+	RNA polymerase sigma factor RpoD	NA	F4YCU2	Synechococcus_phage	37.6	1.3e-38
AZK46852.1|2796856_2797636_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZK46853.1|2797611_2798727_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
AZK46854.1|2799378_2801301_-	peptidase S8	NA	A0A1B0T6A2	Bacillus_phage	37.4	4.0e-56
AZK46855.1|2801453_2801681_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
AZK46856.1|2801715_2802111_+	hypothetical protein	NA	NA	NA	NA	NA
AZK46857.1|2802270_2803014_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	49.0	1.5e-27
AZK46858.1|2803182_2804334_+	cysteine desulfurase	NA	H7BUW1	unidentified_phage	37.3	4.7e-28
AZK49015.1|2804338_2805571_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
AZK46859.1|2805729_2806383_+	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	35.7	4.3e-26
>prophage 192
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2810616	2813244	5288676		Bacillus_phage(100.0%)	3	NA	NA
AZK46864.1|2810616_2811069_+	hypothetical protein	NA	A0A127AW69	Bacillus_phage	34.3	2.7e-19
AZK46865.1|2811102_2811801_-	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
AZK46866.1|2811912_2813244_+	PhoH family protein	NA	A0A141HS37	Bacillus_phage	37.3	2.0e-75
>prophage 193
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2822710	2827753	5288676		Planktothrix_phage(33.33%)	4	NA	NA
AZK46876.1|2822710_2823706_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.3	1.9e-17
AZK46877.1|2823660_2824641_+	ATP-binding cassette domain-containing protein	NA	Q6GZ03	Mycoplasma_phage	34.1	4.9e-10
AZK46878.1|2824787_2826425_+	bacillithiol biosynthesis cysteine-adding enzyme BshC	NA	NA	NA	NA	NA
AZK46879.1|2826484_2827753_+	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	37.6	1.4e-70
>prophage 194
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2849036	2850621	5288676		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AZK46896.1|2849036_2849759_+	RNA polymerase sporulation sigma factor SigE	NA	A0A2H4JC68	uncultured_Caudovirales_phage	42.9	1.3e-20
AZK46897.1|2849838_2850621_+	RNA polymerase sporulation sigma factor SigG	NA	A0A0A0RV91	Bacillus_phage	42.0	2.9e-45
>prophage 195
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2855311	2867479	5288676	tRNA	Orpheovirus(25.0%)	10	NA	NA
AZK46903.1|2855311_2858407_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	33.8	2.1e-155
AZK49019.1|2858666_2858990_+	hypothetical protein	NA	NA	NA	NA	NA
AZK46904.1|2859022_2859760_-	molecular chaperone DnaK	NA	NA	NA	NA	NA
AZK46905.1|2859966_2860467_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
AZK46906.1|2860463_2861411_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.4	4.0e-09
AZK46907.1|2861599_2862868_+	LL-diaminopimelate aminotransferase	NA	NA	NA	NA	NA
AZK46908.1|2863270_2863816_+	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
AZK46909.1|2863817_2864735_+	aspartate carbamoyltransferase catalytic subunit	NA	M1I6M4	Paramecium_bursaria_Chlorella_virus	36.4	3.1e-30
AZK46910.1|2864838_2866122_+	dihydroorotase	NA	NA	NA	NA	NA
AZK46911.1|2866342_2867479_+	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	37.3	2.3e-59
>prophage 196
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2871514	2874922	5288676		Prochlorococcus_phage(50.0%)	3	NA	NA
AZK46914.1|2871514_2872156_+	orotate phosphoribosyltransferase	NA	R9S7H3	Prochlorococcus_phage	25.0	8.2e-06
AZK46915.1|2872223_2873855_-	glycoside hydrolase	NA	NA	NA	NA	NA
AZK46916.1|2874061_2874922_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	1.0e-35
>prophage 197
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2878898	2879792	5288676		Planktothrix_phage(100.0%)	1	NA	NA
AZK49020.1|2878898_2879792_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	7.1e-32
>prophage 198
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2885504	2889759	5288676		Sphenicid_alphaherpesvirus(50.0%)	3	NA	NA
AZK49021.1|2885504_2886191_+	uracil-DNA glycosylase	NA	A0A1R3T3N6	Sphenicid_alphaherpesvirus	43.8	2.0e-50
AZK46926.1|2886307_2888536_+	hypothetical protein	NA	NA	NA	NA	NA
AZK46927.1|2888862_2889759_+	MBL fold metallo-hydrolase	NA	Q332B9	Clostridium_botulinum_C_phage	45.4	1.1e-56
>prophage 199
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2893769	2894387	5288676		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
AZK46933.1|2893769_2894387_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	66.3	5.6e-76
>prophage 200
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2900632	2902651	5288676		Bacillus_phage(100.0%)	1	NA	NA
AZK46940.1|2900632_2902651_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	A0A127AWB9	Bacillus_phage	35.6	5.4e-19
>prophage 201
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2906502	2907237	5288676		Bacillus_phage(100.0%)	1	NA	NA
AZK46946.1|2906502_2907237_-	ribonuclease Z	NA	A0A0A0RUN7	Bacillus_phage	36.3	1.0e-39
>prophage 202
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2913070	2920132	5288676	transposase	Synechococcus_phage(33.33%)	6	NA	NA
AZK46952.1|2913070_2914480_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A1D7RI04	Synechococcus_phage	31.2	1.1e-34
AZK46953.1|2914557_2915711_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	40.9	5.6e-29
AZK49024.1|2915937_2916423_+	shikimate kinase	NA	NA	NA	NA	NA
AZK46954.1|2916447_2917737_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AZK46955.1|2917786_2918218_+	CoA-binding protein	NA	NA	NA	NA	NA
AZK46956.1|2918395_2920132_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	29.2	5.3e-15
>prophage 203
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2926050	2927775	5288676		Staphylococcus_phage(100.0%)	1	NA	NA
AZK46961.1|2926050_2927775_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	69.7	1.9e-198
>prophage 204
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2932893	2934840	5288676		Bacillus_phage(100.0%)	1	NA	NA
AZK46965.1|2932893_2934840_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.9	2.3e-19
>prophage 205
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2951625	2954433	5288676		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AZK46983.1|2951625_2954433_+	calcium-translocating P-type ATPase, SERCA-type	NA	M1HM40	Paramecium_bursaria_Chlorella_virus	30.1	1.6e-85
>prophage 206
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2958815	2965099	5288676	tRNA	Synechococcus_phage(50.0%)	6	NA	NA
AZK46988.1|2958815_2959388_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.3	1.3e-23
AZK49027.1|2959444_2959669_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AZK49028.1|2959781_2961011_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	35.0	2.0e-45
AZK46989.1|2961010_2963545_+	primosomal protein N'	NA	NA	NA	NA	NA
AZK46990.1|2963665_2964148_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.5	3.5e-17
AZK46991.1|2964154_2965099_+|tRNA	methionyl-tRNA formyltransferase	tRNA	M4QRX9	Synechococcus_phage	32.2	8.7e-12
>prophage 207
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2968964	2971139	5288676		Salmon_gill_poxvirus(100.0%)	1	NA	NA
AZK46994.1|2968964_2971139_+	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A0H4Y184	Salmon_gill_poxvirus	32.1	5.4e-25
>prophage 208
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2975844	2976714	5288676		Staphylococcus_phage(100.0%)	1	NA	NA
AZK47000.1|2975844_2976714_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	34.3	5.5e-13
>prophage 209
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	2989796	2992031	5288676		Bacillus_phage(50.0%)	2	NA	NA
AZK47008.1|2989796_2990606_+	response regulator	NA	W8CYM9	Bacillus_phage	27.8	8.2e-11
AZK47009.1|2990666_2992031_+	nucleotide sugar dehydrogenase	NA	M1IC36	Acanthocystis_turfacea_Chlorella_virus	31.8	1.3e-37
>prophage 210
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3003509	3004076	5288676		Bacillus_virus(100.0%)	1	NA	NA
AZK47022.1|3003509_3004076_+	FAD-binding protein	NA	G3MA85	Bacillus_virus	35.1	8.6e-07
>prophage 211
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3018385	3024854	5288676		Tetraselmis_virus(66.67%)	4	NA	NA
AZK47032.1|3018385_3020647_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	44.7	9.2e-185
AZK47033.1|3020702_3021446_+	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	30.6	3.0e-23
AZK47034.1|3021645_3023022_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
AZK47035.1|3023048_3024854_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	32.4	6.1e-22
>prophage 212
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3029493	3034333	5288676	tRNA	Staphylococcus_phage(33.33%)	4	NA	NA
AZK47039.1|3029493_3029760_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	59.7	2.4e-20
AZK47040.1|3030176_3032153_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	33.0	1.0e-99
AZK47041.1|3032556_3033543_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZK49034.1|3033589_3034333_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.1	1.2e-16
>prophage 213
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3038482	3039448	5288676		Klosneuvirus(100.0%)	1	NA	NA
AZK47046.1|3038482_3039448_+	patatin	NA	A0A1V0SKV5	Klosneuvirus	26.4	5.7e-19
>prophage 214
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3045401	3047831	5288676		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
AZK47053.1|3045401_3047831_+	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	41.4	7.7e-12
>prophage 215
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3058170	3060421	5288676		Enterococcus_phage(50.0%)	2	NA	NA
AZK47067.1|3058170_3059037_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	40.5	2.7e-44
AZK47068.1|3059059_3060421_+	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	33.5	2.1e-30
>prophage 216
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3069328	3070135	5288676		Bacillus_phage(100.0%)	1	NA	NA
AZK47075.1|3069328_3070135_+	sporulation transcription factor Spo0A	NA	W8CYM9	Bacillus_phage	28.9	6.1e-06
>prophage 217
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3073575	3074997	5288676		Erysipelothrix_phage(100.0%)	1	NA	NA
AZK47080.1|3073575_3074997_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	30.6	4.3e-47
>prophage 218
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3081990	3082560	5288676		Vibrio_phage(100.0%)	1	NA	NA
AZK47089.1|3081990_3082560_+	NUDIX hydrolase	NA	A0A1S6L1P8	Vibrio_phage	39.5	2.5e-06
>prophage 219
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3088864	3093692	5288676		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
AZK47097.1|3088864_3089776_+	site-specific tyrosine recombinase XerD	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	27.2	8.4e-20
AZK47098.1|3089844_3090672_+	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	43.8	5.2e-61
AZK47099.1|3090845_3092030_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
AZK47100.1|3092122_3092476_+	anti-sigma F factor antagonist	NA	NA	NA	NA	NA
AZK47101.1|3092472_3092925_+	anti-sigma F factor	NA	NA	NA	NA	NA
AZK47102.1|3092936_3093692_+	RNA polymerase sporulation sigma factor SigF	NA	A0A0Y0AU18	Bacillus_phage	56.1	2.6e-67
>prophage 220
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3098191	3135241	5288676	tail,holin	Brevibacillus_phage(20.83%)	31	NA	NA
AZK47107.1|3098191_3098629_+	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	44.8	5.8e-19
AZK47108.1|3098809_3099034_-	small acid-soluble spore protein Tlp	NA	NA	NA	NA	NA
AZK47109.1|3099369_3099834_-|holin	holin	holin	A0A0N7GFE6	Paenibacillus_phage	32.5	3.5e-14
AZK47110.1|3099897_3102735_-	DNRLRE domain-containing protein	NA	A0A0K2CP88	Brevibacillus_phage	25.2	1.2e-24
AZK47111.1|3102776_3104903_-	hypothetical protein	NA	A0A127AW61	Bacillus_phage	40.3	1.3e-18
AZK47112.1|3104915_3105515_-	hypothetical protein	NA	G3MAA3	Bacillus_virus	47.3	1.3e-45
AZK47113.1|3105585_3106047_-	hypothetical protein	NA	G3MAA2	Bacillus_virus	55.0	3.7e-40
AZK47114.1|3106092_3107244_-	hypothetical protein	NA	A0A1P8CWP7	Bacillus_phage	43.8	2.1e-20
AZK47115.1|3107256_3107892_-	hypothetical protein	NA	A0A0K2FM10	Brevibacillus_phage	31.1	2.0e-20
AZK47116.1|3107903_3108539_-	hypothetical protein	NA	NA	NA	NA	NA
AZK47117.1|3108554_3109172_-|tail	phage tail protein	tail	A0A1P8CWP8	Bacillus_phage	37.4	1.9e-20
AZK47118.1|3109215_3109674_-	hypothetical protein	NA	NA	NA	NA	NA
AZK47119.1|3109753_3113182_-	hypothetical protein	NA	A0A0K2FLF6	Brevibacillus_phage	27.5	7.1e-104
AZK47120.1|3113252_3118376_-	hypothetical protein	NA	A0A0H3V0Q1	Geobacillus_virus	35.7	1.4e-31
AZK47121.1|3118639_3119488_-|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	36.3	1.9e-34
AZK47122.1|3119459_3119888_-	hypothetical protein	NA	A0A0K2FLF1	Brevibacillus_phage	35.8	3.8e-15
AZK47123.1|3119909_3120494_-	hypothetical protein	NA	NA	NA	NA	NA
AZK47124.1|3120628_3121423_-	hypothetical protein	NA	A0A0K2FL50	Brevibacillus_phage	34.1	3.4e-33
AZK47125.1|3121436_3122162_-	hypothetical protein	NA	A0A0H3V0N8	Geobacillus_virus	26.9	2.9e-07
AZK47126.1|3122318_3123086_-	hypothetical protein	NA	Q331U9	Clostridium_botulinum_C_phage	30.0	8.3e-29
AZK47127.1|3123082_3125926_-	hypothetical protein	NA	H7BV05	unidentified_phage	49.4	6.0e-242
AZK47128.1|3126448_3126733_+	hypothetical protein	NA	NA	NA	NA	NA
AZK47129.1|3127374_3128481_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	40.0	3.6e-57
AZK47130.1|3128579_3129257_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	46.4	4.7e-44
AZK47131.1|3129305_3130538_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	52.5	2.6e-117
AZK47132.1|3130605_3131073_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	58.3	4.7e-43
AZK47133.1|3131176_3131974_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	40.7	3.4e-09
AZK47134.1|3131942_3132548_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.3	7.5e-17
AZK47135.1|3132630_3133344_+	DUF2953 domain-containing protein	NA	NA	NA	NA	NA
AZK47136.1|3133457_3133928_+	sporulation protein YtfJ	NA	NA	NA	NA	NA
AZK47137.1|3134071_3135241_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	30.2	2.9e-09
>prophage 221
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3140960	3144884	5288676		Bacillus_phage(66.67%)	3	NA	NA
AZK47144.1|3140960_3141677_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	42.2	2.0e-48
AZK47145.1|3141677_3143120_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	34.1	4.0e-32
AZK47146.1|3143294_3144884_-	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	35.7	5.7e-40
>prophage 222
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3166115	3169046	5288676		Staphylococcus_phage(50.0%)	3	NA	NA
AZK49046.1|3166115_3167606_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	5.9e-15
AZK47167.1|3167602_3168589_+	ABC transporter permease	NA	NA	NA	NA	NA
AZK47168.1|3168773_3169046_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	70.0	1.9e-28
>prophage 223
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3176031	3176475	5288676		Anguillid_herpesvirus(100.0%)	1	NA	NA
AZK47176.1|3176031_3176475_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	45.0	4.5e-27
>prophage 224
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3181663	3187331	5288676		Acinetobacter_phage(66.67%)	6	NA	NA
AZK47180.1|3181663_3182704_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	39.1	2.9e-69
AZK47181.1|3182693_3183497_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	46.5	1.9e-55
AZK47182.1|3183525_3184194_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
AZK47183.1|3184190_3185390_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AZK49050.1|3185401_3186208_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AZK47184.1|3186233_3187331_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.1	1.3e-22
>prophage 225
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3197376	3198246	5288676		Streptococcus_phage(100.0%)	1	NA	NA
AZK47198.1|3197376_3198246_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	44.8	7.6e-63
>prophage 226
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3202627	3203923	5288676	tRNA	unidentified_phage(100.0%)	1	NA	NA
AZK47203.1|3202627_3203923_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	48.5	2.5e-46
>prophage 227
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3208256	3211133	5288676		Bacillus_phage(100.0%)	1	NA	NA
AZK49054.1|3208256_3211133_+	ATP-dependent helicase DinG	NA	A0A127AW80	Bacillus_phage	32.5	1.2e-85
>prophage 228
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3214424	3220253	5288676	tRNA	Bathycoccus_sp._RCC1105_virus(33.33%)	5	NA	NA
AZK47212.1|3214424_3215927_+	AAA family ATPase	NA	E5EQU5	Bathycoccus_sp._RCC1105_virus	41.8	1.4e-72
AZK49055.1|3216063_3216936_+	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AZK47213.1|3216932_3218138_+	acetate kinase	NA	NA	NA	NA	NA
AZK47214.1|3218179_3219475_+|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	31.5	6.9e-60
AZK47215.1|3219554_3220253_+	DnaD domain protein	NA	A0A0N7AE27	Bacillus_phage	35.5	6.2e-15
>prophage 229
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3224761	3225532	5288676		Planktothrix_phage(100.0%)	1	NA	NA
AZK47221.1|3224761_3225532_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.5	1.5e-30
>prophage 230
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3239340	3243230	5288676	transposase	Escherichia_phage(50.0%)	5	NA	NA
AZK47231.1|3239340_3240066_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	38.7	4.9e-39
AZK47232.1|3240067_3241642_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AZK47233.1|3241682_3241895_+	hypothetical protein	NA	NA	NA	NA	NA
AZK47234.1|3241891_3242473_-	hypothetical protein	NA	NA	NA	NA	NA
AZK47235.1|3242939_3243230_+	hypothetical protein	NA	A0A1B1P7C9	Bacillus_phage	41.6	1.2e-07
>prophage 231
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3246821	3250091	5288676		Streptococcus_phage(100.0%)	3	NA	NA
AZK47241.1|3246821_3247682_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	31.5	6.2e-25
AZK47242.1|3247694_3248942_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.4	2.7e-101
AZK47243.1|3248984_3250091_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	47.2	7.9e-81
>prophage 232
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3254459	3261992	5288676	transposase	Macacine_betaherpesvirus(33.33%)	6	NA	NA
AZK47247.1|3254459_3255613_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	40.9	5.6e-29
AZK47248.1|3255875_3257333_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
AZK47249.1|3257359_3257962_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
AZK49058.1|3258224_3259736_+	AMIN domain-containing protein	NA	A0A0N9SGH1	Paenibacillus_phage	39.2	2.0e-18
AZK47250.1|3259781_3260339_+	hypothetical protein	NA	NA	NA	NA	NA
AZK47251.1|3260561_3261992_+	AMIN domain-containing protein	NA	M4ZRP4	Bacillus_phage	40.5	2.8e-22
>prophage 233
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3270906	3274528	5288676		Bacillus_phage(100.0%)	2	NA	NA
AZK47257.1|3270906_3272676_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.6	2.4e-55
AZK49059.1|3272734_3274528_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.0	3.0e-61
>prophage 234
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3279937	3289987	5288676		Bacillus_virus(40.0%)	8	NA	NA
AZK47262.1|3279937_3280477_+	hypothetical protein	NA	U5Q1E2	Bacillus_phage	59.8	6.6e-33
AZK47263.1|3280889_3281714_+	hypothetical protein	NA	NA	NA	NA	NA
AZK47264.1|3281765_3282761_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.4	3.7e-37
AZK49060.1|3282753_3283743_+	ABC transporter permease	NA	NA	NA	NA	NA
AZK47265.1|3283823_3285809_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	43.2	3.0e-131
AZK47266.1|3285822_3288285_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.9	1.4e-101
AZK47267.1|3288450_3288963_+	hypothetical protein	NA	NA	NA	NA	NA
AZK47268.1|3289105_3289987_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	29.2	8.7e-06
>prophage 235
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3295897	3297675	5288676		Bacillus_phage(100.0%)	2	NA	NA
AZK47274.1|3295897_3296704_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.2	3.1e-10
AZK47275.1|3296835_3297675_+	prohibitin family protein	NA	A0A1C8E9A9	Bacillus_phage	23.6	1.4e-08
>prophage 236
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3303210	3309994	5288676		Bacillus_phage(60.0%)	7	NA	NA
AZK47281.1|3303210_3304266_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	22.5	6.1e-06
AZK49061.1|3304311_3305307_+	iron ABC transporter permease	NA	NA	NA	NA	NA
AZK47282.1|3305598_3306009_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	60.0	2.3e-33
AZK47283.1|3305944_3308074_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	R4JDX9	Bacillus_phage	61.4	1.0e-254
AZK47284.1|3308097_3309093_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4JMU8	Bacillus_phage	59.2	5.2e-108
AZK47285.1|3309222_3309651_-	VOC family protein	NA	NA	NA	NA	NA
AZK47286.1|3309760_3309994_+	toxin-antitoxin system HicB family antitoxin	NA	A0A0K2CZV4	Paenibacillus_phage	61.9	7.1e-08
>prophage 237
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3313430	3317990	5288676		Hokovirus(50.0%)	3	NA	NA
AZK47290.1|3313430_3316493_-	response regulator	NA	A0A1V0SGX0	Hokovirus	26.3	2.2e-32
AZK47291.1|3316858_3317494_+	hypothetical protein	NA	NA	NA	NA	NA
AZK47292.1|3317474_3317990_+	accessory regulator AgrB	NA	S5MUJ9	Brevibacillus_phage	34.5	7.3e-13
>prophage 238
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3326478	3328275	5288676		Staphylococcus_phage(50.0%)	2	NA	NA
AZK47303.1|3326478_3327396_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	41.7	1.6e-42
AZK47304.1|3327567_3328275_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	37.9	1.4e-35
>prophage 239
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3333426	3337510	5288676		Bacillus_phage(33.33%)	3	NA	NA
AZK47308.1|3333426_3335646_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.4	1.0e-34
AZK47309.1|3336128_3336962_+	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	39.1	3.3e-23
AZK47310.1|3337306_3337510_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	1.6e-19
>prophage 240
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3342141	3346750	5288676		Microcystis_phage(50.0%)	4	NA	NA
AZK47315.1|3342141_3343629_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	32.3	7.7e-47
AZK47316.1|3343867_3345019_+	sensor histidine kinase	NA	NA	NA	NA	NA
AZK47317.1|3345015_3345657_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AZK47318.1|3345817_3346750_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.4	4.8e-23
>prophage 241
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3351515	3352220	5288676		Planktothrix_phage(100.0%)	1	NA	NA
AZK47323.1|3351515_3352220_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.8e-28
>prophage 242
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3356204	3356414	5288676		Listeria_phage(100.0%)	1	NA	NA
AZK47326.1|3356204_3356414_-	XRE family transcriptional regulator	NA	A0A0B5CYL9	Listeria_phage	49.2	3.1e-07
>prophage 243
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3384550	3385333	5288676		Bacillus_virus(100.0%)	1	NA	NA
AZK47347.1|3384550_3385333_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	2.1e-32
>prophage 244
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3389731	3394737	5288676		Klosneuvirus(50.0%)	2	NA	NA
AZK47352.1|3389731_3392545_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.8	1.9e-30
AZK49069.1|3392616_3394737_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	43.5	1.6e-61
>prophage 245
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3401104	3402103	5288676		Bacillus_virus(100.0%)	1	NA	NA
AZK47358.1|3401104_3402103_+	AAA family ATPase	NA	G3MAX6	Bacillus_virus	41.2	8.2e-53
>prophage 246
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3408001	3409438	5288676		Enterobacteria_phage(100.0%)	1	NA	NA
AZK47364.1|3408001_3409438_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	29.0	1.1e-21
>prophage 247
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3412556	3414068	5288676		Staphylococcus_phage(100.0%)	1	NA	NA
AZK47365.1|3412556_3414068_+	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.3	2.9e-17
>prophage 248
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3417786	3426423	5288676		Phage_Wrath(33.33%)	8	NA	NA
AZK49074.1|3417786_3418413_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	60.9	1.1e-15
AZK47369.1|3418690_3419092_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
AZK47370.1|3419501_3419675_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
AZK49075.1|3419725_3420718_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	25.3	1.1e-09
AZK47371.1|3420740_3421277_+	hypothetical protein	NA	NA	NA	NA	NA
AZK47372.1|3421338_3422139_+	HAD family hydrolase	NA	NA	NA	NA	NA
AZK47373.1|3422234_3422777_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AZK47374.1|3422982_3426423_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	53.3	9.2e-11
>prophage 249
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3429556	3434428	5288676		Bacillus_virus(33.33%)	5	NA	NA
AZK49076.1|3429556_3430375_+	Fpg/Nei family DNA glycosylase	NA	G3MA33	Bacillus_virus	30.5	3.3e-15
AZK47378.1|3430364_3431222_+	deoxyribonuclease IV	NA	A0A146JI69	Tokyovirus	25.5	3.4e-15
AZK47379.1|3431255_3431609_+	cell division protein FtsJ	NA	NA	NA	NA	NA
AZK49077.1|3431682_3432747_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AZK47380.1|3432832_3434428_+	serine/threonine protein kinase	NA	K7YID8	Megavirus	30.6	1.5e-16
>prophage 250
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3443303	3447417	5288676		Tupanvirus(50.0%)	4	NA	NA
AZK47388.1|3443303_3444851_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.0	2.0e-53
AZK49080.1|3444911_3445961_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
AZK47389.1|3446099_3446777_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AZK47390.1|3446895_3447417_-	NlpC/P60 family protein	NA	A0A217EQL1	Bacillus_phage	35.9	7.4e-13
>prophage 251
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3458741	3462459	5288676		Geobacillus_virus(33.33%)	3	NA	NA
AZK47401.1|3458741_3459536_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	75.8	3.3e-121
AZK47402.1|3459576_3460062_+	dihydrofolate reductase	NA	A0A218KC58	Bacillus_phage	44.7	1.1e-31
AZK47403.1|3460197_3462459_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	26.1	4.9e-37
>prophage 252
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3465726	3471791	5288676		Bacillus_phage(50.0%)	6	NA	NA
AZK47407.1|3465726_3466461_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.5	8.8e-20
AZK47408.1|3466471_3467728_+	hypothetical protein	NA	NA	NA	NA	NA
AZK47409.1|3467761_3468460_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.5	6.6e-33
AZK47410.1|3468456_3469962_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	32.7	4.7e-36
AZK47411.1|3469936_3470491_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZK47412.1|3470561_3471791_-	glucose-1-phosphate adenylyltransferase	NA	H9NC64	Sphingomonas_phage	26.6	3.8e-15
>prophage 253
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3479334	3481077	5288676		Planktothrix_phage(50.0%)	2	NA	NA
AZK47417.1|3479334_3480057_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.4	6.8e-33
AZK47418.1|3480402_3481077_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0S2MUE5	Bacillus_phage	41.2	3.1e-11
>prophage 254
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3506574	3507093	5288676		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
AZK47439.1|3506574_3507093_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	51.5	2.1e-20
>prophage 255
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3515173	3523009	5288676		Planktothrix_phage(25.0%)	7	NA	NA
AZK47446.1|3515173_3515992_+	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	29.9	3.1e-18
AZK47447.1|3515976_3516852_+	energy-coupling factor transporter ATPase	NA	A0A2K9L3Z8	Tupanvirus	29.5	3.7e-17
AZK47448.1|3516855_3517659_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
AZK47449.1|3517668_3519396_+	adenine deaminase	NA	NA	NA	NA	NA
AZK47450.1|3519432_3520968_+	hypothetical protein	NA	A0A2H4PQM9	Staphylococcus_phage	26.3	3.2e-32
AZK47451.1|3520971_3522141_+	thiolase family protein	NA	NA	NA	NA	NA
AZK47452.1|3522160_3523009_+	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.5	7.5e-15
>prophage 256
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3547195	3553378	5288676		Mycobacterium_phage(33.33%)	6	NA	NA
AZK47469.1|3547195_3548110_+	recombinase XerC	NA	A0A142K830	Mycobacterium_phage	24.8	5.4e-11
AZK47470.1|3548202_3548715_-	DUF3231 family protein	NA	NA	NA	NA	NA
AZK47471.1|3548900_3549755_+	manganese catalase family protein	NA	NA	NA	NA	NA
AZK47472.1|3549864_3550575_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	38.9	5.9e-21
AZK47473.1|3550756_3551737_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AZK47474.1|3551905_3553378_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	28.1	2.7e-28
>prophage 257
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3561013	3562162	5288676		Erysipelothrix_phage(100.0%)	1	NA	NA
AZK49092.1|3561013_3562162_-	MFS transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	25.2	1.5e-13
>prophage 258
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3572505	3575700	5288676	transposase	Staphylococcus_phage(100.0%)	3	NA	NA
AZK47488.1|3572505_3573798_+	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	67.1	7.9e-157
AZK47489.1|3573938_3575132_-|transposase	transposase	transposase	NA	NA	NA	NA
AZK47490.1|3575280_3575700_+	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	63.4	4.5e-45
>prophage 259
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3584635	3585706	5288676		Brevibacillus_phage(100.0%)	1	NA	NA
AZK47497.1|3584635_3585706_+	tyrosine recombinase XerS	NA	S5M9V8	Brevibacillus_phage	20.8	1.4e-05
>prophage 260
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3600733	3662763	5288676	transposase,integrase,protease	Streptococcus_phage(33.33%)	53	3606382:3606399	3652271:3652288
AZK47506.1|3600733_3600988_-	YolD-like family protein	NA	A0A0C5ABD9	Paenibacillus_phage	51.9	7.2e-14
AZK47507.1|3602446_3602641_-	hypothetical protein	NA	NA	NA	NA	NA
AZK47508.1|3603353_3603713_-	XRE family transcriptional regulator	NA	A0A2H4J358	uncultured_Caudovirales_phage	35.5	8.7e-05
AZK47509.1|3603857_3604856_+	DGQHR domain-containing protein	NA	NA	NA	NA	NA
AZK47510.1|3604901_3605378_-	hypothetical protein	NA	NA	NA	NA	NA
AZK47511.1|3605343_3607404_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
3606382:3606399	attL	ATTGTATTGCTGGCTTCT	NA	NA	NA	NA
AZK47512.1|3607407_3608757_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AZK47513.1|3608908_3609316_-	hypothetical protein	NA	NA	NA	NA	NA
AZK49095.1|3609619_3609808_-	hypothetical protein	NA	NA	NA	NA	NA
AZK47514.1|3611026_3611926_-|protease	serine protease	protease	A0A1B1IRH0	uncultured_Mediterranean_phage	26.9	8.5e-09
AZK47515.1|3612084_3614061_+	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
AZK47516.1|3614364_3615618_-	MFS transporter	NA	NA	NA	NA	NA
AZK47517.1|3615614_3617195_-	hypothetical protein	NA	NA	NA	NA	NA
AZK47518.1|3617567_3618299_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AZK47519.1|3618425_3618731_-	iron-sulfur cluster repair di-iron protein, ric	NA	NA	NA	NA	NA
AZK47520.1|3618770_3619004_-	copper chaperone	NA	NA	NA	NA	NA
AZK47521.1|3619117_3620986_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.5	1.0e-104
AZK47522.1|3621308_3622067_+	EcsC family protein	NA	NA	NA	NA	NA
AZK49096.1|3622447_3622981_+	hypothetical protein	NA	NA	NA	NA	NA
AZK47523.1|3623075_3623633_-	hypothetical protein	NA	NA	NA	NA	NA
AZK47524.1|3623832_3625071_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	41.9	6.8e-65
AZK47525.1|3625715_3626840_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
AZK47526.1|3627033_3627927_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZK47527.1|3628009_3628360_-	DUF2200 domain-containing protein	NA	NA	NA	NA	NA
AZK47528.1|3628531_3628936_-	hypothetical protein	NA	NA	NA	NA	NA
AZK49097.1|3629091_3629508_-	VOC family protein	NA	NA	NA	NA	NA
AZK47529.1|3629680_3630907_-	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
AZK47530.1|3631131_3632556_-	L-arabinose isomerase	NA	NA	NA	NA	NA
AZK47531.1|3632589_3633285_-	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
AZK47532.1|3633301_3634906_-	ATPase	NA	NA	NA	NA	NA
AZK47533.1|3635234_3636320_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZK47534.1|3637062_3637695_-	glutamine amidotransferase	NA	NA	NA	NA	NA
AZK47535.1|3638239_3639733_+	amidase	NA	NA	NA	NA	NA
AZK47536.1|3640322_3640979_-	transcriptional regulator	NA	NA	NA	NA	NA
AZK47537.1|3641744_3644162_-	glycoside hydrolase family 16 protein	NA	M1HRU7	Paramecium_bursaria_Chlorella_virus	36.3	6.9e-37
AZK47538.1|3644199_3644400_-	hypothetical protein	NA	NA	NA	NA	NA
AZK47539.1|3644396_3645644_-	MFS transporter	NA	NA	NA	NA	NA
AZK47540.1|3645734_3646256_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZK47541.1|3646409_3647084_+	SOS response-associated peptidase	NA	NA	NA	NA	NA
AZK47542.1|3647122_3647926_-	HAD family hydrolase	NA	NA	NA	NA	NA
AZK49098.1|3647958_3649188_-	MFS transporter	NA	NA	NA	NA	NA
AZK47543.1|3649324_3650329_-	ROK family protein	NA	NA	NA	NA	NA
AZK47544.1|3650559_3651822_-	MFS transporter	NA	NA	NA	NA	NA
AZK47545.1|3652228_3653422_-|transposase	transposase	transposase	NA	NA	NA	NA
3652271:3652288	attR	AGAAGCCAGCAATACAAT	NA	NA	NA	NA
AZK47546.1|3653646_3654462_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
AZK47547.1|3654770_3655073_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AZK47548.1|3655088_3656480_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AZK47549.1|3656476_3656974_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZK47550.1|3657053_3658220_-	beta-glucosidase	NA	NA	NA	NA	NA
AZK47551.1|3658383_3659577_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZK49099.1|3659592_3660537_-	FAD-binding protein	NA	NA	NA	NA	NA
AZK47552.1|3660728_3661058_-	hypothetical protein	NA	NA	NA	NA	NA
AZK47553.1|3661467_3662763_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 261
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3672411	3673503	5288676		Tetraselmis_virus(100.0%)	1	NA	NA
AZK47561.1|3672411_3673503_-	glycosyltransferase family 1 protein	NA	A0A2P0VNG4	Tetraselmis_virus	28.9	2.0e-07
>prophage 262
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3679224	3685055	5288676		Bacillus_phage(50.0%)	4	NA	NA
AZK47567.1|3679224_3680874_+	catalase	NA	A0A2K9L572	Tupanvirus	44.7	9.6e-99
AZK49100.1|3680870_3682238_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.3	2.5e-20
AZK47568.1|3682269_3682986_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.4	7.7e-37
AZK47569.1|3683045_3685055_-	penicillin-binding protein	NA	G1BNF7	Mycobacterium_phage	26.3	2.8e-07
>prophage 263
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3692921	3696371	5288676		Vaccinia_virus(100.0%)	1	NA	NA
AZK49101.1|3692921_3696371_-	DUF4982 domain-containing protein	NA	B9U1V4	Vaccinia_virus	26.0	2.9e-20
>prophage 264
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3722630	3727623	5288676		Sulfolobales_Virus_YNP2(33.33%)	3	NA	NA
AZK47592.1|3722630_3723425_+	glycosyltransferase family 2 protein	NA	A0A0N9P7Z4	Sulfolobales_Virus_YNP2	34.7	5.1e-05
AZK47593.1|3723461_3725597_-	class A beta-lactamase-related serine hydrolase	NA	G1BSP8	Mycobacterium_virus	24.4	1.2e-05
AZK49102.1|3725892_3727623_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	33.1	1.2e-62
>prophage 265
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3760972	3762028	5288676		Pandoravirus(100.0%)	1	NA	NA
AZK47619.1|3760972_3762028_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.7	4.4e-81
>prophage 266
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3778133	3781850	5288676		Streptococcus_phage(50.0%)	3	NA	NA
AZK49111.1|3778133_3779426_-	voltage-gated chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.7	1.6e-40
AZK47633.1|3779739_3780864_+	hypothetical protein	NA	NA	NA	NA	NA
AZK47634.1|3780953_3781850_-	RNA polymerase sigma factor RpoD	NA	M4SMP8	Cyanophage	36.3	5.7e-37
>prophage 267
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3797560	3804187	5288676		Bacillus_virus(50.0%)	6	NA	NA
AZK47649.1|3797560_3798691_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	32.7	1.5e-26
AZK47650.1|3798936_3799557_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZK47651.1|3799591_3799822_-	hypothetical protein	NA	NA	NA	NA	NA
AZK47652.1|3799845_3800244_-	hypothetical protein	NA	NA	NA	NA	NA
AZK47653.1|3800240_3801050_-	DUF817 domain-containing protein	NA	NA	NA	NA	NA
AZK49112.1|3801196_3804187_-	cellulose 1,4-beta-cellobiosidase	NA	G0YQI6	Erwinia_phage	36.3	1.0e-111
>prophage 268
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3832473	3835126	5288676		Bacillus_phage(66.67%)	3	NA	NA
AZK47677.1|3832473_3833571_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.7	1.4e-29
AZK47678.1|3833560_3834256_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	39.6	1.3e-41
AZK47679.1|3834412_3835126_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	41.0	4.2e-19
>prophage 269
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3839246	3841781	5288676		Powai_lake_megavirus(100.0%)	1	NA	NA
AZK47683.1|3839246_3841781_-	ATP-dependent helicase HrpB	NA	A0A167RJH7	Powai_lake_megavirus	27.8	7.5e-26
>prophage 270
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3847604	3855717	5288676		Bacillus_phage(100.0%)	6	NA	NA
AZK47692.1|3847604_3849353_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.1	1.5e-57
AZK47693.1|3849424_3850393_-	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
AZK47694.1|3850514_3851033_+	ADP-heptose synthase	NA	NA	NA	NA	NA
AZK47695.1|3851107_3851410_-	hypothetical protein	NA	NA	NA	NA	NA
AZK47696.1|3851884_3853642_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.1	2.4e-39
AZK47697.1|3853641_3855717_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.4	2.4e-38
>prophage 271
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3865734	3868708	5288676		Bacillus_virus(100.0%)	3	NA	NA
AZK47707.1|3865734_3867189_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	48.4	3.5e-121
AZK47708.1|3867248_3867791_-	cysteine hydrolase	NA	NA	NA	NA	NA
AZK49116.1|3867922_3868708_-	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	47.2	2.1e-51
>prophage 272
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3879230	3879491	5288676		Bacillus_phage(100.0%)	1	NA	NA
AZK47719.1|3879230_3879491_-	stage V sporulation protein S	NA	J9PTX7	Bacillus_phage	42.2	1.4e-09
>prophage 273
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3883286	3884345	5288676		Bacillus_phage(100.0%)	1	NA	NA
AZK47723.1|3883286_3884345_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	73.5	8.8e-130
>prophage 274
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3891738	3898151	5288676		Bodo_saltans_virus(25.0%)	4	NA	NA
AZK47731.1|3891738_3893019_-	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	27.6	5.5e-09
AZK47732.1|3893022_3894303_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	25.9	1.1e-38
AZK47733.1|3894430_3895261_-	spore cortex-lytic enzyme	NA	A0A172JHR8	Bacillus_phage	43.5	4.0e-21
AZK47734.1|3895430_3898151_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.8	2.1e-90
>prophage 275
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3905169	3906862	5288676		Insectomime_virus(50.0%)	2	NA	NA
AZK47742.1|3905169_3905625_-	dUTP diphosphatase	NA	V5L6Y7	Insectomime_virus	55.4	2.1e-35
AZK47743.1|3905608_3906862_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	33.9	4.5e-48
>prophage 276
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3911094	3929673	5288676	protease,tRNA	Tupanvirus(33.33%)	15	NA	NA
AZK47747.1|3911094_3912042_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	38.5	1.1e-11
AZK47748.1|3912082_3913006_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
AZK47749.1|3913002_3913980_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
AZK47750.1|3913998_3914352_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
AZK47751.1|3914367_3916926_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	24.2	6.0e-23
AZK47752.1|3916918_3917242_-	50S ribosomal protein L7ae	NA	NA	NA	NA	NA
AZK47753.1|3917234_3917549_-	YlxR family protein	NA	NA	NA	NA	NA
AZK47754.1|3917589_3918687_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
AZK47755.1|3918727_3919189_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
AZK47756.1|3919419_3923736_-	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	38.5	1.1e-29
AZK47757.1|3923960_3925412_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	39.6	5.6e-103
AZK47758.1|3925478_3926756_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
AZK47759.1|3926873_3928013_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
AZK47760.1|3928080_3928884_-	phosphatidate cytidylyltransferase	NA	A0A2K9L268	Tupanvirus	40.2	5.8e-09
AZK47761.1|3928905_3929673_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.7	1.0e-23
>prophage 277
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3936100	3936889	5288676		Bacillus_phage(100.0%)	1	NA	NA
AZK47770.1|3936100_3936889_-	FliA/WhiG family RNA polymerase sigma factor	NA	A0A0Y0AU18	Bacillus_phage	25.2	2.6e-09
>prophage 278
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3966650	3972280	5288676	protease,tRNA	Erwinia_phage(50.0%)	4	NA	NA
AZK47801.1|3966650_3968057_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.1	1.1e-39
AZK47802.1|3968182_3968725_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
AZK47803.1|3968810_3970130_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
AZK47804.1|3970180_3972280_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	38.7	3.3e-104
>prophage 279
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3980770	3981391	5288676		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AZK47812.1|3980770_3981391_-	ribonuclease HII	NA	A0A0N9QYD4	Chrysochromulina_ericina_virus	38.9	1.8e-21
>prophage 280
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	3996660	3999783	5288676		Powai_lake_megavirus(33.33%)	4	NA	NA
AZK47826.1|3996660_3997359_-	ribonuclease III	NA	A0A167RGU4	Powai_lake_megavirus	30.8	2.7e-26
AZK47827.1|3997371_3998610_-	beta-ketoacyl-[acyl-carrier-protein] synthase II	NA	NA	NA	NA	NA
AZK49121.1|3998731_3998965_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	38.0	4.6e-07
AZK47828.1|3999033_3999783_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.9	7.1e-17
>prophage 281
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4008427	4008940	5288676		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AZK47838.1|4008427_4008940_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	39.5	1.8e-27
>prophage 282
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4012702	4017265	5288676	transposase	Aphanizomenon_phage(50.0%)	4	NA	NA
AZK47844.1|4012702_4013797_-	ATPase	NA	A0A2H4PB07	Aphanizomenon_phage	31.5	1.9e-39
AZK47845.1|4013880_4014342_-	hypothetical protein	NA	NA	NA	NA	NA
AZK47846.1|4014384_4015281_-	hypothetical protein	NA	NA	NA	NA	NA
AZK47847.1|4016112_4017265_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	40.9	5.6e-29
>prophage 283
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4048247	4051876	5288676		Bacillus_phage(100.0%)	4	NA	NA
AZK47874.1|4048247_4049114_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.3	1.0e-11
AZK47875.1|4049158_4050109_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZK47876.1|4050141_4051068_+	ferrochelatase	NA	NA	NA	NA	NA
AZK47877.1|4051156_4051876_-	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	60.2	7.2e-35
>prophage 284
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4062477	4063203	5288676		Escherichia_phage(100.0%)	1	NA	NA
AZK47887.1|4062477_4063203_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	38.7	4.9e-39
>prophage 285
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4076179	4083547	5288676		Tupanvirus(100.0%)	1	NA	NA
AZK47899.1|4076179_4083547_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.7	5.3e-149
>prophage 286
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4092190	4099772	5288676		Acanthocystis_turfacea_Chlorella_virus(33.33%)	3	NA	NA
AZK47907.1|4092190_4093429_+	glycosyl hydrolase family protein	NA	M1I0P8	Acanthocystis_turfacea_Chlorella_virus	39.2	3.4e-40
AZK47908.1|4093600_4094068_-	GNAT family N-acetyltransferase	NA	E9LUK4	Lactobacillus_phage	47.3	7.0e-31
AZK49128.1|4094804_4099772_+	G-D-S-L family lipolytic protein	NA	A7KUU1	Bacillus_phage	23.2	2.6e-06
>prophage 287
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4120820	4121531	5288676		Staphylococcus_phage(100.0%)	1	NA	NA
AZK47930.1|4120820_4121531_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	1.4e-19
>prophage 288
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4135812	4152144	5288676		Mycobacterium_phage(16.67%)	12	NA	NA
AZK47942.1|4135812_4137489_-	class A beta-lactamase-related serine hydrolase	NA	A0A0B5A4V6	Mycobacterium_phage	26.9	5.3e-12
AZK47943.1|4138293_4138632_+	bacillithiol system redox-active protein YtxJ	NA	NA	NA	NA	NA
AZK47944.1|4139188_4141888_-	adenosylcobalamin-dependent ribonucleoside-diphosphate reductase	NA	A0A0K2CP92	Brevibacillus_phage	48.0	1.2e-175
AZK47945.1|4142563_4144327_+	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	30.2	9.1e-55
AZK47946.1|4144330_4145266_+	hypothetical protein	NA	NA	NA	NA	NA
AZK47947.1|4145407_4146433_+	hypothetical protein	NA	NA	NA	NA	NA
AZK47948.1|4146492_4146711_-	YqzE family protein	NA	NA	NA	NA	NA
AZK47949.1|4146949_4147639_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	26.0	7.2e-08
AZK47950.1|4147668_4148127_-	hypothetical protein	NA	NA	NA	NA	NA
AZK47951.1|4148132_4150166_-	S9 family peptidase	NA	NA	NA	NA	NA
AZK47952.1|4150162_4151173_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.1	3.1e-15
AZK47953.1|4151169_4152144_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.2	7.8e-16
>prophage 289
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4175965	4178194	5288676		Bacillus_phage(100.0%)	2	NA	NA
AZK47974.1|4175965_4177507_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.7	2.1e-23
AZK47975.1|4177507_4178194_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	40.8	1.0e-38
>prophage 290
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4200880	4202530	5288676		Bacillus_phage(50.0%)	2	NA	NA
AZK47996.1|4200880_4201123_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	49.4	1.4e-14
AZK47997.1|4201243_4202530_-	DNA polymerase IV	NA	A0A290GHP0	Caldibacillus_phage	32.4	4.0e-28
>prophage 291
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4206766	4210097	5288676		Planktothrix_phage(66.67%)	3	NA	NA
AZK48001.1|4206766_4207717_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	22.2	9.0e-09
AZK48002.1|4207677_4208430_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.3	1.3e-18
AZK48003.1|4208426_4210097_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.5	6.4e-18
>prophage 292
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4214210	4215119	5288676		Burkholderia_virus(100.0%)	1	NA	NA
AZK48007.1|4214210_4215119_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	32.2	4.1e-11
>prophage 293
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4218623	4221307	5288676		Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	2	NA	NA
AZK48012.1|4218623_4220201_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	37.6	3.8e-68
AZK48013.1|4220479_4221307_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	31.0	8.9e-29
>prophage 294
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4228840	4239464	5288676		Streptococcus_phage(40.0%)	10	NA	NA
AZK48020.1|4228840_4229797_-	WYL domain-containing protein	NA	A0A1B0RXM1	Streptococcus_phage	33.3	5.3e-09
AZK48021.1|4230015_4230213_-	cold shock domain-containing protein	NA	Q9AZD3	Lactococcus_phage	64.5	8.3e-18
AZK48022.1|4230426_4230660_+	hypothetical protein	NA	NA	NA	NA	NA
AZK48023.1|4231134_4232925_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	28.9	6.4e-64
AZK48024.1|4233009_4233345_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
AZK48025.1|4233388_4234426_+	M42 family peptidase	NA	NA	NA	NA	NA
AZK48026.1|4235147_4237130_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	27.7	4.8e-44
AZK48027.1|4237198_4238041_-	DUF92 domain-containing protein	NA	NA	NA	NA	NA
AZK48028.1|4238042_4238687_-	FAA hydrolase family protein	NA	NA	NA	NA	NA
AZK48029.1|4238738_4239464_-	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	30.1	6.0e-21
>prophage 295
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4249070	4250996	5288676		Streptococcus_phage(100.0%)	1	NA	NA
AZK49141.1|4249070_4250996_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	29.3	7.1e-45
>prophage 296
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4276480	4277464	5288676		Brazilian_cedratvirus(100.0%)	1	NA	NA
AZK48063.1|4276480_4277464_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.6	5.1e-15
>prophage 297
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4286870	4312153	5288676		Bacillus_phage(38.46%)	21	NA	NA
AZK48071.1|4286870_4290275_-	helicase SNF	NA	A0A160DHD3	Gordonia_phage	29.3	1.9e-37
AZK48072.1|4290780_4291413_-	DedA family protein	NA	NA	NA	NA	NA
AZK48073.1|4292389_4293148_-	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.2	4.7e-16
AZK48074.1|4293160_4294048_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
AZK48075.1|4294044_4294947_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
AZK48076.1|4295022_4295961_-	phosphate ABC transporter substrate-binding protein	NA	M1U9L0	Synechococcus_phage	26.8	1.6e-10
AZK48077.1|4296137_4296332_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48078.1|4296371_4296848_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AZK48079.1|4297005_4297227_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	55.4	7.7e-12
AZK48080.1|4297307_4297871_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	37.0	9.4e-14
AZK48081.1|4297867_4298461_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
AZK48082.1|4298512_4299343_-	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	30.1	2.5e-23
AZK48083.1|4300157_4302821_-	DNA polymerase I	NA	A0A1B1IST8	uncultured_Mediterranean_phage	33.0	2.8e-47
AZK48084.1|4303037_4303697_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
AZK48085.1|4303716_4304472_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.4	1.2e-16
AZK49143.1|4304674_4305934_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.0	5.7e-11
AZK48086.1|4306125_4306866_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.0	1.2e-37
AZK48087.1|4307034_4308831_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	35.2	3.4e-41
AZK48088.1|4308833_4310381_-	fumarate hydratase	NA	NA	NA	NA	NA
AZK48089.1|4310546_4311155_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	40.0	1.7e-05
AZK48090.1|4311283_4312153_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	43.9	6.9e-56
>prophage 298
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4324404	4329484	5288676		Bacillus_virus(50.0%)	2	NA	NA
AZK48104.1|4324404_4324893_-	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.5	3.1e-37
AZK48105.1|4325647_4329484_-	DNA polymerase III subunit alpha	NA	A0A0K1Y906	Streptomyces_phage	38.8	5.0e-215
>prophage 299
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4346706	4348707	5288676		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AZK48122.1|4346706_4348707_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	47.7	3.7e-12
>prophage 300
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4354232	4354976	5288676		Staphylococcus_phage(100.0%)	1	NA	NA
AZK48127.1|4354232_4354976_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.0	8.3e-26
>prophage 301
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4360233	4362402	5288676		Bacillus_phage(100.0%)	3	NA	NA
AZK48131.1|4360233_4360986_+	SCP-like extracellular	NA	A0A0E3T7R5	Bacillus_phage	60.3	9.0e-36
AZK48132.1|4361081_4361627_-	phosphodiesterase	NA	NA	NA	NA	NA
AZK49146.1|4361838_4362402_+	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	73.1	2.1e-53
>prophage 302
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4366984	4368923	5288676		Bacillus_phage(100.0%)	2	NA	NA
AZK48137.1|4366984_4368211_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.8	5.4e-22
AZK48138.1|4368212_4368923_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.2	8.2e-39
>prophage 303
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4372322	4443497	5288676	transposase,tRNA,coat,protease	Bacillus_phage(21.05%)	61	NA	NA
AZK48140.1|4372322_4373048_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	38.7	4.9e-39
AZK48141.1|4373049_4374537_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AZK48142.1|4375185_4376544_-|transposase	transposase	transposase	NA	NA	NA	NA
AZK48143.1|4376703_4377591_+	hypothetical protein	NA	NA	NA	NA	NA
AZK48144.1|4378223_4378793_-|coat	spore coat protein CotJC	coat	NA	NA	NA	NA
AZK48145.1|4378844_4379114_-|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
AZK48146.1|4379113_4379350_-|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
AZK48147.1|4379540_4380965_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
AZK48148.1|4380984_4382121_-	radical SAM/CxCxxxxC motif protein YfkAB	NA	NA	NA	NA	NA
AZK48149.1|4382239_4383325_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
AZK48150.1|4383417_4384248_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
AZK48151.1|4384275_4385730_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
AZK48152.1|4386244_4387288_+	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
AZK48153.1|4387405_4387777_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48154.1|4387781_4388642_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
AZK48155.1|4388875_4390273_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AZK48156.1|4390293_4390713_-	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
AZK48157.1|4390712_4391927_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	46.5	1.8e-110
AZK48158.1|4391923_4393225_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AZK48159.1|4393249_4394032_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	25.2	2.2e-08
AZK48160.1|4394553_4395027_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	53.2	6.6e-37
AZK48161.1|4395342_4396566_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
AZK48162.1|4396562_4397669_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
AZK48163.1|4397887_4398460_+	hypothetical protein	NA	NA	NA	NA	NA
AZK48164.1|4398548_4398929_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
AZK48165.1|4399108_4399522_+	hypothetical protein	NA	NA	NA	NA	NA
AZK48166.1|4399708_4400578_+	DegV family protein	NA	NA	NA	NA	NA
AZK48167.1|4400604_4401459_+	DegV family protein	NA	NA	NA	NA	NA
AZK48168.1|4401524_4404593_-	PAS domain S-box protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	35.0	1.9e-52
AZK48169.1|4404820_4405984_+	sporulation protein YhbH	NA	NA	NA	NA	NA
AZK48170.1|4405980_4407414_+	SpoVR family protein	NA	NA	NA	NA	NA
AZK48171.1|4407592_4409488_-	PrkA family serine protein kinase	NA	A0MN77	Thermus_phage	35.1	8.1e-102
AZK48172.1|4409894_4410641_+	hypothetical protein	NA	NA	NA	NA	NA
AZK48173.1|4410579_4411008_+	hypothetical protein	NA	NA	NA	NA	NA
AZK48174.1|4411004_4412333_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
AZK48175.1|4412428_4412839_+	hypothetical protein	NA	NA	NA	NA	NA
AZK48176.1|4412838_4413906_+	phosphodiester glycosidase family protein	NA	A0A1P8CWN9	Bacillus_phage	36.1	5.0e-08
AZK48177.1|4414395_4414785_+	hypothetical protein	NA	NA	NA	NA	NA
AZK48178.1|4414777_4415023_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	44.3	5.3e-14
AZK48179.1|4415330_4415795_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
AZK48180.1|4415964_4417053_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	48.5	2.6e-92
AZK48181.1|4417209_4418100_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48182.1|4418249_4420979_-	cellobiose phosphorylase	NA	NA	NA	NA	NA
AZK48183.1|4421052_4421889_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
AZK48184.1|4421891_4422785_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AZK48185.1|4422870_4424232_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
AZK49147.1|4424776_4425799_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.7	1.3e-21
AZK48186.1|4425917_4426955_-	3-deoxy-7-phosphoheptulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	26.5	6.2e-11
AZK48187.1|4427327_4428281_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
AZK48188.1|4428357_4429815_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.4	9.2e-29
AZK48189.1|4429817_4430510_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	42.7	2.2e-41
AZK48190.1|4430701_4432330_-|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.5	5.3e-17
AZK48191.1|4432487_4433147_-	DNA-binding response regulator	NA	Q6XLV6	Feldmannia_irregularis_virus	31.1	9.4e-05
AZK48192.1|4433160_4434186_-	sensor histidine kinase	NA	NA	NA	NA	NA
AZK48193.1|4434188_4435130_-	hypothetical protein	NA	NA	NA	NA	NA
AZK49148.1|4435606_4436173_-	hypothetical protein	NA	A0A217ER34	Bacillus_phage	36.6	1.3e-10
AZK48194.1|4436378_4438316_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.4	1.7e-118
AZK48195.1|4438707_4439610_-	sporulation protein	NA	NA	NA	NA	NA
AZK48196.1|4439773_4440910_-	dehypoxanthine futalosine cyclase	NA	A9ZMK9	Mamastrovirus	47.1	2.6e-23
AZK48197.1|4441126_4442317_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
AZK48198.1|4442309_4443497_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	28.8	3.0e-17
>prophage 304
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4448365	4450710	5288676		Rhodococcus_phage(33.33%)	3	NA	NA
AZK49150.1|4448365_4449286_-	5'-3' exonuclease	NA	A0A2P1JXG8	Rhodococcus_phage	32.5	1.5e-24
AZK48202.1|4449297_4449660_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	50.4	6.9e-26
AZK48203.1|4449735_4450710_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	30.1	1.3e-07
>prophage 305
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4457049	4459413	5288676		Lactobacillus_phage(100.0%)	1	NA	NA
AZK48212.1|4457049_4459413_-	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	35.1	7.5e-12
>prophage 306
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4464702	4465737	5288676	tRNA	Tupanvirus(100.0%)	1	NA	NA
AZK48217.1|4464702_4465737_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	34.3	1.7e-29
>prophage 307
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4472309	4473266	5288676		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
AZK49152.1|4472309_4473266_-	nucleoid-structuring protein H-NS	NA	E5EQ69	Micromonas_sp._RCC1109_virus	29.9	1.8e-17
>prophage 308
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4478651	4483268	5288676		Ostreococcus_lucimarinus_virus(50.0%)	5	NA	NA
AZK48229.1|4478651_4480397_-	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.6	3.6e-64
AZK48230.1|4481089_4481545_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZK48231.1|4482106_4482466_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AZK48232.1|4482496_4482697_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AZK48233.1|4482773_4483268_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.0	5.2e-16
>prophage 309
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4488308	4491239	5288676		Staphylococcus_phage(50.0%)	4	NA	NA
AZK48238.1|4488308_4489259_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	63.2	6.0e-45
AZK48239.1|4489260_4489842_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZK48240.1|4489867_4490266_+	VOC family protein	NA	NA	NA	NA	NA
AZK48241.1|4490300_4491239_+	alpha/beta fold hydrolase	NA	A0A1X9T771	Cowpox_virus	29.0	3.9e-20
>prophage 310
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4495092	4503433	5288676		Acanthamoeba_polyphaga_lentillevirus(25.0%)	5	NA	NA
AZK48243.1|4495092_4496928_-	DNA helicase RecQ	NA	J2YAJ8	Acanthamoeba_polyphaga_lentillevirus	35.0	3.9e-77
AZK48244.1|4497221_4498865_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	36.9	1.4e-86
AZK48245.1|4499089_4499962_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AZK48246.1|4499986_4500955_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	27.5	4.1e-09
AZK48247.1|4501402_4503433_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.9	4.7e-15
>prophage 311
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4514019	4516080	5288676		Mimivirus(100.0%)	1	NA	NA
AZK48256.1|4514019_4516080_+	chitinase	NA	A0A1X9VNM7	Mimivirus	31.6	5.3e-54
>prophage 312
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4522414	4523209	5288676		Brazilian_cedratvirus(100.0%)	1	NA	NA
AZK48263.1|4522414_4523209_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.7	1.8e-10
>prophage 313
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4527392	4530913	5288676		uncultured_Caudovirales_phage(20.0%)	5	NA	NA
AZK48267.1|4527392_4528061_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	54.2	7.1e-61
AZK48268.1|4528057_4528552_+	6-carboxytetrahydropterin synthase QueD	NA	J9PV91	Bacillus_phage	68.6	4.6e-57
AZK48269.1|4528544_4529285_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	46.0	4.5e-56
AZK48270.1|4529329_4529827_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	67.6	8.5e-51
AZK48271.1|4529941_4530913_+	D-glycerate dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	28.1	3.6e-21
>prophage 314
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4535149	4540263	5288676		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
AZK48275.1|4535149_4536838_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.9	5.9e-19
AZK49155.1|4536900_4537719_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
AZK48276.1|4537727_4538327_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
AZK48277.1|4538323_4539415_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
AZK48278.1|4539477_4540263_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.5	6.5e-13
>prophage 315
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4551911	4552976	5288676		Bacillus_virus(100.0%)	1	NA	NA
AZK48288.1|4551911_4552976_-	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.4	5.3e-26
>prophage 316
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4560632	4563833	5288676		Streptococcus_phage(50.0%)	3	NA	NA
AZK48294.1|4560632_4561265_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	45.3	2.4e-34
AZK48295.1|4561397_4562753_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AZK48296.1|4562927_4563833_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	27.3	1.4e-27
>prophage 317
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4572452	4581689	5288676	tail	Halovirus(25.0%)	7	NA	NA
AZK48301.1|4572452_4573448_-	MoxR family ATPase	NA	R4TG24	Halovirus	32.1	3.0e-07
AZK48302.1|4573470_4575162_-|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
AZK48303.1|4575214_4576156_-	ABC transporter permease	NA	NA	NA	NA	NA
AZK48304.1|4576142_4577081_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.7	1.1e-09
AZK48305.1|4577077_4579450_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48306.1|4579622_4580522_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.7	2.7e-15
AZK48307.1|4580576_4581689_-	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	35.8	6.8e-24
>prophage 318
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4599274	4599979	5288676		Planktothrix_phage(100.0%)	1	NA	NA
AZK48322.1|4599274_4599979_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.2	3.0e-25
>prophage 319
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4612365	4612926	5288676		Bacillus_virus(100.0%)	1	NA	NA
AZK48337.1|4612365_4612926_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	48.8	2.4e-38
>prophage 320
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4618034	4618259	5288676		Caldibacillus_phage(100.0%)	1	NA	NA
AZK48342.1|4618034_4618259_-	response regulator transcription factor	NA	A0A290GJH9	Caldibacillus_phage	72.2	1.2e-12
>prophage 321
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4626063	4636429	5288676		Catovirus(42.86%)	11	NA	NA
AZK48350.1|4626063_4627158_-	glycosyltransferase family 2 protein	NA	A0A1V0SAJ8	Catovirus	27.3	2.2e-06
AZK48351.1|4627154_4628144_-	NAD-dependent epimerase/dehydratase family protein	NA	K7Y9E1	Megavirus	32.7	1.3e-42
AZK48352.1|4628188_4628884_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48353.1|4628942_4630232_-	nucleotide sugar dehydrogenase	NA	M1I178	Paramecium_bursaria_Chlorella_virus	30.1	5.1e-39
AZK48354.1|4630323_4631256_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AZK48355.1|4631357_4631768_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48356.1|4631896_4632610_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.3	2.0e-08
AZK48357.1|4632606_4633539_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AZK48358.1|4633531_4634362_-	SDR family oxidoreductase	NA	A0A2P1ELT6	Moumouvirus	32.7	1.9e-31
AZK48359.1|4634358_4635345_-	SDR family NAD(P)-dependent oxidoreductase	NA	A0A1V0SAI8	Catovirus	32.9	7.9e-40
AZK48360.1|4635334_4636429_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A2P1ELS7	Moumouvirus	46.6	4.3e-95
>prophage 322
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4644367	4653051	5288676	coat	Bacillus_virus(33.33%)	8	NA	NA
AZK48366.1|4644367_4645099_-|coat	spore coat protein	coat	G3MA50	Bacillus_virus	42.9	2.7e-45
AZK48367.1|4645125_4645872_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AZK49165.1|4645868_4646927_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AZK48368.1|4646980_4647796_-	glycosyltransferase	NA	NA	NA	NA	NA
AZK48369.1|4648034_4649033_-	glycosyltransferase family 1 protein	NA	A0A2P0VNG4	Tetraselmis_virus	24.6	8.3e-05
AZK48370.1|4649395_4650502_+	YheC/YheD family protein	NA	NA	NA	NA	NA
AZK48371.1|4650568_4651369_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
AZK48372.1|4651365_4653051_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.8	1.5e-14
>prophage 323
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4663106	4664564	5288676		Streptococcus_phage(100.0%)	1	NA	NA
AZK48380.1|4663106_4664564_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.8	4.8e-17
>prophage 324
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4668272	4670508	5288676		Staphylococcus_phage(50.0%)	2	NA	NA
AZK48384.1|4668272_4669019_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	4.7e-21
AZK48385.1|4669074_4670508_-	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	30.9	2.5e-50
>prophage 325
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4675642	4682389	5288676		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
AZK48391.1|4675642_4676941_-	beta-N-acetylhexosaminidase	NA	A0A1B1IVS3	uncultured_Mediterranean_phage	33.6	5.9e-11
AZK48392.1|4677295_4677802_-	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
AZK48393.1|4678159_4682389_+	hypothetical protein	NA	A0A217EQY2	Bacillus_phage	32.9	8.1e-17
>prophage 326
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4689416	4691213	5288676		Enterobacteria_phage(100.0%)	1	NA	NA
AZK48398.1|4689416_4691213_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	29.9	4.2e-23
>prophage 327
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4696770	4699884	5288676		Herpes_simplex_virus(100.0%)	1	NA	NA
AZK48403.1|4696770_4699884_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	36.4	1.7e-173
>prophage 328
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4722401	4724129	5288676		Aureococcus_anophage(100.0%)	1	NA	NA
AZK48419.1|4722401_4724129_-	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	23.3	1.3e-16
>prophage 329
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4735405	4739347	5288676		Bacillus_virus(50.0%)	5	NA	NA
AZK48427.1|4735405_4736182_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	30.5	2.6e-14
AZK48428.1|4736169_4736922_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
AZK48429.1|4736991_4737852_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZK49169.1|4737906_4738590_-	ABC transporter permease	NA	NA	NA	NA	NA
AZK48430.1|4738582_4739347_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.7	4.0e-31
>prophage 330
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4743954	4747224	5288676		Herpes_simplex_virus(100.0%)	1	NA	NA
AZK48434.1|4743954_4747224_-	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	30.2	5.3e-141
>prophage 331
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4750791	4752654	5288676		Enterobacteria_phage(100.0%)	1	NA	NA
AZK48438.1|4750791_4752654_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	24.8	3.6e-17
>prophage 332
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4757193	4760202	5288676		Synechococcus_phage(100.0%)	1	NA	NA
AZK48442.1|4757193_4760202_-	beta-phosphoglucomutase	NA	A0A1D8KNV9	Synechococcus_phage	25.3	5.1e-05
>prophage 333
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4774442	4775867	5288676		Bacillus_phage(100.0%)	1	NA	NA
AZK48452.1|4774442_4775867_-	hypothetical protein	NA	S5MM68	Bacillus_phage	39.2	7.4e-07
>prophage 334
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4782506	4791351	5288676	tRNA	Leptospira_phage(33.33%)	6	NA	NA
AZK48459.1|4782506_4785860_-	DUF4145 domain-containing protein	NA	Q6NDX2	Leptospira_phage	26.6	1.1e-11
AZK48460.1|4785897_4787046_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AZK48461.1|4787038_4788508_-	SAM-dependent DNA methyltransferase	NA	A0A1W6JNK1	Staphylococcus_phage	23.6	4.6e-20
AZK48462.1|4788850_4789450_+	hypothetical protein	NA	NA	NA	NA	NA
AZK48463.1|4789465_4789858_+	hypothetical protein	NA	NA	NA	NA	NA
AZK48464.1|4790091_4791351_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	41.8	4.4e-88
>prophage 335
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4794724	4798139	5288676		Streptococcus_phage(50.0%)	2	NA	NA
AZK48468.1|4794724_4795633_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	28.7	1.1e-14
AZK48469.1|4795757_4798139_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	25.7	7.0e-10
>prophage 336
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4823022	4823523	5288676		Aeromonas_phage(100.0%)	1	NA	NA
AZK48489.1|4823022_4823523_-	CYTH domain-containing protein	NA	I6YXR6	Aeromonas_phage	29.7	6.2e-09
>prophage 337
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4831254	4835039	5288676		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
AZK48494.1|4831254_4833129_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	35.3	4.7e-94
AZK48495.1|4833457_4833727_-	scaffolding protein	NA	NA	NA	NA	NA
AZK48496.1|4834007_4835039_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.9	3.7e-24
>prophage 338
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4838679	4841310	5288676		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
AZK48500.1|4838679_4841310_-	cation-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	29.9	3.3e-85
>prophage 339
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4845558	4939079	5288676	transposase,plate,tail,portal	Brevibacillus_phage(28.57%)	61	NA	NA
AZK48504.1|4845558_4845837_-	ketopantoate hydroxymethyltransferase	NA	A0A0K2CNH8	Brevibacillus_phage	34.5	8.5e-08
AZK49175.1|4845836_4846406_-	DUF2313 domain-containing protein	NA	S5MA71	Brevibacillus_phage	45.6	1.7e-34
AZK48505.1|4846410_4847490_-|plate	baseplate J/gp47 family protein	plate	A0A0K2CP27	Brevibacillus_phage	50.3	1.2e-97
AZK48506.1|4847482_4847878_-	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	46.6	3.2e-24
AZK48507.1|4847874_4848216_-	DUF2577 domain-containing protein	NA	S5M5M4	Brevibacillus_phage	52.1	1.9e-25
AZK48508.1|4848212_4849169_-	hypothetical protein	NA	S5MNC9	Brevibacillus_phage	52.5	5.4e-94
AZK48509.1|4849179_4849857_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0K2CNM3	Brevibacillus_phage	44.9	6.1e-52
AZK48510.1|4849883_4851824_-	hypothetical protein	NA	S6AVU8	Thermus_phage	26.1	1.2e-26
AZK48511.1|4852025_4852433_-	XkdN-like protein	NA	A0A0A7RTY8	Clostridium_phage	26.4	4.0e-06
AZK48512.1|4852454_4852913_-|portal	phage portal protein	portal	A0A0A7RVP1	Clostridium_phage	58.7	1.6e-43
AZK48513.1|4852928_4854254_-|tail	phage tail sheath protein	tail	A0A0A7S087	Clostridium_phage	44.3	2.2e-93
AZK48514.1|4854254_4854446_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48515.1|4854438_4854876_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48516.1|4855155_4855413_-	acyl carrier protein	NA	NA	NA	NA	NA
AZK48517.1|4855417_4856458_-	HAD-IIIC family phosphatase	NA	NA	NA	NA	NA
AZK48518.1|4856441_4856900_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZK48519.1|4856920_4858129_-	putative methyltransferase	NA	NA	NA	NA	NA
AZK48520.1|4858339_4864903_-	HAD-IIIC family phosphatase	NA	D0R7J2	Paenibacillus_phage	41.3	4.3e-57
AZK48521.1|4864899_4872567_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	36.7	3.2e-64
AZK48522.1|4872651_4877517_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	40.8	7.5e-59
AZK48523.1|4877509_4880149_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	28.2	3.4e-82
AZK48524.1|4880180_4889468_-	amino acid adenylation domain-containing protein	NA	D0R7J2	Paenibacillus_phage	35.9	1.1e-61
AZK48525.1|4889579_4890749_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AZK48526.1|4890753_4891005_-	acyl carrier protein	NA	NA	NA	NA	NA
AZK48527.1|4891010_4892075_-	HAD-IIIC family phosphatase	NA	NA	NA	NA	NA
AZK48528.1|4892088_4892946_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AZK48529.1|4892942_4893674_-	thioesterase	NA	NA	NA	NA	NA
AZK48530.1|4893674_4895270_-	class A beta-lactamase-related serine hydrolase	NA	G1BNF7	Mycobacterium_phage	22.9	2.1e-10
AZK48531.1|4895294_4899809_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	24.9	3.8e-81
AZK48532.1|4899835_4900846_-	hypothetical protein	NA	NA	NA	NA	NA
AZK49176.1|4901047_4903051_-	beta-galactosidase	NA	NA	NA	NA	NA
AZK48533.1|4903122_4903950_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
AZK48534.1|4903946_4904831_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AZK48535.1|4904911_4906219_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
AZK48536.1|4906348_4907407_-	response regulator	NA	NA	NA	NA	NA
AZK49177.1|4907384_4909130_-	sensor histidine kinase	NA	NA	NA	NA	NA
AZK48537.1|4909332_4910016_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	33.5	3.2e-24
AZK48538.1|4910494_4910713_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZK48539.1|4911207_4911654_+	hypothetical protein	NA	NA	NA	NA	NA
AZK48540.1|4911690_4912368_-	DUF1266 domain-containing protein	NA	NA	NA	NA	NA
AZK48541.1|4912383_4913745_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AZK48542.1|4913982_4915683_-	MFS transporter	NA	NA	NA	NA	NA
AZK48543.1|4915849_4916341_+	general stress protein	NA	NA	NA	NA	NA
AZK48544.1|4916565_4917537_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
AZK48545.1|4917606_4919031_-	VanZ family protein	NA	NA	NA	NA	NA
AZK49178.1|4919263_4920007_-	spermidine synthase	NA	NA	NA	NA	NA
AZK48546.1|4920274_4920775_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48547.1|4921167_4921446_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48548.1|4921848_4922052_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZK48549.1|4924236_4925259_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	32.4	2.9e-37
AZK48550.1|4925673_4926969_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZK48551.1|4927311_4928007_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48552.1|4928010_4931262_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48553.1|4931287_4932016_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
AZK48554.1|4932023_4932542_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48555.1|4932547_4933507_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
AZK48556.1|4934112_4935408_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZK48557.1|4935505_4935769_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48558.1|4936152_4936377_+	XRE family transcriptional regulator	NA	A0A2K9V490	Faecalibacterium_phage	41.8	3.7e-06
AZK48559.1|4936829_4937339_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
AZK48560.1|4937885_4939079_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 340
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	4947791	5006453	5288676	transposase,tail,protease	uncultured_virus(42.86%)	54	NA	NA
AZK48569.1|4947791_4949012_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	52.4	3.7e-55
AZK48570.1|4949118_4949601_-	DUF600 family protein	NA	NA	NA	NA	NA
AZK48571.1|4949593_4952575_-	hypothetical protein	NA	NA	NA	NA	NA
AZK49179.1|4952586_4952958_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
AZK48572.1|4953376_4954672_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZK48573.1|4955206_4955620_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48574.1|4955637_4958487_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48575.1|4958580_4958868_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48576.1|4959121_4959349_+	XRE family transcriptional regulator	NA	D2J026	Enterococcus_phage	47.9	8.1e-09
AZK48577.1|4960369_4960678_-	toxin	NA	NA	NA	NA	NA
AZK48578.1|4961019_4961490_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48579.1|4962985_4964779_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48580.1|4964804_4965506_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
AZK48581.1|4965513_4966032_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48582.1|4966037_4967174_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
AZK48583.1|4967195_4968752_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48584.1|4968801_4969578_-	DNA and RNA helicase	NA	NA	NA	NA	NA
AZK48585.1|4969646_4970117_-	RDD family protein	NA	NA	NA	NA	NA
AZK48586.1|4970188_4970485_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48587.1|4970809_4971016_+	XRE family transcriptional regulator	NA	A0A2I6UHW7	Bacillus_phage	51.6	4.6e-11
AZK48588.1|4971551_4972070_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48589.1|4972454_4972976_-	hypothetical protein	NA	NA	NA	NA	NA
AZK49180.1|4972977_4973433_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48590.1|4973813_4975034_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	52.4	3.7e-55
AZK48591.1|4975187_4975679_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48592.1|4975693_4978822_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48593.1|4978837_4979584_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
AZK48594.1|4979576_4980098_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48595.1|4980084_4981248_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
AZK48596.1|4981268_4982792_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48597.1|4982833_4983610_-	DNA and RNA helicase	NA	NA	NA	NA	NA
AZK49181.1|4983682_4984087_-	RDD family protein	NA	NA	NA	NA	NA
AZK48598.1|4984223_4984517_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48599.1|4984896_4985103_+	XRE family transcriptional regulator	NA	A0A2I6UHW7	Bacillus_phage	54.8	1.2e-11
AZK48600.1|4986465_4987686_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	52.4	3.7e-55
AZK48601.1|4987797_4988244_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48602.1|4988263_4988746_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48603.1|4988770_4991458_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48604.1|4991538_4991940_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
AZK48605.1|4991971_4992496_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48606.1|4992512_4993142_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48607.1|4993138_4994551_-|tail	phage tail protein	tail	NA	NA	NA	NA
AZK48608.1|4994553_4995147_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48609.1|4995181_4995958_-	DNA and RNA helicase	NA	NA	NA	NA	NA
AZK48610.1|4996162_4996708_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48611.1|4996723_4999372_-	molecular chaperone	NA	NA	NA	NA	NA
AZK48612.1|4999447_5000146_-	iron-dependent peroxidase	NA	NA	NA	NA	NA
AZK48613.1|5000136_5001423_-	normocyte-binding protein	NA	NA	NA	NA	NA
AZK48614.1|5001419_5003333_-	serine/threonine protein phosphatase	NA	NA	NA	NA	NA
AZK49182.1|5003377_5004262_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
AZK48615.1|5004277_5004796_-	FHA domain-containing protein	NA	NA	NA	NA	NA
AZK48616.1|5004838_5005378_-	FHA domain-containing protein	NA	NA	NA	NA	NA
AZK49183.1|5005414_5005873_-	J domain-containing protein	NA	E3T4P7	Cafeteria_roenbergensis_virus	41.5	4.3e-09
AZK48617.1|5006021_5006453_-|protease	membrane-associated protease 1	protease	NA	NA	NA	NA
>prophage 341
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	5012392	5013325	5288676		Orpheovirus(100.0%)	1	NA	NA
AZK49184.1|5012392_5013325_-	serine/threonine protein kinase	NA	A0A2I2L4T9	Orpheovirus	30.8	6.3e-15
>prophage 342
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	5026050	5029965	5288676		Mycobacterium_phage(100.0%)	1	NA	NA
AZK48631.1|5026050_5029965_-	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	24.7	6.5e-45
>prophage 343
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	5051705	5059391	5288676		Streptococcus_phage(25.0%)	6	NA	NA
AZK48650.1|5051705_5053661_-	TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein	NA	A0A1S5SF82	Streptococcus_phage	28.9	9.4e-69
AZK48651.1|5053981_5054566_+	N-acetyltransferase	NA	NA	NA	NA	NA
AZK48652.1|5055207_5056434_-	RtcB family protein	NA	K4F7X0	Cronobacter_phage	29.4	1.2e-32
AZK48653.1|5056556_5057339_-	nucleotidyltransferase domain-containing protein	NA	K4K696	Caulobacter_phage	36.0	4.0e-39
AZK48654.1|5057363_5058095_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
AZK48655.1|5058110_5059391_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	27.9	8.4e-10
>prophage 344
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	5070619	5071723	5288676		Streptococcus_phage(100.0%)	1	NA	NA
AZK48660.1|5070619_5071723_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	70.1	2.6e-153
>prophage 345
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	5085850	5133480	5288676		Tupanvirus(100.0%)	6	NA	NA
AZK48667.1|5085850_5093335_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	25.4	7.7e-87
AZK48668.1|5093362_5100940_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	29.5	7.3e-186
AZK48669.1|5100967_5108620_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	26.1	6.1e-156
AZK48670.1|5108648_5123951_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	27.3	5.7e-161
AZK48671.1|5123968_5131567_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	28.7	1.6e-177
AZK48672.1|5131563_5133480_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	31.9	2.7e-76
>prophage 346
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	5141597	5142461	5288676		Microcystis_virus(100.0%)	1	NA	NA
AZK48680.1|5141597_5142461_-	formylglycine-generating enzyme family protein	NA	A0A7F1	Microcystis_virus	34.7	4.6e-20
>prophage 347
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	5150680	5152948	5288676		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AZK48688.1|5150680_5152948_-	ATP-binding cassette domain-containing protein	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	31.0	6.7e-119
>prophage 348
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	5162033	5165784	5288676		Bacillus_phage(50.0%)	3	NA	NA
AZK48696.1|5162033_5163752_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	44.4	6.4e-114
AZK48697.1|5164158_5164452_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48698.1|5165010_5165784_-	DUF3800 domain-containing protein	NA	A0A1W6JTE9	Pseudomonas_phage	26.2	7.6e-22
>prophage 349
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	5169696	5186172	5288676	transposase,integrase	Brevibacillus_phage(25.0%)	17	5164125:5164151	5183089:5183115
5164125:5164151	attL	AAGTTTCACATCAATTTCACATCAATT	NA	NA	NA	NA
AZK48701.1|5169696_5171715_-	hypothetical protein	NA	A0A0K2CP22	Brevibacillus_phage	30.0	2.0e-66
AZK48702.1|5172443_5173094_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48703.1|5173285_5173579_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48704.1|5173632_5173815_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48705.1|5174136_5174436_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48706.1|5174582_5176823_-	DUF3987 domain-containing protein	NA	A0A060RJ50	Pseudomonas_phage	29.3	2.9e-50
AZK48707.1|5176834_5177020_-	DNA-binding protein	NA	NA	NA	NA	NA
AZK48708.1|5177175_5177481_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48709.1|5177663_5178062_-	hypothetical protein	NA	NA	NA	NA	NA
AZK49190.1|5178085_5178298_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48710.1|5178583_5179213_+	XRE family transcriptional regulator	NA	A0A1W6JQE6	Staphylococcus_phage	55.4	1.2e-12
AZK48711.1|5179362_5179626_+	hypothetical protein	NA	A0A0K2CZ62	Paenibacillus_phage	56.9	2.3e-15
AZK48712.1|5179726_5181214_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AZK48713.1|5181215_5181941_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	38.7	4.9e-39
AZK48714.1|5182026_5183031_+|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	57.4	5.6e-102
AZK48715.1|5183200_5185000_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	51.5	3.6e-99
5183089:5183115	attR	AAGTTTCACATCAATTTCACATCAATT	NA	NA	NA	NA
AZK48716.1|5185290_5186172_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	30.7	1.7e-25
>prophage 350
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	5194343	5197211	5288676		Staphylococcus_phage(100.0%)	4	NA	NA
AZK48725.1|5194343_5195042_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	7.8e-18
AZK48726.1|5195080_5195464_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZK48727.1|5195509_5196268_-	ABC transporter permease	NA	NA	NA	NA	NA
AZK48728.1|5196260_5197211_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	40.8	1.4e-38
>prophage 351
CP034248	Paenibacillus lentus strain DSM 25539 chromosome, complete genome	5288676	5202921	5288505	5288676	plate,coat,tail,portal,transposase	Clostridium_phage(32.14%)	66	NA	NA
AZK48731.1|5202921_5204469_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase PurH	NA	Q58MG4	Prochlorococcus_phage	52.0	6.9e-75
AZK48732.1|5204704_5205337_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.0	2.1e-25
AZK48733.1|5205336_5206380_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	47.1	2.4e-71
AZK48734.1|5206454_5207933_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.1	1.3e-49
AZK48735.1|5207917_5210161_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	42.5	1.1e-169
AZK48736.1|5210138_5210828_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AZK48737.1|5210831_5211077_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FJ99	Synechococcus_phage	33.8	3.1e-06
AZK48738.1|5211254_5212163_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	35.9	4.5e-42
AZK48739.1|5212191_5213490_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	8.2e-21
AZK48740.1|5213486_5214749_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AZK48741.1|5214748_5215258_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.4	7.2e-21
AZK48742.1|5215972_5217125_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	40.9	5.6e-29
AZK48743.1|5217188_5217623_-	universal stress protein	NA	NA	NA	NA	NA
AZK48744.1|5217704_5217968_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
AZK48745.1|5218490_5220626_-	DNA topoisomerase III	NA	J3E777	Acanthamoeba_polyphaga_lentillevirus	24.5	3.8e-23
AZK48746.1|5221202_5222201_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
AZK48747.1|5222236_5222806_+	thymidine kinase	NA	A0A249XZX5	Enterococcus_phage	50.5	1.1e-46
AZK48748.1|5223771_5223984_+	hypothetical protein	NA	NA	NA	NA	NA
AZK48749.1|5224039_5224891_+	sulfurtransferase	NA	NA	NA	NA	NA
AZK48750.1|5225557_5226439_+	esterase family protein	NA	NA	NA	NA	NA
AZK48751.1|5227541_5228123_+	DoxX family membrane protein	NA	NA	NA	NA	NA
AZK48752.1|5228398_5228881_+	hypothetical protein	NA	NA	NA	NA	NA
AZK48753.1|5229005_5229764_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	45.0	4.6e-56
AZK48754.1|5229958_5231311_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AZK48755.1|5231437_5232169_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AZK48756.1|5232441_5233815_-	amino acid permease	NA	NA	NA	NA	NA
AZK48757.1|5233900_5234563_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48758.1|5234580_5235033_-	flavodoxin	NA	A7KUZ7	Bacillus_phage	36.6	2.5e-17
AZK48759.1|5235153_5235780_-	amino acid transporter	NA	NA	NA	NA	NA
AZK48760.1|5235866_5236613_-	YqcI/YcgG family protein	NA	NA	NA	NA	NA
AZK48761.1|5236835_5237549_+	polyphosphate polymerase domain-containing protein	NA	NA	NA	NA	NA
AZK48762.1|5237554_5238256_+	DUF4956 domain-containing protein	NA	NA	NA	NA	NA
AZK49195.1|5238303_5240295_+|coat	spore coat protein CotH	coat	NA	NA	NA	NA
AZK49196.1|5240433_5243340_-	starch-binding protein	NA	NA	NA	NA	NA
AZK48763.1|5245526_5245781_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AZK48764.1|5245872_5247471_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AZK49197.1|5247427_5248849_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZK48765.1|5248877_5250599_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	29.0	1.7e-21
AZK48766.1|5250713_5251583_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
AZK48767.1|5251579_5252536_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AZK48768.1|5252634_5253984_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
AZK48769.1|5262168_5262873_-	class D sortase	NA	NA	NA	NA	NA
AZK48770.1|5263003_5264572_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AZK48771.1|5264686_5265133_-	GtrA family protein	NA	NA	NA	NA	NA
AZK48772.1|5265122_5266133_-	glycosyltransferase	NA	A0A2H5BFL1	Salmonella_phage	40.4	1.8e-60
AZK48773.1|5266196_5270171_-	phospholipid carrier-dependent glycosyltransferase	NA	NA	NA	NA	NA
AZK48774.1|5270434_5271808_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	32.5	1.1e-44
AZK48775.1|5272361_5273114_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZK48776.1|5273266_5274445_-	phosphopentomutase	NA	NA	NA	NA	NA
AZK48777.1|5274464_5275859_-	MFS transporter	NA	NA	NA	NA	NA
AZK48778.1|5276011_5276728_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
AZK48779.1|5277094_5277883_-	hypothetical protein	NA	D6QWP5	uncultured_phage	40.7	3.8e-37
AZK48780.1|5277879_5278071_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48781.1|5278087_5278390_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48782.1|5278470_5278761_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48783.1|5278797_5279886_-	hypothetical protein	NA	NA	NA	NA	NA
AZK48784.1|5279885_5280434_-	DUF2313 domain-containing protein	NA	X5J9Z9	Clostridium_phage	35.1	4.5e-21
AZK48785.1|5280426_5281515_-|plate	baseplate J/gp47 family protein	plate	A0A0A8WFK0	Clostridium_phage	48.7	3.7e-91
AZK48786.1|5281507_5281915_-	DUF2634 domain-containing protein	NA	A0A0A8WFW6	Clostridium_phage	52.5	9.1e-35
AZK48787.1|5281911_5282226_-	DUF2577 domain-containing protein	NA	A0A0A8WJ65	Clostridium_phage	34.3	1.9e-08
AZK49198.1|5282227_5283181_-	hydrolase	NA	H7BVH4	unidentified_phage	59.0	5.5e-107
AZK48788.1|5283182_5283848_-	LysM peptidoglycan-binding domain-containing protein	NA	X5J9Z8	Clostridium_phage	47.2	7.6e-47
AZK48789.1|5283847_5285968_-|tail	phage tail tape measure protein	tail	X5JAB7	Clostridium_phage	37.0	7.4e-112
AZK48790.1|5286203_5286683_-|portal	phage portal protein	portal	X5JAB6	Clostridium_phage	48.5	2.0e-33
AZK48791.1|5286711_5287182_-	hypothetical protein	NA	A0A0A8WJ62	Clostridium_phage	73.1	4.5e-62
AZK48792.1|5287200_5288505_-|tail	phage tail protein	tail	X5JAJ1	Clostridium_phage	67.1	1.0e-167
