The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034336	Enterobacter asburiae strain CAV1043 chromosome, complete genome	5046183	7722	30007	5046183	head,plate,tail	uncultured_Caudovirales_phage(25.0%)	25	NA	NA
AZL61485.1|7722_8982_+|head	phage head morphogenesis protein	head	A0A0M4UTA3	Ralstonia_phage	35.1	6.7e-52
AZL61486.1|8978_9521_+	phage virion morphogenesis protein	NA	A0A2H4J9E5	uncultured_Caudovirales_phage	37.1	3.7e-23
AZL61487.1|9637_9847_+	hypothetical protein	NA	NA	NA	NA	NA
AZL61488.1|9901_11017_+	hypothetical protein	NA	A0A0M5N0Q6	Ralstonia_phage	42.6	2.0e-60
AZL61489.1|11028_11421_+	hypothetical protein	NA	A0A2P9JZJ1	Alteromonadaceae_phage	48.0	4.1e-24
AZL61490.1|11434_12343_+|head	head protein	head	A0A2H4J778	uncultured_Caudovirales_phage	63.6	2.9e-105
AZL61491.1|12342_12750_+	hypothetical protein	NA	NA	NA	NA	NA
AZL61492.1|12753_13182_+	DUF1320 domain-containing protein	NA	A0A1B0T6F3	Thiobacimonas_phage	35.1	5.1e-12
AZL61493.1|13181_13841_+	DUF1834 family protein	NA	A0A0M3LQJ7	Mannheimia_phage	35.4	4.2e-21
AZL61494.1|13827_14049_+	hypothetical protein	NA	NA	NA	NA	NA
AZL61495.1|14035_15454_+|tail	phage tail protein	tail	B7SDP8	Haemophilus_phage	42.2	2.1e-86
AZL61496.1|15467_15842_+|tail	phage tail protein	tail	F6MIK8	Haemophilus_phage	54.9	7.3e-31
AZL61497.1|15842_16235_+	hypothetical protein	NA	NA	NA	NA	NA
AZL61498.1|16369_18610_+|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	35.9	3.0e-71
AZL61499.1|18606_19938_+	multidrug DMT transporter permease	NA	A0A2H4JGT4	uncultured_Caudovirales_phage	27.7	5.1e-34
AZL61500.1|19921_21139_+|tail	phage tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	37.9	8.4e-76
AZL61501.1|21122_21728_+|plate	phage baseplate assembly protein V	plate	F6MIL4	Haemophilus_phage	55.6	4.5e-30
AZL61502.1|21817_22168_+	hypothetical protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	60.9	1.2e-30
AZL61503.1|22167_23235_+|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	43.8	1.4e-66
AZL61504.1|23231_23804_+	DUF2313 domain-containing protein	NA	F6MIL7	Haemophilus_phage	42.7	1.1e-33
AZL66003.1|24822_25200_+|tail	phage tail protein	tail	M1SNQ2	Escherichia_phage	53.1	3.4e-28
AZL61505.1|25180_25645_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	55.2	3.9e-42
AZL61506.1|26033_26588_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	82.0	7.2e-83
AZL61507.1|27413_28403_-	putative FMN-dependent luciferase-like monooxygenase	NA	NA	NA	NA	NA
AZL61508.1|28399_30007_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	7.8e-21
>prophage 2
CP034336	Enterobacter asburiae strain CAV1043 chromosome, complete genome	5046183	193131	227613	5046183	transposase,head,plate,tail	Pseudomonas_phage(22.22%)	53	NA	NA
AZL61654.1|193131_193689_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	82.0	5.5e-83
AZL61655.1|193718_194099_+	hypothetical protein	NA	NA	NA	NA	NA
AZL61656.1|194101_194536_+|tail	tail assembly chaperone	tail	Q9MCR5	Enterobacteria_phage	73.4	7.0e-17
AZL61657.1|194507_194981_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	53.1	2.4e-39
AZL61658.1|195686_196259_-	DUF2313 domain-containing protein	NA	F6MIL7	Haemophilus_phage	42.7	1.1e-33
AZL61659.1|196255_197323_-|plate	baseplate J/gp47 family protein	plate	F6MIL6	Haemophilus_phage	43.4	7.4e-68
AZL61660.1|197322_197673_-	hypothetical protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	63.5	3.4e-30
AZL61661.1|197762_198368_-|plate	phage baseplate assembly protein V	plate	F6MIL4	Haemophilus_phage	55.6	4.5e-30
AZL61662.1|198351_199569_-|tail	phage tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	37.9	1.4e-75
AZL61663.1|199552_200884_-	multidrug DMT transporter permease	NA	A0A2H4JGT4	uncultured_Caudovirales_phage	29.2	6.9e-39
AZL61664.1|200880_203022_-|tail	phage tail tape measure protein	tail	B5TAA4	Burkholderia_phage	28.0	1.5e-32
AZL61665.1|203156_203549_-	hypothetical protein	NA	NA	NA	NA	NA
AZL61666.1|203549_203924_-|tail	phage tail protein	tail	F6MIK8	Haemophilus_phage	54.9	7.3e-31
AZL61667.1|203937_205356_-|tail	phage tail protein	tail	B7SDP8	Haemophilus_phage	42.2	2.1e-86
AZL61668.1|205342_205564_-	hypothetical protein	NA	NA	NA	NA	NA
AZL61669.1|205550_206210_-	DUF1834 family protein	NA	A0A0M3LQJ7	Mannheimia_phage	35.4	4.2e-21
AZL61670.1|206209_206638_-	DUF1320 domain-containing protein	NA	A0A1B0T6F3	Thiobacimonas_phage	35.1	5.1e-12
AZL61671.1|206641_207049_-	hypothetical protein	NA	NA	NA	NA	NA
AZL61672.1|207048_207957_-|head	head protein	head	A0A2H4J778	uncultured_Caudovirales_phage	63.6	2.9e-105
AZL61673.1|207970_208363_-	hypothetical protein	NA	A0A2P9JZJ1	Alteromonadaceae_phage	48.0	4.1e-24
AZL61674.1|208374_209490_-	hypothetical protein	NA	A0A0M5N0Q6	Ralstonia_phage	42.6	2.0e-60
AZL61675.1|209545_209755_-	hypothetical protein	NA	NA	NA	NA	NA
AZL61676.1|209871_210414_-	phage virion morphogenesis protein	NA	A0A2H4J9E5	uncultured_Caudovirales_phage	37.1	3.7e-23
AZL61677.1|210410_211670_-|head	phage head morphogenesis protein	head	A0A0M4UTA3	Ralstonia_phage	35.1	6.7e-52
AZL61678.1|211656_213225_-	DUF935 domain-containing protein	NA	A0A0U5KSI0	unidentified_phage	45.4	4.6e-127
AZL61679.1|213227_214877_-	hypothetical protein	NA	H6V8N6	Pseudomonas_phage	66.1	2.2e-212
AZL61680.1|214901_215108_-	hypothetical protein	NA	NA	NA	NA	NA
AZL61681.1|215100_215601_-	DUF1804 family protein	NA	L7P7L4	Pseudomonas_phage	54.1	1.2e-47
AZL61682.1|215602_215887_-	hypothetical protein	NA	NA	NA	NA	NA
AZL61683.1|215883_216126_-	hypothetical protein	NA	NA	NA	NA	NA
AZL61684.1|216134_216767_-	hypothetical protein	NA	NA	NA	NA	NA
AZL61685.1|216732_216996_-	DUF2644 domain-containing protein	NA	A0A2D1GNW8	Pseudomonas_phage	57.3	4.8e-13
AZL61686.1|216992_217637_-	glycoside hydrolase family 19 protein	NA	A0A248XCW5	Klebsiella_phage	56.3	4.3e-63
AZL61687.1|217715_218222_-	hypothetical protein	NA	NA	NA	NA	NA
AZL61688.1|218221_218656_-	hypothetical protein	NA	A0A2D1GNW5	Pseudomonas_phage	47.0	5.2e-28
AZL61689.1|218600_219077_-	regulatory protein GemA	NA	A0A2D1GNN4	Pseudomonas_phage	62.2	1.6e-43
AZL61690.1|219138_219354_-	hypothetical protein	NA	A0A2D1GNS9	Pseudomonas_phage	63.4	2.6e-20
AZL61691.1|219313_219532_-	hypothetical protein	NA	NA	NA	NA	NA
AZL61692.1|219531_219747_-	hypothetical protein	NA	NA	NA	NA	NA
AZL61693.1|219739_220114_-	DUF4406 domain-containing protein	NA	A0A1V0E824	Vibrio_phage	52.2	5.8e-20
AZL61694.1|220280_220541_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	72.6	1.5e-27
AZL61695.1|220545_220791_-	hypothetical protein	NA	A0A0M3ULJ3	Salmonella_phage	81.5	1.7e-36
AZL61696.1|220795_221134_-	hypothetical protein	NA	NA	NA	NA	NA
AZL61697.1|221130_221850_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	33.2	1.9e-27
AZL61698.1|221930_222122_-	hypothetical protein	NA	NA	NA	NA	NA
AZL61699.1|222111_222345_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
AZL61700.1|222346_222991_-	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	64.6	5.4e-74
AZL61701.1|222980_223187_-	hypothetical protein	NA	NA	NA	NA	NA
AZL61702.1|223199_223490_-	hypothetical protein	NA	NA	NA	NA	NA
AZL61703.1|223500_224394_-	ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	59.8	3.6e-100
AZL61704.1|224405_226451_-|transposase	transposase	transposase	A0A2D1GNK9	Pseudomonas_phage	48.3	4.6e-175
AZL61705.1|226450_226708_-	transcriptional regulator	NA	M1PVU4	Vibrio_phage	64.6	2.1e-16
AZL61706.1|226842_227613_+	helix-turn-helix transcriptional regulator	NA	A0A2I7S9A5	Vibrio_phage	37.5	6.1e-40
>prophage 3
CP034336	Enterobacter asburiae strain CAV1043 chromosome, complete genome	5046183	383952	394026	5046183		Klosneuvirus(16.67%)	9	NA	NA
AZL61837.1|383952_385986_-	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	22.7	1.3e-17
AZL61838.1|386128_386875_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
AZL61839.1|386966_387653_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZL61840.1|387686_388118_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	36.6	3.7e-18
AZL61841.1|388405_388609_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	58.2	3.4e-14
AZL61842.1|388652_390116_-	mannitol dehydrogenase family protein	NA	G9E6E2	Micromonas_pusilla_virus	30.6	3.0e-43
AZL61843.1|390336_391704_-	MFS transporter	NA	NA	NA	NA	NA
AZL61844.1|391777_392797_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	27.7	2.3e-18
AZL61845.1|392811_394026_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	29.4	3.7e-47
>prophage 4
CP034336	Enterobacter asburiae strain CAV1043 chromosome, complete genome	5046183	501763	550808	5046183	coat,holin,head,lysis,terminase	Cronobacter_phage(27.59%)	73	NA	NA
AZL61942.1|501763_502153_-	LexA family transcriptional regulator	NA	G8C7R9	Escherichia_phage	91.5	1.2e-63
AZL61943.1|502303_504091_+	hypothetical protein	NA	Q6QI96	Burkholderia_phage	21.1	1.2e-06
AZL61944.1|504122_506393_-	SGNH/GDSL hydrolase family protein	NA	A0A2P1MXB7	Escherichia_phage	61.3	1.4e-44
AZL61945.1|506449_508927_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	92.0	0.0e+00
AZL61946.1|508913_509306_-	peptidoglycan endopeptidase	NA	F1C5F2	Cronobacter_phage	85.6	3.8e-62
AZL61947.1|509307_509820_-	HNH endonuclease	NA	A0A0M7Q8U0	Escherichia_phage	43.7	1.2e-28
AZL61948.1|509782_510250_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	90.9	4.2e-76
AZL61949.1|510252_510786_-	hypothetical protein	NA	Q8LTA0	Lactobacillus_phage	37.6	3.1e-22
AZL61950.1|510839_511337_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	90.9	7.9e-89
AZL61951.1|511336_514819_-	hypothetical protein	NA	R9TMK1	Aeromonas_phage	60.5	2.2e-254
AZL61952.1|514880_515558_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	49.6	5.4e-56
AZL61953.1|515615_516359_-	DNA breaking-rejoining protein	NA	F1C5E5	Cronobacter_phage	84.6	1.4e-73
AZL61954.1|516422_516806_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	61.4	3.4e-39
AZL61955.1|516802_517171_-	HK97 gp10 family phage protein	NA	F1C5E3	Cronobacter_phage	78.7	5.9e-49
AZL61956.1|517173_517530_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	53.8	2.7e-27
AZL61957.1|517526_517697_-	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	48.2	1.9e-10
AZL61958.1|517696_518077_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	2.4e-29
AZL61959.1|518079_518445_-	hypothetical protein	NA	NA	NA	NA	NA
AZL61960.1|518456_519542_-|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	68.4	2.3e-141
AZL61961.1|519553_519985_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	71.3	4.3e-51
AZL61962.1|519988_521374_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	58.7	2.0e-150
AZL61963.1|521386_521569_-	hypothetical protein	NA	NA	NA	NA	NA
AZL61964.1|521629_522322_-	HNH endonuclease	NA	S5M802	Pseudoalteromonas_phage	37.8	1.3e-36
AZL61965.1|522423_523428_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	65.3	3.4e-107
AZL61966.1|523363_524824_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.9	1.7e-147
AZL61967.1|524836_526309_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.7	2.4e-250
AZL61968.1|526308_526827_-	hypothetical protein	NA	A0A2H4J2I6	uncultured_Caudovirales_phage	58.8	2.0e-47
AZL61969.1|526914_527229_+	hypothetical protein	NA	NA	NA	NA	NA
AZL61970.1|527325_527514_+	hypothetical protein	NA	NA	NA	NA	NA
AZL61971.1|527576_527783_-	hypothetical protein	NA	NA	NA	NA	NA
AZL61972.1|527983_528247_-	hypothetical protein	NA	A0A1V0E5Q1	Salmonella_phage	91.8	1.8e-36
AZL61973.1|528243_528741_-	DNA-binding protein	NA	A0A220NRM9	Escherichia_phage	97.0	1.3e-91
AZL61974.1|528933_529407_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	55.3	7.1e-39
AZL61975.1|529403_529844_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	70.5	9.8e-51
AZL61976.1|529830_530172_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	54.2	1.1e-28
AZL61977.1|530616_530841_-	hypothetical protein	NA	NA	NA	NA	NA
AZL61978.1|531025_531502_-	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	52.6	1.0e-37
AZL61979.1|531501_532185_-	antiterminator	NA	I6PDF8	Cronobacter_phage	53.6	1.5e-58
AZL61980.1|532181_532298_-	hypothetical protein	NA	NA	NA	NA	NA
AZL61981.1|532294_532654_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	98.3	2.6e-65
AZL61982.1|532650_532941_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.6	1.8e-45
AZL61983.1|532933_533104_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	85.5	2.9e-19
AZL61984.1|533100_533538_-	recombination protein NinB	NA	G8C7V3	Escherichia_phage	68.3	4.7e-53
AZL61985.1|533784_534027_-	hypothetical protein	NA	NA	NA	NA	NA
AZL66018.1|534023_534575_-	DUF551 domain-containing protein	NA	K7P6H7	Enterobacteria_phage	57.3	6.4e-23
AZL61986.1|534961_535399_-	ead/Ea22-like family protein	NA	NA	NA	NA	NA
AZL61987.1|535670_535970_-	protein ren	NA	M1FPD5	Enterobacteria_phage	51.6	4.8e-17
AZL61988.1|535969_537403_-	helicase DnaB	NA	Q716D2	Shigella_phage	87.6	1.2e-233
AZL61989.1|537392_538292_-	DNA replication protein	NA	K7P7U6	Enterobacteria_phage	55.0	1.4e-80
AZL61990.1|538511_538733_-	transcriptional regulator	NA	NA	NA	NA	NA
AZL61991.1|538770_538992_-	helix-turn-helix domain-containing protein	NA	K7P6H5	Enterobacteria_phage	89.0	1.2e-28
AZL61992.1|539109_539829_+	helix-turn-helix transcriptional regulator	NA	K7P7I4	Enterobacteria_phage	92.5	4.7e-127
AZL61993.1|540625_540823_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	79.7	8.9e-20
AZL61994.1|541266_541479_+	hypothetical protein	NA	K7P7B4	Enterobacteria_phage	97.1	1.0e-29
AZL61995.1|541536_541866_+	hypothetical protein	NA	NA	NA	NA	NA
AZL66019.1|542068_542284_+	hypothetical protein	NA	I6NVM7	Burkholderia_virus	57.4	4.0e-05
AZL61996.1|542435_542942_+	HNH endonuclease	NA	Q5DMP6	Escherichia_phage	41.1	2.5e-26
AZL61997.1|542919_543153_+	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	96.9	4.6e-31
AZL61998.1|543401_543599_+	thioredoxin reductase	NA	NA	NA	NA	NA
AZL61999.1|543747_544428_+	ATP-binding protein	NA	A0A2D1GLT5	Escherichia_phage	81.4	2.0e-106
AZL62000.1|545101_545653_+	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	86.1	1.2e-93
AZL62001.1|545675_545897_+	hypothetical protein	NA	NA	NA	NA	NA
AZL62002.1|545896_546049_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	46.2	5.6e-06
AZL62003.1|546045_546705_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	92.7	2.1e-121
AZL62004.1|546701_546920_+	hypothetical protein	NA	NA	NA	NA	NA
AZL62005.1|546916_547528_+	hypothetical protein	NA	NA	NA	NA	NA
AZL62006.1|547619_547922_+	hypothetical protein	NA	K7PHN6	Enterobacterial_phage	68.0	8.8e-27
AZL62007.1|547924_548143_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	62.5	2.1e-17
AZL62008.1|548154_548364_+	hypothetical protein	NA	A0A0F6TK62	Escherichia_coli_O157_typing_phage	82.6	3.2e-28
AZL62009.1|548562_548802_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	71.8	3.1e-27
AZL62010.1|548811_549138_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	69.9	5.2e-33
AZL62011.1|549246_549495_+	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	8.3e-15
AZL62012.1|549527_550808_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	51.2	6.7e-124
>prophage 5
CP034336	Enterobacter asburiae strain CAV1043 chromosome, complete genome	5046183	713629	781532	5046183	transposase,plate,tail,holin,protease,tRNA,portal,terminase	Salmonella_phage(15.91%)	85	NA	NA
AZL62168.1|713629_714130_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AZL62169.1|714151_714256_-	hypothetical protein	NA	NA	NA	NA	NA
AZL62170.1|714401_714848_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AZL62171.1|714831_715623_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZL62172.1|715722_716910_+	MFS transporter	NA	NA	NA	NA	NA
AZL62173.1|716941_717649_-	hypothetical protein	NA	NA	NA	NA	NA
AZL62174.1|717750_718095_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AZL62175.1|718095_718401_-	hypothetical protein	NA	NA	NA	NA	NA
AZL62176.1|718481_718736_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AZL66026.1|719045_720074_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	33.2	3.7e-16
AZL62177.1|720119_720218_+	hypothetical protein	NA	NA	NA	NA	NA
AZL62178.1|720348_720597_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AZL66027.1|720882_722355_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	30.3	2.9e-14
AZL66028.1|722480_724001_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AZL62179.1|724236_725736_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AZL62180.1|726026_726272_-	DUF2543 family protein	NA	NA	NA	NA	NA
AZL62181.1|726346_726694_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
AZL62182.1|726771_728022_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	7.9e-21
AZL62183.1|728139_728793_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AZL62184.1|728802_729276_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AZL62185.1|729316_730429_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AZL62186.1|730455_731085_+	lysogenization regulator HflD	NA	NA	NA	NA	NA
AZL62187.1|731104_732475_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.0	3.8e-109
AZL62188.1|732884_733556_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	3.1e-80
AZL62189.1|733658_734294_-	peptidase	NA	NA	NA	NA	NA
AZL62190.1|734437_735706_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.0	1.9e-227
AZL62191.1|735708_736128_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.7	8.5e-36
AZL62192.1|736400_737570_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	32.8	1.2e-07
AZL62193.1|737577_738192_-|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	43.3	5.6e-28
AZL62194.1|738179_739898_-	hypothetical protein	NA	A0A0M3ULH6	Salmonella_phage	34.1	5.4e-28
AZL62195.1|739900_740452_-|tail	phage tail protein I	tail	V5YTN0	Pseudomonas_phage	44.2	4.9e-31
AZL62196.1|740444_741359_-|plate	baseplate assembly protein	plate	A0A193GYM8	Enterobacter_phage	47.1	1.2e-61
AZL62197.1|741348_741696_-|plate	baseplate assembly protein	plate	D4HTV2	Vibrio_phage	47.3	6.4e-21
AZL62198.1|741734_742853_-	late control protein D	NA	R9TNM7	Vibrio_phage	33.7	1.1e-37
AZL62199.1|742854_743070_-|tail	phage tail protein	tail	R9TR63	Vibrio_phage	51.4	1.1e-12
AZL62200.1|743044_743515_-|tail	phage tail protein	tail	D4HTW5	Vibrio_phage	33.3	7.1e-15
AZL62201.1|743511_745320_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	40.3	4.7e-30
AZL62202.1|745434_745722_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AZL62203.1|745777_746284_-|tail	phage tail protein	tail	NA	NA	NA	NA
AZL62204.1|746280_747750_-|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	37.3	7.8e-76
AZL62205.1|747788_748406_-|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	34.0	2.2e-16
AZL62206.1|748398_748953_-	hypothetical protein	NA	NA	NA	NA	NA
AZL62207.1|748961_749624_-	hypothetical protein	NA	R9TR34	Vibrio_phage	36.7	4.2e-21
AZL62208.1|749625_749982_-	hypothetical protein	NA	NA	NA	NA	NA
AZL62209.1|749981_750317_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	44.5	2.6e-11
AZL66029.1|750386_752444_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	53.2	3.5e-199
AZL62210.1|752436_753957_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	55.4	5.6e-154
AZL62211.1|753965_754181_-	hypothetical protein	NA	NA	NA	NA	NA
AZL62212.1|754177_756298_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	74.5	3.2e-304
AZL66030.1|756301_756805_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	62.3	1.2e-47
AZL62213.1|756861_757287_-	hypothetical protein	NA	NA	NA	NA	NA
AZL62214.1|757363_757636_-	hypothetical protein	NA	NA	NA	NA	NA
AZL62215.1|757815_758034_-	hypothetical protein	NA	NA	NA	NA	NA
AZL62216.1|758112_758655_-	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	80.0	4.1e-67
AZL62217.1|758651_759137_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	72.0	2.9e-64
AZL62218.1|759123_759465_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	67.3	7.4e-38
AZL62219.1|759517_759811_-	hypothetical protein	NA	NA	NA	NA	NA
AZL62220.1|759870_760161_-	hypothetical protein	NA	NA	NA	NA	NA
AZL62221.1|760129_760960_-	hypothetical protein	NA	I6PD67	Cronobacter_phage	80.1	8.2e-123
AZL62222.1|760963_761212_-	hypothetical protein	NA	I6PCV4	Cronobacter_phage	85.4	1.8e-30
AZL62223.1|761547_762150_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	64.3	2.5e-73
AZL62224.1|762146_762503_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	58.5	3.5e-38
AZL62225.1|762495_763983_-	DNA cytosine methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	51.6	2.1e-137
AZL62226.1|763975_764272_-	hypothetical protein	NA	Q6V7S4	Burkholderia_virus	58.1	8.4e-22
AZL62227.1|764416_764635_-	hypothetical protein	NA	NA	NA	NA	NA
AZL62228.1|764806_765130_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	65.7	5.4e-30
AZL62229.1|765593_766115_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	44.4	8.7e-30
AZL62230.1|766507_766774_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	71.2	7.8e-27
AZL62231.1|766974_767649_-	DUF1627 domain-containing protein	NA	NA	NA	NA	NA
AZL62232.1|767666_768407_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	73.1	1.7e-100
AZL62233.1|768409_769327_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	41.4	2.9e-52
AZL62234.1|769349_769802_-	hypothetical protein	NA	NA	NA	NA	NA
AZL62235.1|769801_770059_-	hypothetical protein	NA	NA	NA	NA	NA
AZL62236.1|770153_770549_+	hypothetical protein	NA	NA	NA	NA	NA
AZL62237.1|771236_771422_+	hypothetical protein	NA	NA	NA	NA	NA
AZL62238.1|771489_771762_+	hypothetical protein	NA	H6WRX2	Salmonella_phage	51.9	1.8e-15
AZL62239.1|771983_773888_+	exodeoxyribonuclease VIII	NA	S4TNL0	Salmonella_phage	31.0	3.3e-26
AZL62240.1|773874_774114_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	59.2	1.7e-17
AZL62241.1|774175_774391_+	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	56.3	4.8e-19
AZL66031.1|774390_775677_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	49.1	4.7e-109
AZL66032.1|775750_776422_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AZL62242.1|776422_777886_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
AZL62243.1|777978_779100_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AZL62244.1|779143_780367_-	peptidase T	NA	NA	NA	NA	NA
AZL62245.1|780527_781532_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
>prophage 6
CP034336	Enterobacter asburiae strain CAV1043 chromosome, complete genome	5046183	3163142	3268979	5046183	integrase,transposase,tail,protease,tRNA,portal,head,capsid,terminase	uncultured_Caudovirales_phage(41.38%)	95	3179526:3179543	3212403:3212420
AZL64341.1|3163142_3164090_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.0	1.9e-06
AZL64342.1|3164115_3164625_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	3.3e-18
AZL64343.1|3164752_3165877_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AZL64344.1|3165848_3166322_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
AZL64345.1|3166348_3166903_+	hypothetical protein	NA	NA	NA	NA	NA
AZL64346.1|3166895_3167468_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	A0A291ATS8	Pandoravirus	27.1	1.9e-09
AZL64347.1|3167472_3168291_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
AZL64348.1|3168287_3168536_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
AZL64349.1|3168511_3169066_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AZL64350.1|3174882_3175641_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.3	2.0e-19
AZL66125.1|3175648_3176752_-	ABC transporter permease	NA	NA	NA	NA	NA
AZL64351.1|3176761_3177943_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AZL64352.1|3178010_3179036_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	40.9	6.2e-72
AZL64353.1|3179509_3179731_-	hypothetical protein	NA	NA	NA	NA	NA
3179526:3179543	attL	ACAATACCCAGCGTCAGA	NA	NA	NA	NA
AZL64354.1|3180034_3183148_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AZL64355.1|3183159_3184299_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AZL64356.1|3184685_3185405_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
AZL64357.1|3185320_3187402_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	35.9	5.4e-22
AZL64358.1|3187541_3187706_-	DUF2556 domain-containing protein	NA	NA	NA	NA	NA
AZL64359.1|3188071_3189298_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.4e-150
AZL64360.1|3189389_3190196_+	hypothetical protein	NA	NA	NA	NA	NA
AZL64361.1|3190300_3190585_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AZL64362.1|3190593_3191373_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	52.0	3.6e-40
AZL66126.1|3191836_3192373_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGN8	uncultured_Caudovirales_phage	52.3	1.6e-10
AZL64363.1|3192365_3192563_+	hypothetical protein	NA	NA	NA	NA	NA
AZL64364.1|3192555_3192783_+	aminotransferase	NA	A0A2H4JBA1	uncultured_Caudovirales_phage	90.1	3.0e-27
AZL64365.1|3192779_3193148_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	82.8	5.7e-52
AZL64366.1|3193144_3193510_+	hypothetical protein	NA	NA	NA	NA	NA
AZL64367.1|3193509_3195639_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.4	4.1e-187
AZL64368.1|3195984_3196320_+	hypothetical protein	NA	NA	NA	NA	NA
AZL64369.1|3196366_3196879_-	hypothetical protein	NA	NA	NA	NA	NA
AZL64370.1|3197141_3198302_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.6	4.1e-205
AZL64371.1|3198353_3198914_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	92.5	2.8e-95
AZL64372.1|3198915_3200151_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	97.3	1.3e-236
AZL64373.1|3200147_3200486_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	92.9	1.1e-52
AZL64374.1|3200482_3200776_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	90.7	2.2e-46
AZL64375.1|3200775_3201219_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	93.9	3.9e-79
AZL64376.1|3201492_3201849_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	94.9	3.0e-58
AZL64377.1|3201832_3203494_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	97.8	0.0e+00
AZL66127.1|3203526_3204120_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	51.8	5.9e-51
AZL64378.1|3204128_3204317_+	hypothetical protein	NA	NA	NA	NA	NA
AZL64379.1|3204470_3204767_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
AZL64380.1|3204790_3205756_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AZL66128.1|3206086_3206827_-	carbonic anhydrase family protein	NA	NA	NA	NA	NA
AZL64381.1|3206955_3207837_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AZL66129.1|3207848_3209300_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
AZL64382.1|3209289_3209532_-	DUF997 family protein	NA	NA	NA	NA	NA
AZL64383.1|3209640_3210990_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AZL64384.1|3211000_3211462_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
AZL64385.1|3211483_3211936_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AZL64386.1|3212170_3212770_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
3212403:3212420	attR	ACAATACCCAGCGTCAGA	NA	NA	NA	NA
AZL64387.1|3212770_3213772_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
AZL64388.1|3213849_3214824_-	oxidoreductase	NA	NA	NA	NA	NA
AZL64389.1|3215006_3216947_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
AZL64390.1|3217229_3218273_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
AZL64391.1|3218335_3219352_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AZL64392.1|3219351_3219840_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AZL64393.1|3219849_3220443_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AZL64394.1|3220432_3221902_+	ribonuclease G	NA	NA	NA	NA	NA
AZL64395.1|3221944_3225748_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
AZL64396.1|3225832_3227278_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AZL64397.1|3227354_3228281_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
AZL64398.1|3228460_3228664_+	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
AZL64399.1|3228671_3229604_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
AZL64400.1|3229609_3231577_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
AZL64401.1|3231666_3233121_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AZL64402.1|3233166_3233439_+	hypothetical protein	NA	NA	NA	NA	NA
AZL64403.1|3233500_3233767_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AZL64404.1|3233878_3234142_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AZL64405.1|3234517_3234988_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
AZL64406.1|3235385_3236324_+	malate dehydrogenase	NA	NA	NA	NA	NA
AZL64407.1|3236381_3237449_-|protease	serine endoprotease DegS	protease	NA	NA	NA	NA
AZL64408.1|3237540_3238908_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.4	3.5e-22
AZL64409.1|3239079_3239478_-	DUF1043 family protein	NA	NA	NA	NA	NA
AZL64410.1|3239713_3240694_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
AZL64411.1|3240867_3241992_+	cell division protein ZapE	NA	NA	NA	NA	NA
AZL64412.1|3242291_3242720_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AZL64413.1|3242735_3243128_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
AZL64414.1|3243436_3244075_+	stringent starvation protein A	NA	NA	NA	NA	NA
AZL64415.1|3244080_3244578_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.8	1.1e-26
AZL64416.1|3244681_3245464_+	transcriptional regulator NanR	NA	NA	NA	NA	NA
AZL64417.1|3245586_3246480_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
AZL64418.1|3246551_3248036_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	22.4	3.7e-09
AZL64419.1|3248032_3248893_+	ROK family protein	NA	NA	NA	NA	NA
AZL64420.1|3248889_3249357_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
AZL64421.1|3249392_3250811_-	glutamate synthase small subunit	NA	NA	NA	NA	NA
AZL64422.1|3250820_3255281_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
AZL64423.1|3255968_3256901_+	TIGR01212 family radical SAM protein	NA	NA	NA	NA	NA
AZL64424.1|3259428_3260208_+	DUF3274 domain-containing protein	NA	NA	NA	NA	NA
AZL66130.1|3260280_3260928_+	hypothetical protein	NA	NA	NA	NA	NA
AZL64425.1|3261012_3262515_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.0	4.4e-82
AZL64426.1|3262653_3264300_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
AZL64427.1|3264392_3265412_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.2e-43
AZL64428.1|3265496_3266000_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZL64429.1|3266123_3268979_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	6.0e-141
>prophage 7
CP034336	Enterobacter asburiae strain CAV1043 chromosome, complete genome	5046183	3400327	3427250	5046183	integrase,transposase,plate,tail,tRNA,lysis	Erwinia_phage(39.29%)	31	3394975:3394989	3425247:3425261
3394975:3394989	attL	CTGACGCGCAGGCTC	NA	NA	NA	NA
AZL64557.1|3400327_3401338_-|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	97.5	1.0e-188
AZL64558.1|3401340_3401916_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	63.3	4.4e-67
AZL64559.1|3402143_3402482_+	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	71.2	1.5e-38
AZL64560.1|3402550_3402778_+	DUF2732 family protein	NA	A0A0M3UL87	Salmonella_phage	62.7	2.9e-14
AZL64561.1|3402777_3402999_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	75.0	2.1e-25
AZL64562.1|3403000_3405190_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	73.1	0.0e+00
AZL64563.1|3405299_3405740_+	DinI family protein	NA	A0A218M4I0	Erwinia_phage	75.2	8.0e-53
AZL64564.1|3405919_3406123_+|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	71.6	4.0e-23
AZL64565.1|3406113_3406335_+	primosomal protein	NA	A0A218M4L5	Erwinia_phage	73.6	3.9e-24
AZL64566.1|3406318_3406828_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	81.5	9.6e-74
AZL64567.1|3406824_3407250_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	56.7	2.1e-29
AZL64568.1|3407209_3407383_+|lysis	phage lysis protein	lysis	S4TNY4	Salmonella_phage	74.5	8.1e-17
AZL64569.1|3407345_3407813_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	60.6	1.4e-50
AZL64570.1|3407925_3408567_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	76.5	3.0e-88
AZL64571.1|3408563_3408914_+|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	70.7	3.1e-39
AZL64572.1|3408919_3409828_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	80.8	2.0e-130
AZL64573.1|3409820_3410351_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	86.4	3.8e-89
AZL66137.1|3412125_3412758_+|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	45.6	3.6e-30
AZL64574.1|3413478_3414483_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AZL64575.1|3415409_3415928_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	80.8	7.7e-79
AZL64576.1|3415984_3416293_+|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	65.3	3.4e-26
AZL66138.1|3416325_3416445_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	89.7	9.7e-14
AZL64577.1|3416437_3418717_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	40.7	9.7e-134
AZL64578.1|3418728_3419193_+|tail	phage tail protein	tail	O80317	Escherichia_phage	66.7	6.9e-55
AZL64579.1|3419189_3420344_+	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	62.2	5.1e-131
AZL64580.1|3420411_3420612_+	late control protein B	NA	A0A2I8TV89	Erwinia_phage	79.6	6.3e-21
AZL64581.1|3420883_3421390_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
AZL64582.1|3421922_3423770_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
AZL64583.1|3423923_3425669_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	1.4e-76
3425247:3425261	attR	CTGACGCGCAGGCTC	NA	NA	NA	NA
AZL64584.1|3425784_3426000_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AZL64585.1|3426236_3427250_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.3	1.8e-108
>prophage 8
CP034336	Enterobacter asburiae strain CAV1043 chromosome, complete genome	5046183	3612561	3655804	5046183	integrase,transposase,tRNA,capsid	Escherichia_phage(27.27%)	48	3636949:3636976	3651361:3651388
AZL64748.1|3612561_3613542_-|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
AZL64749.1|3613834_3614101_+	FAD assembly factor SdhE	NA	NA	NA	NA	NA
AZL64750.1|3614081_3614492_+	hypothetical protein	NA	NA	NA	NA	NA
AZL64751.1|3614498_3615020_-	flavodoxin FldB	NA	NA	NA	NA	NA
AZL64752.1|3615121_3616018_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.8	6.7e-30
AZL64753.1|3616046_3616760_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AZL64754.1|3616765_3618499_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.1	1.7e-61
AZL64755.1|3618589_3619687_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	3.1e-05
AZL64756.1|3619697_3621215_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.5	7.7e-87
AZL64757.1|3621253_3621796_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
AZL64758.1|3621959_3622703_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A7K9	Microcystis_virus	34.9	6.4e-10
AZL64759.1|3623367_3624093_+	HNH endonuclease	NA	NA	NA	NA	NA
AZL64760.1|3624213_3624990_+	hypothetical protein	NA	NA	NA	NA	NA
AZL66151.1|3625446_3625650_+	hypothetical protein	NA	NA	NA	NA	NA
AZL64761.1|3625934_3626315_+	hypothetical protein	NA	NA	NA	NA	NA
AZL64762.1|3626703_3627246_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
AZL64763.1|3627248_3627605_+	hypothetical protein	NA	NA	NA	NA	NA
AZL64764.1|3627781_3628339_-	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	39.2	8.7e-28
AZL64765.1|3628619_3628970_-	hypothetical protein	NA	NA	NA	NA	NA
AZL64766.1|3629155_3629362_+	hypothetical protein	NA	NA	NA	NA	NA
AZL64767.1|3630345_3630582_+	hypothetical protein	NA	NA	NA	NA	NA
AZL64768.1|3632510_3632864_-	NIPSNAP family protein	NA	NA	NA	NA	NA
AZL66152.1|3632863_3633277_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZL64769.1|3633760_3634228_+	hypothetical protein	NA	NA	NA	NA	NA
AZL64770.1|3634320_3635517_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
AZL64771.1|3635653_3636859_-|integrase	integrase	integrase	NA	NA	NA	NA
3636949:3636976	attL	TTTGTTCGATTCCCTTCGCCCGCTCCAG	NA	NA	NA	NA
AZL64772.1|3637709_3637988_-	hypothetical protein	NA	NA	NA	NA	NA
AZL64773.1|3638063_3638279_-	hypothetical protein	NA	NA	NA	NA	NA
AZL64774.1|3638272_3638851_-|integrase	integrase	integrase	A0A0S2GLG4	Bacillus_phage	26.3	2.6e-11
AZL64775.1|3640370_3640559_+	hypothetical protein	NA	NA	NA	NA	NA
AZL64776.1|3640568_3641492_+	hypothetical protein	NA	A0A2I7R666	Vibrio_phage	29.1	1.4e-06
AZL64777.1|3641488_3642247_+	hypothetical protein	NA	NA	NA	NA	NA
AZL64778.1|3642259_3642538_+	hypothetical protein	NA	NA	NA	NA	NA
AZL64779.1|3642549_3642930_+	hypothetical protein	NA	NA	NA	NA	NA
AZL64780.1|3642922_3643132_+	hypothetical protein	NA	NA	NA	NA	NA
AZL64781.1|3643121_3643439_+	hypothetical protein	NA	NA	NA	NA	NA
AZL64782.1|3644084_3644315_+	hypothetical protein	NA	NA	NA	NA	NA
AZL64783.1|3644538_3645519_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
AZL64784.1|3645500_3645896_+	hypothetical protein	NA	NA	NA	NA	NA
AZL64785.1|3645912_3646953_+|capsid	major capsid protein E	capsid	NA	NA	NA	NA
AZL64786.1|3647063_3647252_+	hypothetical protein	NA	NA	NA	NA	NA
AZL64787.1|3647251_3649114_+	hypothetical protein	NA	K7QJV2	Escherichia_phage	33.9	1.4e-66
AZL64788.1|3649155_3649827_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AZL64789.1|3650083_3651292_-|integrase	integrase	integrase	NA	NA	NA	NA
AZL64790.1|3651913_3652468_+	hypothetical protein	NA	NA	NA	NA	NA
3651361:3651388	attR	TTTGTTCGATTCCCTTCGCCCGCTCCAG	NA	NA	NA	NA
AZL64791.1|3653033_3654005_-	hypothetical protein	NA	NA	NA	NA	NA
AZL64792.1|3654017_3654491_-	hypothetical protein	NA	NA	NA	NA	NA
AZL64793.1|3654787_3655804_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
>prophage 9
CP034336	Enterobacter asburiae strain CAV1043 chromosome, complete genome	5046183	3995629	4003723	5046183	integrase	Morganella_phage(50.0%)	9	3995382:3995405	4008285:4008308
3995382:3995405	attL	CACATTAAGAAAAGCAAATAAGCT	NA	NA	NA	NA
AZL65092.1|3995629_3996883_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	60.3	5.5e-147
AZL65093.1|3996976_3997864_+	hypothetical protein	NA	NA	NA	NA	NA
AZL65094.1|3997967_3998171_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AZL65095.1|3998170_3998605_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	52.9	5.2e-28
AZL65096.1|3998618_3999461_+	antA/AntB antirepressor family protein	NA	A0A0P0ZG08	Escherichia_phage	48.0	1.7e-22
AZL65097.1|3999453_4000134_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
AZL65098.1|4000130_4000328_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	51.9	2.1e-08
AZL65099.1|4000324_4000951_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	38.4	7.7e-25
AZL65100.1|4000963_4003723_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.9	6.4e-297
4008285:4008308	attR	CACATTAAGAAAAGCAAATAAGCT	NA	NA	NA	NA
>prophage 10
CP034336	Enterobacter asburiae strain CAV1043 chromosome, complete genome	5046183	4430141	4437527	5046183		Enterobacteria_phage(42.86%)	8	NA	NA
AZL65458.1|4430141_4431533_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.8	3.7e-19
AZL65459.1|4431709_4432603_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	1.8e-43
AZL65460.1|4432922_4433516_+	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	30.8	1.6e-08
AZL65461.1|4433515_4434100_+	acyltransferase	NA	NA	NA	NA	NA
AZL65462.1|4434132_4435215_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.8	2.8e-99
AZL65463.1|4435247_4436123_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	61.3	2.7e-100
AZL65464.1|4436149_4436710_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	54.4	1.2e-48
AZL65465.1|4436702_4437527_+	NAD(P)-dependent oxidoreductase	NA	M4QPK0	Synechococcus_phage	25.1	1.1e-07
>prophage 11
CP034336	Enterobacter asburiae strain CAV1043 chromosome, complete genome	5046183	5025388	5042271	5046183	transposase,head	Pseudomonas_phage(50.0%)	30	NA	NA
AZL65971.1|5025388_5025811_-	hypothetical protein	NA	A0A076FSV9	Pseudomonas_phage	49.2	8.9e-09
AZL65972.1|5026007_5026220_+	transcriptional regulator	NA	A0A0C4UQU0	Shigella_phage	72.5	5.1e-21
AZL65973.1|5026221_5028276_+|transposase	transposase	transposase	A0A2D1GNK9	Pseudomonas_phage	45.8	8.4e-161
AZL65974.1|5028287_5029181_+	ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	59.8	4.7e-100
AZL65975.1|5029191_5029482_+	hypothetical protein	NA	NA	NA	NA	NA
AZL65976.1|5029494_5029701_+	hypothetical protein	NA	NA	NA	NA	NA
AZL65977.1|5029690_5030335_+	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	64.6	9.3e-74
AZL65978.1|5030336_5030570_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
AZL65979.1|5030559_5030751_+	hypothetical protein	NA	NA	NA	NA	NA
AZL65980.1|5030831_5031551_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	33.2	1.9e-27
AZL65981.1|5031547_5031886_+	hypothetical protein	NA	NA	NA	NA	NA
AZL65982.1|5031890_5032136_+	hypothetical protein	NA	A0A0M3ULJ3	Salmonella_phage	81.5	1.7e-36
AZL65983.1|5032140_5032401_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	72.6	1.5e-27
AZL65984.1|5032567_5032942_+	DUF4406 domain-containing protein	NA	A0A1V0E824	Vibrio_phage	52.2	5.8e-20
AZL65985.1|5032934_5033150_+	hypothetical protein	NA	NA	NA	NA	NA
AZL65986.1|5033149_5033368_+	hypothetical protein	NA	NA	NA	NA	NA
AZL65987.1|5033327_5033543_+	hypothetical protein	NA	A0A2D1GNS9	Pseudomonas_phage	63.4	2.6e-20
AZL65988.1|5033604_5034081_+	regulatory protein GemA	NA	A0A2D1GNN4	Pseudomonas_phage	62.2	1.6e-43
AZL65989.1|5034025_5034460_+	hypothetical protein	NA	A0A2D1GNW5	Pseudomonas_phage	47.0	5.2e-28
AZL65990.1|5034459_5034966_+	hypothetical protein	NA	NA	NA	NA	NA
AZL65991.1|5035044_5035689_+	glycoside hydrolase family 19 protein	NA	A0A248XCW5	Klebsiella_phage	56.3	4.3e-63
AZL65992.1|5035685_5035949_+	DUF2644 domain-containing protein	NA	A0A2D1GNW8	Pseudomonas_phage	57.3	4.8e-13
AZL65993.1|5035914_5036547_+	hypothetical protein	NA	NA	NA	NA	NA
AZL65994.1|5036555_5036798_+	hypothetical protein	NA	NA	NA	NA	NA
AZL65995.1|5036794_5037079_+	hypothetical protein	NA	NA	NA	NA	NA
AZL65996.1|5037080_5037581_+	DUF1804 family protein	NA	L7P7L4	Pseudomonas_phage	54.1	1.2e-47
AZL65997.1|5037573_5037780_+	hypothetical protein	NA	NA	NA	NA	NA
AZL65998.1|5037804_5039454_+	hypothetical protein	NA	H6V8N6	Pseudomonas_phage	66.1	2.2e-212
AZL65999.1|5039456_5041025_+	DUF935 domain-containing protein	NA	A0A0U5KSI0	unidentified_phage	45.4	4.6e-127
AZL66000.1|5041011_5042271_+|head	phage head morphogenesis protein	head	A0A0M4UTA3	Ralstonia_phage	35.1	6.7e-52
