The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034337	Pseudomonas entomophila strain 2014 chromosome, complete genome	5686346	3495300	3542675	5686346	terminase,integrase,capsid,bacteriocin,portal,tail,protease,plate,holin,head	Pseudomonas_phage(47.83%)	70	3494769:3494828	3534780:3534875
3494769:3494828	attL	CCCACAAAGAAAAACCCCGCAGACGTTAATCTGCGGGGCTTTCGAATATGGAGGCCGAGG	NA	NA	NA	NA
AZL74511.1|3495300_3495594_-	hypothetical protein	NA	A0A2H4JER5	uncultured_Caudovirales_phage	66.0	2.0e-28
AZL74512.1|3495665_3496262_-	hypothetical protein	NA	NA	NA	NA	NA
AZL74513.1|3496329_3496833_-	DUF2514 domain-containing protein	NA	A0A2H4J3Q6	uncultured_Caudovirales_phage	62.6	6.4e-30
AZL74514.1|3496829_3497459_-	glycoside hydrolase family 19 protein	NA	A0A2H4J3Y3	uncultured_Caudovirales_phage	80.2	9.6e-92
AZL74515.1|3497499_3497859_-	hypothetical protein	NA	NA	NA	NA	NA
AZL74516.1|3497861_3499229_-	hypothetical protein	NA	B5TK77	Pseudomonas_phage	48.0	5.3e-18
AZL74517.1|3499239_3499839_-	DUF2313 domain-containing protein	NA	B5TK76	Pseudomonas_phage	65.3	1.7e-74
AZL74518.1|3499826_3500867_-|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	69.3	1.3e-133
AZL74519.1|3500856_3501252_-	hypothetical protein	NA	B5TK74	Pseudomonas_phage	68.3	2.3e-43
AZL74520.1|3501248_3501806_-|plate	phage baseplate assembly protein V	plate	B5TK73	Pseudomonas_phage	57.1	5.6e-51
AZL74521.1|3501802_3502912_-|plate	baseplate protein	plate	B5TK72	Pseudomonas_phage	59.5	3.9e-112
AZL76512.1|3502915_3504178_-	hydroxyacid dehydrogenase	NA	B5TK71	Pseudomonas_phage	46.2	2.3e-92
AZL74522.1|3504180_3506079_-|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	52.7	3.8e-115
AZL74523.1|3506209_3506506_-|tail	phage tail assembly protein	tail	B5TK69	Pseudomonas_phage	72.0	1.7e-30
AZL74524.1|3506502_3506850_-|tail	phage tail protein	tail	B5TK68	Pseudomonas_phage	72.2	2.2e-45
AZL74525.1|3506910_3508407_-|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	73.1	7.4e-207
AZL74526.1|3508406_3508589_-	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	68.3	1.4e-16
AZL74527.1|3508585_3509176_-	hypothetical protein	NA	B5TK65	Pseudomonas_phage	56.6	4.5e-59
AZL74528.1|3509206_3509728_-	hypothetical protein	NA	NA	NA	NA	NA
AZL74529.1|3509720_3510083_-|head,tail	head-tail adaptor protein	head,tail	Q8HAC9	Salmonella_phage	43.9	1.3e-16
AZL74530.1|3510082_3510391_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J8C5	uncultured_Caudovirales_phage	68.6	4.9e-33
AZL74531.1|3510391_3510703_-	hypothetical protein	NA	NA	NA	NA	NA
AZL74532.1|3510757_3511960_-|capsid	phage major capsid protein	capsid	A0A2H4J8D1	uncultured_Caudovirales_phage	64.2	1.6e-143
AZL74533.1|3511956_3512598_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JA51	uncultured_Caudovirales_phage	79.2	1.5e-92
AZL74534.1|3512584_3513799_-|portal	phage portal protein	portal	A0A2H4JFN7	uncultured_Caudovirales_phage	73.3	2.6e-170
AZL74535.1|3513801_3515481_-|terminase	terminase large subunit	terminase	A0A2H4JDK9	uncultured_Caudovirales_phage	65.4	1.5e-195
AZL74536.1|3515484_3515976_-|terminase	terminase small subunit	terminase	A0A2H4J8R0	uncultured_Caudovirales_phage	46.5	1.6e-22
AZL74537.1|3516092_3516428_-	HNH endonuclease	NA	B5WZZ4	Pseudomonas_phage	55.0	6.6e-31
AZL74538.1|3516427_3516751_-|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	60.2	6.6e-28
AZL74539.1|3516824_3517376_-	hypothetical protein	NA	NA	NA	NA	NA
AZL74540.1|3517558_3518245_-	hypothetical protein	NA	A0A1B0VMF2	Pseudomonas_phage	65.8	1.2e-82
AZL74541.1|3518256_3518574_-	hypothetical protein	NA	A0A2D1GNG3	Pseudomonas_phage	64.8	1.6e-31
AZL74542.1|3518570_3518867_-	hypothetical protein	NA	NA	NA	NA	NA
AZL74543.1|3518863_3520150_-|integrase	site-specific integrase	integrase	A0A2D1GND4	Pseudomonas_phage	53.1	3.3e-123
AZL74544.1|3520146_3520443_-	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	71.0	8.9e-32
AZL76513.1|3520424_3520631_-	hypothetical protein	NA	NA	NA	NA	NA
AZL74545.1|3520639_3521323_-	Replication protein P	NA	B5WZY0	Pseudomonas_phage	49.7	4.2e-48
AZL74546.1|3521319_3522048_-	hypothetical protein	NA	A0A1J0MCP9	Streptomyces_phage	41.7	5.3e-17
AZL74547.1|3522289_3522466_-	Cro/Cl family transcriptional regulator	NA	A0A0S2SYB8	Pseudomonas_phage	62.7	5.5e-13
AZL74548.1|3522554_3523412_+	Cro/Cl family transcriptional regulator	NA	A0A0S2SYF7	Pseudomonas_phage	63.6	3.9e-96
AZL74549.1|3523476_3523749_+	hypothetical protein	NA	NA	NA	NA	NA
AZL74550.1|3523745_3524234_+	hypothetical protein	NA	NA	NA	NA	NA
AZL74551.1|3524280_3524577_-	DUF1654 domain-containing protein	NA	A0A0S2SYC9	Pseudomonas_phage	49.1	3.9e-19
AZL74552.1|3525215_3525599_+	LuxR family transcriptional regulator	NA	A0A2H4JA92	uncultured_Caudovirales_phage	55.9	4.4e-23
AZL74553.1|3525619_3525889_+	hypothetical protein	NA	NA	NA	NA	NA
AZL74554.1|3525885_3526431_+	hypothetical protein	NA	NA	NA	NA	NA
AZL74555.1|3526512_3526761_+	hypothetical protein	NA	NA	NA	NA	NA
AZL74556.1|3526838_3527846_+	nucleoid-associated protein YejK	NA	L7TI92	Pseudomonas_virus	66.0	1.1e-126
AZL74557.1|3527877_3528534_-	hypothetical protein	NA	NA	NA	NA	NA
AZL74558.1|3528632_3528941_+	hypothetical protein	NA	A0A2H4J1V6	uncultured_Caudovirales_phage	92.2	6.2e-44
AZL74559.1|3528944_3529334_+	hypothetical protein	NA	A0A2H4J2C6	uncultured_Caudovirales_phage	60.2	4.6e-36
AZL74560.1|3529348_3531061_+	DNA cytosine methyltransferase	NA	A0A2I7QRH3	Vibrio_phage	44.0	6.2e-101
AZL74561.1|3531269_3531692_+	hypothetical protein	NA	NA	NA	NA	NA
AZL74562.1|3531691_3531955_+	hypothetical protein	NA	A0A2H4J399	uncultured_Caudovirales_phage	81.6	2.3e-31
AZL74563.1|3531951_3532275_+	hypothetical protein	NA	A0A2H4J0N7	uncultured_Caudovirales_phage	85.0	4.4e-48
AZL74564.1|3532271_3532613_+	DUF4406 domain-containing protein	NA	A0A2K8I958	Pseudomonas_phage	51.1	3.3e-22
AZL74565.1|3532656_3532968_+	hypothetical protein	NA	I0J2X6	Dickeya_virus	45.3	2.9e-09
AZL74566.1|3533024_3533384_+	hypothetical protein	NA	NA	NA	NA	NA
AZL74567.1|3533421_3533658_+	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	73.1	9.0e-27
AZL74568.1|3533661_3534726_+|integrase	integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	59.4	1.4e-114
AZL76514.1|3535046_3536066_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	30.0	3.4e-22
3534780:3534875	attR	CCCACAAAGAAAAACCCCGCAGACGTTAATCTGCGGGGCTTTCGAATATGGAGGCCGAGGTCGGAATCGAACCGGCGTAGACGGATTTGCAATCCG	NA	NA	NA	NA
AZL74569.1|3536264_3536978_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
AZL74570.1|3537032_3537350_+	SCP-2 family sterol carrier protein	NA	NA	NA	NA	NA
AZL74571.1|3537538_3538606_+	phosphotransferase family protein	NA	NA	NA	NA	NA
AZL74572.1|3538639_3539407_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AZL74573.1|3539410_3540232_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZL74574.1|3540370_3541444_+	PAS domain S-box protein	NA	NA	NA	NA	NA
AZL74575.1|3541452_3541803_-	hypothetical protein	NA	NA	NA	NA	NA
AZL74576.1|3542038_3542221_+	hypothetical protein	NA	NA	NA	NA	NA
AZL74577.1|3542294_3542675_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 2
CP034337	Pseudomonas entomophila strain 2014 chromosome, complete genome	5686346	3550277	3558831	5686346	tRNA	uncultured_Caudovirales_phage(75.0%)	10	NA	NA
AZL74586.1|3550277_3550949_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	88.8	1.1e-101
AZL74587.1|3551137_3552517_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.4	3.7e-27
AZL74588.1|3552604_3552997_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	82.2	4.1e-56
AZL74589.1|3552998_3553358_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	65.8	4.3e-36
AZL74590.1|3553357_3553654_+	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	63.6	7.8e-28
AZL74591.1|3553650_3553986_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	76.6	7.5e-43
AZL74592.1|3553982_3554984_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	79.6	6.5e-151
AZL74593.1|3555080_3556040_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AZL74594.1|3556157_3557549_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
AZL74595.1|3557550_3558831_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	54.8	1.0e-95
>prophage 3
CP034337	Pseudomonas entomophila strain 2014 chromosome, complete genome	5686346	4257621	4354725	5686346	tail,protease,holin,tRNA,lysis,plate	uncultured_Caudovirales_phage(25.0%)	95	NA	NA
AZL75191.1|4257621_4259397_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	26.1	7.3e-12
AZL75192.1|4259491_4259713_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AZL75193.1|4259805_4260144_-	aryl-sulfate sulfotransferase	NA	NA	NA	NA	NA
AZL75194.1|4260325_4260799_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	37.1	6.2e-19
AZL75195.1|4261102_4261693_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	48.3	2.3e-10
AZL75196.1|4261711_4261918_-	hypothetical protein	NA	NA	NA	NA	NA
AZL75197.1|4261921_4262341_-	HIT domain-containing protein	NA	NA	NA	NA	NA
AZL75198.1|4263089_4264370_+	OprD family porin	NA	NA	NA	NA	NA
AZL75199.1|4264527_4266243_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AZL75200.1|4266264_4267218_+	hypothetical protein	NA	NA	NA	NA	NA
AZL75201.1|4267264_4268329_-	DNA polymerase IV	NA	NA	NA	NA	NA
AZL75202.1|4269294_4271937_+	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
AZL75203.1|4271936_4273229_+	virulence factor family protein	NA	NA	NA	NA	NA
AZL75204.1|4273264_4275175_-	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	34.0	7.0e-77
AZL75205.1|4275410_4276742_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
AZL75206.1|4276836_4277295_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZL75207.1|4277415_4278126_+	RNA-binding protein	NA	NA	NA	NA	NA
AZL75208.1|4278174_4278636_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	48.7	3.8e-37
AZL75209.1|4278635_4279331_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
AZL75210.1|4279408_4280188_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
AZL75211.1|4280308_4281235_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZL75212.1|4281238_4281604_-	diacylglycerol kinase	NA	NA	NA	NA	NA
AZL75213.1|4281679_4282330_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AZL75214.1|4282585_4283296_-	DTW domain-containing protein	NA	NA	NA	NA	NA
AZL75215.1|4283509_4283932_+	hypothetical protein	NA	NA	NA	NA	NA
AZL75216.1|4283933_4284134_-	hypothetical protein	NA	NA	NA	NA	NA
AZL75217.1|4284440_4285559_+	LOG family protein	NA	NA	NA	NA	NA
AZL75218.1|4285607_4286078_-	recombination regulator RecX	NA	NA	NA	NA	NA
AZL75219.1|4286086_4287154_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.7	9.2e-111
AZL75220.1|4287258_4287741_-	nicotinamide-nucleotide amidohydrolase family protein	NA	B5TK85	Pseudomonas_phage	76.7	3.1e-58
AZL75221.1|4287789_4288287_-|lysis	lysis protein	lysis	B5TK84	Pseudomonas_phage	48.2	1.0e-24
AZL75222.1|4288283_4288835_-	glycoside hydrolase family 19 protein	NA	B5TK83	Pseudomonas_phage	67.2	7.7e-69
AZL75223.1|4288752_4289031_-	Com family DNA-binding transcriptional regulator	NA	B5TK59	Pseudomonas_phage	66.7	1.4e-07
AZL75224.1|4289144_4290191_-	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	70.2	4.3e-137
AZL75225.1|4290242_4290449_-|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	62.7	7.4e-17
AZL75226.1|4290423_4291269_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	55.7	1.1e-82
AZL75227.1|4291279_4293304_-	hypothetical protein	NA	NA	NA	NA	NA
AZL75228.1|4293429_4293732_-|tail	phage tail assembly protein	tail	A0A2H4J873	uncultured_Caudovirales_phage	56.4	7.3e-21
AZL75229.1|4293744_4294254_-|tail	phage major tail tube protein	tail	A0A2H4JBU0	uncultured_Caudovirales_phage	70.7	3.4e-63
AZL75230.1|4294267_4295434_-|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	80.5	1.3e-179
AZL75231.1|4295597_4296497_-|tail	phage tail protein	tail	B5TK79	Pseudomonas_phage	50.9	1.0e-70
AZL75232.1|4296493_4296931_-|tail	phage tail protein	tail	B5TK82	Pseudomonas_phage	40.4	2.8e-21
AZL75233.1|4296939_4299519_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	32.3	2.6e-50
AZL75234.1|4299511_4300123_-|tail	phage tail protein I	tail	A0A2H4JDH5	uncultured_Caudovirales_phage	61.5	5.9e-62
AZL75235.1|4300124_4301006_-|plate	baseplate assembly protein	plate	A0A2H4JFK9	uncultured_Caudovirales_phage	66.9	6.9e-104
AZL75236.1|4301002_4301329_-|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	66.0	1.8e-33
AZL75237.1|4301325_4301571_-	Com family DNA-binding transcriptional regulator	NA	B5TK59	Pseudomonas_phage	68.6	1.9e-11
AZL75238.1|4301603_4302206_-|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	73.5	1.0e-45
AZL75239.1|4302202_4302700_-	hypothetical protein	NA	NA	NA	NA	NA
AZL75240.1|4302696_4303050_-|holin	pyocin R2, holin	holin	B5TK61	Pseudomonas_phage	81.2	1.1e-44
AZL75241.1|4303518_4304265_-	helix-turn-helix transcriptional regulator	NA	B5TK58	Pseudomonas_phage	83.5	2.7e-117
AZL75242.1|4304406_4306980_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	23.0	1.3e-25
AZL75243.1|4307119_4307443_+	Ferredoxin 1	NA	NA	NA	NA	NA
AZL75244.1|4307911_4308919_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	35.8	3.0e-34
AZL75245.1|4309024_4309882_-	LysM peptidoglycan-binding domain-containing protein	NA	I3PV79	Clostridium_phage	36.2	1.9e-13
AZL75246.1|4310059_4310740_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.5	2.4e-43
AZL75247.1|4310736_4311486_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.4	5.4e-65
AZL75248.1|4311473_4312532_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
AZL75249.1|4312528_4313002_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
AZL75250.1|4313179_4314028_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AZL76531.1|4314038_4315151_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.5	4.7e-33
AZL75251.1|4315259_4316156_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZL75252.1|4316287_4316995_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AZL75253.1|4316991_4317273_-	cell division protein FtsB	NA	NA	NA	NA	NA
AZL75254.1|4317429_4318719_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	59.4	4.3e-139
AZL75255.1|4318873_4319719_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.0	2.2e-51
AZL75256.1|4319722_4321351_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.9	4.5e-157
AZL75257.1|4321620_4322904_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
AZL75258.1|4323023_4323971_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
AZL75259.1|4324078_4327603_-	DNA polymerase III subunit alpha	NA	A0A1C9LWZ5	Streptomyces_phage	36.0	3.2e-192
AZL75260.1|4327792_4328416_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	41.5	1.6e-22
AZL75261.1|4328417_4329545_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AZL75262.1|4329546_4330323_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AZL75263.1|4330319_4330760_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
AZL75264.1|4330874_4331930_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AZL75265.1|4331931_4332435_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
AZL75266.1|4332479_4334828_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
AZL75267.1|4334903_4336256_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
AZL75268.1|4336289_4337480_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
AZL75269.1|4337476_4338292_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AZL75270.1|4338291_4339047_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	38.1	8.5e-18
AZL75271.1|4339062_4339620_-	ribosome recycling factor	NA	NA	NA	NA	NA
AZL75272.1|4339616_4340360_-	UMP kinase	NA	NA	NA	NA	NA
AZL75273.1|4340537_4341401_-	elongation factor Ts	NA	NA	NA	NA	NA
AZL75274.1|4341589_4342327_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
AZL75275.1|4342699_4343482_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
AZL75276.1|4343507_4346210_+	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
AZL75277.1|4346231_4347431_+	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
AZL75278.1|4347878_4348637_+	peptidase M12	NA	NA	NA	NA	NA
AZL75279.1|4348769_4350416_-	Na+/H+ antiporter	NA	NA	NA	NA	NA
AZL75280.1|4350700_4351048_+	ArsC family reductase	NA	NA	NA	NA	NA
AZL75281.1|4351079_4352114_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
AZL75282.1|4352192_4353398_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	37.9	8.1e-71
AZL75283.1|4353394_4353805_+	SufE family protein	NA	NA	NA	NA	NA
AZL75284.1|4353915_4354725_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	A0A291ATS8	Pandoravirus	33.6	4.5e-17
>prophage 4
CP034337	Pseudomonas entomophila strain 2014 chromosome, complete genome	5686346	4510019	4517792	5686346		Planktothrix_phage(16.67%)	10	NA	NA
AZL75414.1|4510019_4510829_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.2	5.9e-25
AZL75415.1|4511075_4512050_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	32.2	4.4e-35
AZL75416.1|4512050_4512575_+	HAD family hydrolase	NA	A0A140XBD6	Dickeya_phage	46.6	3.1e-27
AZL75417.1|4512583_4513156_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AZL75418.1|4513142_4513667_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
AZL75419.1|4513667_4514393_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.5	6.4e-23
AZL75420.1|4514577_4516071_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
AZL75421.1|4516149_4516458_+	ribosome-associated translation inhibitor RaiA	NA	A0A0M7QCF2	Escherichia_phage	35.2	1.5e-05
AZL75422.1|4516470_4516935_+	PTS IIA-like nitrogen-regulatory protein PtsN	NA	NA	NA	NA	NA
AZL75423.1|4516937_4517792_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.9	6.9e-08
