The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032509	Alphaproteobacteria bacterium WS11 chromosome, complete genome	4356607	1316595	1325517	4356607		Enterobacteria_phage(50.0%)	7	NA	NA
AZN70920.1|1316595_1317513_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3IB24	Synechococcus_phage	30.6	2.7e-26
AZN70921.1|1317564_1318617_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	46.1	1.3e-80
AZN70922.1|1318718_1319270_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	54.6	1.2e-48
AZN70923.1|1319266_1320145_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	60.4	1.7e-102
AZN73620.1|1320370_1321537_+	nucleotide sugar dehydrogenase	NA	M1HEJ3	Acanthocystis_turfacea_Chlorella_virus	48.5	9.8e-98
AZN70924.1|1321843_1322200_-	hypothetical protein	NA	NA	NA	NA	NA
AZN70925.1|1323387_1325517_-	AAA family ATPase	NA	A0A1V0SG63	Hokovirus	30.8	3.8e-15
>prophage 2
CP032509	Alphaproteobacteria bacterium WS11 chromosome, complete genome	4356607	2593998	2630957	4356607	tail,integrase,capsid,terminase,head,portal	Sinorhizobium_phage(35.0%)	44	2589237:2589252	2616999:2617014
2589237:2589252	attL	CCGCCTGAAAGGCGAC	NA	NA	NA	NA
AZN71976.1|2593998_2595360_+|integrase	integrase	integrase	NA	NA	NA	NA
AZN71977.1|2595423_2596722_+	hypothetical protein	NA	NA	NA	NA	NA
AZN71978.1|2596696_2596909_+	hypothetical protein	NA	NA	NA	NA	NA
AZN71979.1|2597001_2597823_-	hypothetical protein	NA	NA	NA	NA	NA
AZN71980.1|2597880_2598126_-	hypothetical protein	NA	NA	NA	NA	NA
AZN71981.1|2598138_2598426_-	hypothetical protein	NA	NA	NA	NA	NA
AZN71982.1|2598422_2598782_-	DUF4326 domain-containing protein	NA	A0A0A8IN79	Aurantimonas_phage	48.3	5.1e-21
AZN71983.1|2598778_2599936_-	phage Gp37/Gp68 family protein	NA	A0A291AUR0	Sinorhizobium_phage	53.8	1.3e-115
AZN71984.1|2600134_2600758_-	hypothetical protein	NA	A0A068C9C1	Rhizobium_phage	46.6	4.2e-07
AZN71985.1|2600757_2601042_-	hypothetical protein	NA	NA	NA	NA	NA
AZN71986.1|2601038_2601305_-	hypothetical protein	NA	NA	NA	NA	NA
AZN71987.1|2601451_2602126_-	hypothetical protein	NA	A0A141GF24	Brucella_phage	42.6	8.6e-30
AZN71988.1|2602219_2602444_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZN71989.1|2602685_2603189_+	hypothetical protein	NA	A0A291AUJ7	Sinorhizobium_phage	51.0	3.6e-33
AZN71990.1|2603276_2603915_+	hypothetical protein	NA	NA	NA	NA	NA
AZN71991.1|2603917_2604250_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZN73784.1|2604363_2604717_+	DUF2312 domain-containing protein	NA	Q8W6H2	Sinorhizobium_phage	67.7	3.0e-26
AZN71992.1|2604716_2605883_+	S-adenosylmethionine-binding protein	NA	M4MB46	Vibrio_phage	30.1	3.0e-14
AZN71993.1|2605875_2606202_+	hypothetical protein	NA	A0A291AUT2	Sinorhizobium_phage	44.2	2.9e-07
AZN71994.1|2606189_2608115_+	hypothetical protein	NA	A0A1X9HVK8	Ruegeria_phage	47.5	2.4e-141
AZN71995.1|2608111_2609452_+	hypothetical protein	NA	NA	NA	NA	NA
AZN71996.1|2609423_2610086_+	hypothetical protein	NA	NA	NA	NA	NA
AZN71997.1|2610405_2610768_+	HNH endonuclease	NA	NA	NA	NA	NA
AZN71998.1|2611098_2611590_+	hypothetical protein	NA	NA	NA	NA	NA
AZN71999.1|2611576_2613292_+|terminase	terminase large subunit	terminase	I3ULZ6	Rhodobacter_phage	59.8	4.2e-190
AZN72000.1|2613306_2614686_+|portal	phage portal protein	portal	M1PLL1	Streptococcus_phage	36.4	2.1e-62
AZN72001.1|2614682_2615588_+	S49 family peptidase	NA	A0A0N9S104	Escherichia_phage	40.0	6.1e-31
AZN72002.1|2615685_2616978_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	23.2	5.7e-06
AZN72003.1|2617053_2617467_+	hypothetical protein	NA	B0VK34	Azospirillum_phage	52.6	1.7e-28
2616999:2617014	attR	CCGCCTGAAAGGCGAC	NA	NA	NA	NA
AZN72004.1|2617521_2617860_+	hypothetical protein	NA	NA	NA	NA	NA
AZN72005.1|2617863_2618424_+|head,tail	phage gp6-like head-tail connector protein	head,tail	I3UM02	Rhodobacter_phage	36.1	1.8e-12
AZN72006.1|2618433_2618622_+	hypothetical protein	NA	NA	NA	NA	NA
AZN72007.1|2618599_2618959_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AZN72008.1|2618955_2619384_+	HK97 gp10 family phage protein	NA	B4UTQ0	Rhizobium_phage	46.4	3.5e-21
AZN72009.1|2619380_2619785_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
AZN72010.1|2619805_2620258_+	hypothetical protein	NA	NA	NA	NA	NA
AZN72011.1|2620254_2620638_+	gene transfer agent family protein	NA	NA	NA	NA	NA
AZN72012.1|2620819_2621161_-	hypothetical protein	NA	NA	NA	NA	NA
AZN72013.1|2621382_2623797_+|tail	phage tail tape measure protein	tail	A0A141GEX2	Brucella_phage	38.5	1.7e-91
AZN72014.1|2623796_2624447_+	hypothetical protein	NA	A0A291AUM9	Sinorhizobium_phage	42.1	7.2e-42
AZN72015.1|2624682_2624940_+	hypothetical protein	NA	NA	NA	NA	NA
AZN72016.1|2624936_2625527_+	DUF2163 domain-containing protein	NA	A0A291AUM8	Sinorhizobium_phage	57.6	3.5e-59
AZN72017.1|2625474_2625918_+	hypothetical protein	NA	NA	NA	NA	NA
AZN72018.1|2625935_2630957_+	hypothetical protein	NA	A0A291AUN1	Sinorhizobium_phage	58.9	9.1e-201
>prophage 3
CP032509	Alphaproteobacteria bacterium WS11 chromosome, complete genome	4356607	2841988	2851133	4356607	tRNA	uncultured_Mediterranean_phage(88.89%)	10	NA	NA
AZN73812.1|2841988_2843494_-	LysM peptidoglycan-binding domain-containing protein	NA	Q8SBN9	Clostridium_phage	40.9	1.3e-17
AZN73813.1|2843635_2844295_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	33.8	2.9e-14
AZN72193.1|2844307_2845078_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	33.6	1.4e-28
AZN72194.1|2845108_2846392_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	56.0	8.2e-98
AZN72195.1|2846513_2847338_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	43.3	2.9e-48
AZN72196.1|2847334_2848135_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AZN72197.1|2848182_2848395_-	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	70.5	1.3e-08
AZN72198.1|2848563_2849271_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	44.8	1.5e-40
AZN72199.1|2849263_2850100_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.7	4.6e-33
AZN72200.1|2850113_2851133_-	beta-N-acetylhexosaminidase	NA	A0A1B1IVS3	uncultured_Mediterranean_phage	43.9	2.8e-24
>prophage 4
CP032509	Alphaproteobacteria bacterium WS11 chromosome, complete genome	4356607	2884815	2928928	4356607	tail,capsid,terminase,tRNA,head,portal	Sinorhizobium_phage(87.5%)	48	NA	NA
AZN72225.1|2884815_2885553_+|tRNA	alanyl-tRNA editing protein	tRNA	NA	NA	NA	NA
AZN72226.1|2885584_2886466_+	3-mercaptopyruvate sulfurtransferase	NA	NA	NA	NA	NA
AZN73817.1|2886524_2887037_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZN72227.1|2887082_2888201_-	alanine dehydrogenase	NA	NA	NA	NA	NA
AZN73818.1|2888358_2888832_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AZN72228.1|2888941_2890591_+	MFS transporter	NA	NA	NA	NA	NA
AZN72229.1|2890616_2890925_-	hypothetical protein	NA	NA	NA	NA	NA
AZN73819.1|2891108_2893088_+	bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase	NA	NA	NA	NA	NA
AZN72230.1|2893132_2896648_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
AZN72231.1|2896650_2896950_-	succinate dehydrogenase assembly factor 2 family protein	NA	NA	NA	NA	NA
AZN72232.1|2897046_2899152_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
AZN72233.1|2899152_2899854_-	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	25.9	5.3e-14
AZN72234.1|2899951_2900713_-	cytochrome c biogenesis protein CcdA	NA	NA	NA	NA	NA
AZN72235.1|2901281_2902121_-	DNA adenine methylase	NA	A0A291AUP9	Sinorhizobium_phage	69.1	2.9e-112
AZN72236.1|2902189_2902639_+	hypothetical protein	NA	NA	NA	NA	NA
AZN72237.1|2902764_2902968_+	hypothetical protein	NA	NA	NA	NA	NA
AZN72238.1|2902993_2903212_+	hypothetical protein	NA	NA	NA	NA	NA
AZN72239.1|2903323_2903983_+	SOS response-associated peptidase	NA	A0A291AUP1	Sinorhizobium_phage	46.4	7.1e-53
AZN72240.1|2904206_2904467_-	hypothetical protein	NA	NA	NA	NA	NA
AZN72241.1|2904537_2904735_-	hypothetical protein	NA	NA	NA	NA	NA
AZN73820.1|2905057_2905429_+	thermonuclease family protein	NA	NA	NA	NA	NA
AZN72242.1|2905489_2905732_+	hypothetical protein	NA	NA	NA	NA	NA
AZN72243.1|2905790_2906096_-	hypothetical protein	NA	NA	NA	NA	NA
AZN72244.1|2906080_2906551_-	hypothetical protein	NA	NA	NA	NA	NA
AZN72245.1|2906550_2907717_-	DUF3380 domain-containing protein	NA	A0A0A8IK88	Aurantimonas_phage	57.7	7.0e-88
AZN72246.1|2908217_2908628_+	hypothetical protein	NA	NA	NA	NA	NA
AZN72247.1|2908618_2908852_-	hypothetical protein	NA	NA	NA	NA	NA
AZN72248.1|2908882_2909125_-	hypothetical protein	NA	NA	NA	NA	NA
AZN72249.1|2913964_2914399_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZN72250.1|2914398_2915064_-	hypothetical protein	NA	NA	NA	NA	NA
AZN73821.1|2915063_2915684_-	hypothetical protein	NA	NA	NA	NA	NA
AZN72251.1|2915704_2917585_-|tail	tail tape measure protein	tail	A0A291AUM6	Sinorhizobium_phage	37.4	3.8e-75
AZN72252.1|2917597_2917798_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
AZN72253.1|2917836_2918265_-	hypothetical protein	NA	A0A291AUM7	Sinorhizobium_phage	50.0	1.0e-20
AZN72254.1|2918264_2918681_-|tail	phage tail protein	tail	A0A291AUM5	Sinorhizobium_phage	59.7	6.2e-39
AZN72255.1|2918741_2919206_-	hypothetical protein	NA	A0A291AUM4	Sinorhizobium_phage	56.5	2.8e-40
AZN72256.1|2919202_2919526_-	hypothetical protein	NA	NA	NA	NA	NA
AZN73822.1|2919540_2919870_-	hypothetical protein	NA	NA	NA	NA	NA
AZN72257.1|2919869_2920238_-	hypothetical protein	NA	NA	NA	NA	NA
AZN72258.1|2920339_2921371_-|capsid	major capsid protein	capsid	A0A291AUL7	Sinorhizobium_phage	80.4	6.3e-165
AZN72259.1|2921424_2921781_-|head	head decoration protein	head	A0A291AUM0	Sinorhizobium_phage	72.0	2.2e-37
AZN72260.1|2921785_2922361_-	hypothetical protein	NA	A0A291AUL6	Sinorhizobium_phage	50.5	4.5e-11
AZN72261.1|2922408_2923305_-	S49 family peptidase	NA	A0A291AUM2	Sinorhizobium_phage	54.6	1.2e-74
AZN72262.1|2923301_2925008_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	73.2	6.1e-250
AZN72263.1|2925007_2925253_-|tail	phage tail protein	tail	NA	NA	NA	NA
AZN72264.1|2925255_2927295_-|terminase	terminase	terminase	A0A291AUK9	Sinorhizobium_phage	67.6	2.9e-286
AZN72265.1|2927291_2927981_-	hypothetical protein	NA	A0A291AUL0	Sinorhizobium_phage	53.0	3.7e-44
AZN73823.1|2928178_2928928_-	hypothetical protein	NA	A0A291AUL1	Sinorhizobium_phage	62.1	5.7e-83
>prophage 5
CP032509	Alphaproteobacteria bacterium WS11 chromosome, complete genome	4356607	3277803	3313413	4356607	tail,terminase,portal	Acidithiobacillus_phage(26.92%)	35	NA	NA
AZN72549.1|3277803_3278679_+	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	62.3	1.7e-94
AZN72550.1|3278780_3279404_+	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	54.4	2.3e-53
AZN72551.1|3279418_3281107_+	DEAD/DEAH box helicase	NA	A0A125RNY6	Streptomyces_phage	36.7	5.6e-46
AZN73876.1|3281314_3281521_+	hypothetical protein	NA	NA	NA	NA	NA
AZN72552.1|3281520_3282288_+	hypothetical protein	NA	K4HZA0	Acidithiobacillus_phage	54.0	5.0e-74
AZN72553.1|3282239_3284606_+	hypothetical protein	NA	A0A1B2LRS1	Wolbachia_phage	52.8	8.1e-75
AZN73877.1|3284997_3285486_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	61.8	1.9e-50
AZN72554.1|3285482_3285683_+	hypothetical protein	NA	NA	NA	NA	NA
AZN72555.1|3285675_3286056_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZN72556.1|3286472_3287849_+	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	38.2	8.9e-74
AZN72557.1|3287845_3288082_+	hypothetical protein	NA	K4I1E3	Acidithiobacillus_phage	65.7	2.6e-18
AZN72558.1|3288180_3288966_+	hypothetical protein	NA	NA	NA	NA	NA
AZN72559.1|3289026_3289614_-	DUF3489 domain-containing protein	NA	K4HZZ2	Acidithiobacillus_phage	73.9	2.7e-11
AZN72560.1|3289709_3290018_-	hypothetical protein	NA	F4YXM3	Roseobacter_phage	48.1	4.8e-12
AZN73878.1|3290762_3292679_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	59.9	9.8e-212
AZN72561.1|3292681_3292891_+	hypothetical protein	NA	NA	NA	NA	NA
AZN72562.1|3292890_3294420_+|portal	phage portal protein	portal	Q75QM9	Wolbachia_phage	38.9	3.1e-83
AZN72563.1|3294425_3296480_+	peptidase U37	NA	A0A2I7S8L6	Vibrio_phage	34.1	3.1e-86
AZN72564.1|3296557_3296893_+	DUF2190 family protein	NA	NA	NA	NA	NA
AZN72565.1|3296892_3297204_+	hypothetical protein	NA	NA	NA	NA	NA
AZN72566.1|3297200_3297830_+	hypothetical protein	NA	G8DH49	Emiliania_huxleyi_virus	53.4	5.7e-52
AZN72567.1|3297826_3298429_-	hypothetical protein	NA	NA	NA	NA	NA
AZN72568.1|3298476_3298896_+	acyl-CoA transferase	NA	G8DH50	Emiliania_huxleyi_virus	57.9	6.9e-38
AZN72569.1|3298920_3299862_+	hypothetical protein	NA	G8DH51	Emiliania_huxleyi_virus	55.4	1.0e-97
AZN72570.1|3299864_3300302_+	hypothetical protein	NA	NA	NA	NA	NA
AZN72571.1|3300521_3302939_+|tail	phage tail tape measure protein	tail	A0A1J0GUY9	Halomonas_phage	37.1	2.8e-22
AZN72572.1|3303000_3303627_+	TIGR02217 family protein	NA	A0A0B5A2K3	Paracoccus_phage	58.7	2.9e-64
AZN72573.1|3303623_3304508_+	DUF2163 domain-containing protein	NA	A0A0B5A5B8	Paracoccus_phage	45.7	5.4e-64
AZN72574.1|3304504_3304939_+	peptidase	NA	A0A1V0DYB6	Dinoroseobacter_phage	45.9	4.2e-30
AZN72575.1|3304949_3308915_+	hypothetical protein	NA	A0A0B5A7K5	Paracoccus_phage	42.8	6.4e-266
AZN72576.1|3308925_3310002_+	DUF2793 domain-containing protein	NA	A0A0B5A0F6	Paracoccus_phage	38.8	7.2e-55
AZN72577.1|3310022_3310310_+	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	53.2	1.5e-12
AZN72578.1|3310395_3311130_+	secretion activator protein	NA	A0A219YFC4	Ochrobactrum_phage	44.5	4.6e-53
AZN72579.1|3311122_3311629_+	hypothetical protein	NA	A0A1Y0SY13	Sinorhizobium_phage	42.6	1.5e-26
AZN72580.1|3311697_3313413_-	sulfate permease	NA	A0A2H4J153	uncultured_Caudovirales_phage	24.2	6.2e-16
>prophage 6
CP032509	Alphaproteobacteria bacterium WS11 chromosome, complete genome	4356607	3487024	3526666	4356607	tail,capsid,integrase,protease,terminase,head,portal	Sinorhizobium_phage(30.0%)	50	3481625:3481684	3523095:3523158
3481625:3481684	attL	CGTCCCGAACGAGGTGCGCTACCAGGCTGCGCTACACTCCGACATGGCCCGAAGGCCCGG	NA	NA	NA	NA
AZN72730.1|3487024_3487978_-	hypothetical protein	NA	A0A141GEY9	Brucella_phage	31.1	3.2e-06
AZN72731.1|3488017_3488356_-	hypothetical protein	NA	F8TUT1	EBPR_podovirus	56.5	1.6e-16
AZN72732.1|3488809_3489901_-	hypothetical protein	NA	W8EBH7	Pseudomonas_phage	39.1	1.3e-11
AZN72733.1|3489911_3490193_-	hypothetical protein	NA	NA	NA	NA	NA
AZN72734.1|3490221_3494727_-	hypothetical protein	NA	A0A291AUN1	Sinorhizobium_phage	55.5	6.7e-195
AZN72735.1|3494744_3495188_-	hypothetical protein	NA	NA	NA	NA	NA
AZN72736.1|3495135_3495726_-	DUF2163 domain-containing protein	NA	A0A291AUM8	Sinorhizobium_phage	57.6	4.5e-59
AZN72737.1|3495722_3496373_-	hypothetical protein	NA	A0A291AUM9	Sinorhizobium_phage	42.1	2.1e-41
AZN72738.1|3496372_3498730_-|tail	phage tail tape measure protein	tail	A0A141GEX2	Brucella_phage	38.1	3.0e-85
AZN72739.1|3498760_3499072_+	hypothetical protein	NA	NA	NA	NA	NA
AZN72740.1|3499260_3499644_-	gene transfer agent family protein	NA	NA	NA	NA	NA
AZN72741.1|3499640_3500093_-	hypothetical protein	NA	NA	NA	NA	NA
AZN72742.1|3500113_3500518_-	DUF3168 domain-containing protein	NA	I3UM06	Rhodobacter_phage	37.1	3.7e-12
AZN72743.1|3500514_3500943_-	HK97 gp10 family phage protein	NA	B4UTQ0	Rhizobium_phage	46.4	3.5e-21
AZN72744.1|3500939_3501299_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AZN72745.1|3501276_3501465_-	hypothetical protein	NA	NA	NA	NA	NA
AZN72746.1|3501464_3502076_-	hypothetical protein	NA	A0A141GEW4	Brucella_phage	37.0	8.6e-29
AZN72747.1|3502079_3502274_-	hypothetical protein	NA	NA	NA	NA	NA
AZN72748.1|3502338_3503658_-|capsid	phage major capsid protein	capsid	A0A2H4JD98	uncultured_Caudovirales_phage	54.1	3.8e-106
AZN73897.1|3503689_3504358_-|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	55.1	3.9e-51
AZN72749.1|3504329_3505613_-|portal	phage portal protein	portal	A0A0U2BXP2	Paracoccus_phage	47.5	3.0e-92
AZN72750.1|3505609_3507310_-|terminase	terminase large subunit	terminase	I3ULZ6	Rhodobacter_phage	46.2	2.8e-133
AZN72751.1|3507309_3507771_-	helix-turn-helix domain-containing protein	NA	I3ULZ5	Rhodobacter_phage	36.7	3.7e-16
AZN72752.1|3507856_3508108_-	hypothetical protein	NA	W6E8K1	Rhizobium_phage	51.5	2.7e-13
AZN72753.1|3508138_3508333_-	hypothetical protein	NA	NA	NA	NA	NA
AZN73898.1|3508329_3508692_-	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	38.8	2.1e-06
AZN72754.1|3508868_3509558_-	hypothetical protein	NA	NA	NA	NA	NA
AZN72755.1|3509670_3510045_+	hypothetical protein	NA	NA	NA	NA	NA
AZN73899.1|3510830_3511703_-	DNA adenine methylase	NA	A0A0K1LM14	Caulobacter_phage	57.0	3.3e-82
AZN72756.1|3511723_3513646_-	hypothetical protein	NA	A0A1X9HVK8	Ruegeria_phage	45.1	1.1e-149
AZN72757.1|3513633_3513960_-	hypothetical protein	NA	A0A291AUT2	Sinorhizobium_phage	44.2	2.9e-07
AZN72758.1|3513952_3515119_-	S-adenosylmethionine-binding protein	NA	M4MB46	Vibrio_phage	29.3	2.3e-14
AZN73900.1|3515118_3515391_-	DUF2312 domain-containing protein	NA	Q8W6H2	Sinorhizobium_phage	76.9	3.0e-26
AZN72759.1|3515588_3515921_-	hypothetical protein	NA	NA	NA	NA	NA
AZN72760.1|3515923_3516424_-	hypothetical protein	NA	NA	NA	NA	NA
AZN72761.1|3516646_3517150_-	hypothetical protein	NA	A0A291AUJ7	Sinorhizobium_phage	51.0	2.1e-33
AZN72762.1|3517257_3517590_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZN72763.1|3517588_3518281_+	XRE family transcriptional regulator	NA	B5WZX5	Pseudomonas_phage	35.1	5.8e-05
AZN72764.1|3518517_3518700_+	hypothetical protein	NA	NA	NA	NA	NA
AZN72765.1|3518696_3518981_+	hypothetical protein	NA	NA	NA	NA	NA
AZN72766.1|3518980_3519604_+	hypothetical protein	NA	A0A291AUJ2	Sinorhizobium_phage	53.4	4.1e-10
AZN72767.1|3519600_3520008_+	hypothetical protein	NA	H2BD37	Pseudomonas_phage	48.6	6.6e-17
AZN72768.1|3520000_3521044_+	phage Gp37/Gp68 family protein	NA	A0A0A8ILD3	Aurantimonas_phage	56.6	2.6e-102
AZN72769.1|3521040_3521328_+	hypothetical protein	NA	NA	NA	NA	NA
AZN72770.1|3521338_3521668_+	HNH endonuclease	NA	A0A291AUJ4	Sinorhizobium_phage	74.3	1.4e-41
AZN72771.1|3521728_3522028_+	DNA-binding protein	NA	NA	NA	NA	NA
AZN72772.1|3522057_3523086_+|integrase	site-specific integrase	integrase	A0A076G7B8	Sinorhizobium_phage	38.3	3.0e-50
AZN72773.1|3523228_3523687_-	MaoC family dehydratase	NA	NA	NA	NA	NA
3523095:3523158	attR	CGTCCCGAACGAGGTGCGCTACCAGGCTGCGCTACACTCCGACATGGCCCGAAGGCCCGGTTTC	NA	NA	NA	NA
AZN72774.1|3523976_3524597_-	L,D-transpeptidase	NA	NA	NA	NA	NA
AZN72775.1|3524725_3526666_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	26.5	7.7e-31
