The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028974	Cronobacter sakazakii strain GZcsf-1 chromosome, complete genome	4432028	567435	589616	4432028	transposase,protease	Enterobacteria_phage(33.33%)	17	NA	NA
AZP32124.1|567435_568440_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AZP32125.1|569026_570109_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	97.5	5.5e-188
AZP32126.1|570216_573276_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	95.2	0.0e+00
AZP32127.1|573327_574581_+	MFS transporter	NA	NA	NA	NA	NA
AZP32128.1|574637_574808_+	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
AZP32129.1|575686_575947_-	DUF2534 domain-containing protein	NA	NA	NA	NA	NA
AZP32130.1|576003_578067_-	TonB-dependent copper receptor	NA	NA	NA	NA	NA
AZP35514.1|578149_578569_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
AZP32131.1|578929_579934_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AZP32132.1|580360_581632_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	60.5	8.1e-146
AZP32133.1|581831_582326_+	hypothetical protein	NA	NA	NA	NA	NA
AZP32134.1|582388_583060_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AZP32135.1|584029_584929_+	DNA-binding protein	NA	NA	NA	NA	NA
AZP32136.1|584995_585613_-	serine recombinase	NA	NA	NA	NA	NA
AZP32137.1|585808_587491_+|transposase	transposase	transposase	NA	NA	NA	NA
AZP32138.1|587493_588402_+|transposase	transposase	transposase	NA	NA	NA	NA
AZP32139.1|588398_589616_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
CP028974	Cronobacter sakazakii strain GZcsf-1 chromosome, complete genome	4432028	594096	646979	4432028	tRNA,transposase,protease,integrase	Vibrio_phage(15.38%)	54	598778:598793	614173:614188
AZP32148.1|594096_595101_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AZP32149.1|595696_595876_+	hypothetical protein	NA	NA	NA	NA	NA
AZP32150.1|595805_596645_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
AZP32151.1|596638_596986_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AZP35515.1|597149_597941_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AZP32152.1|598086_599100_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
598778:598793	attL	GGGTTTTTGCGCAGCA	NA	NA	NA	NA
AZP32153.1|599038_599308_+|transposase	transposase	transposase	NA	NA	NA	NA
AZP32154.1|599673_599982_-	hypothetical protein	NA	NA	NA	NA	NA
AZP32155.1|599961_600336_+	hypothetical protein	NA	NA	NA	NA	NA
AZP32156.1|600433_600799_+	hypothetical protein	NA	NA	NA	NA	NA
AZP32157.1|600884_601532_+	hypothetical protein	NA	NA	NA	NA	NA
AZP32158.1|601607_602210_+	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
AZP32159.1|602277_602625_+	hypothetical protein	NA	NA	NA	NA	NA
AZP32160.1|602706_603693_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	40.4	1.4e-49
AZP32161.1|603798_604731_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AZP32162.1|604839_605523_+|integrase	integrase	integrase	A0A2K9V411	Faecalibacterium_phage	38.6	6.7e-30
AZP32163.1|605650_607159_+	ATP-dependent helicase	NA	A0A075DXT4	Acinetobacter_phage	31.5	9.2e-48
AZP32164.1|607225_608845_+	relaxase	NA	NA	NA	NA	NA
AZP32165.1|608905_609937_+	recombinase XerD	NA	NA	NA	NA	NA
AZP32166.1|610324_610900_-	transcriptional regulator	NA	NA	NA	NA	NA
AZP32167.1|610950_612675_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
AZP32168.1|612650_612998_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
AZP32169.1|613121_614423_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
614173:614188	attR	GGGTTTTTGCGCAGCA	NA	NA	NA	NA
AZP32170.1|614535_615972_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
AZP32171.1|616309_616786_+	membrane protein FxsA	NA	NA	NA	NA	NA
AZP32172.1|616922_617216_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	41.2	1.0e-11
AZP32173.1|617265_618909_+	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.0	1.3e-188
AZP32174.1|619150_619504_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
AZP32175.1|619828_620857_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
AZP32176.1|620898_621465_+	elongation factor P	NA	NA	NA	NA	NA
AZP32177.1|621523_621655_+	entericidin, EcnA/B family	NA	NA	NA	NA	NA
AZP32178.1|621757_621904_+	entericidin, EcnA/B family	NA	NA	NA	NA	NA
AZP32179.1|621944_622550_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AZP32180.1|622827_623145_+	quaternary ammonium compound-resistance protein SugE	NA	NA	NA	NA	NA
AZP35516.1|623141_623675_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	54.5	1.5e-45
AZP32181.1|623797_624157_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
AZP32182.1|624167_624563_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
AZP32183.1|624562_625309_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
AZP32184.1|625301_627092_-	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	25.8	3.2e-15
AZP32185.1|627395_628373_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.8	4.4e-27
AZP32186.1|628608_631941_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
AZP32187.1|631957_632920_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
AZP32188.1|633016_634096_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
AZP32189.1|634174_634720_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.9e-28
AZP35517.1|635451_636606_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
AZP32190.1|636589_638119_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
AZP32191.1|638111_638570_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
AZP32192.1|638586_639933_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	29.6	2.0e-17
AZP32193.1|639942_641850_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	40.7	1.0e-59
AZP32194.1|641842_642793_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AZP32195.1|642893_643202_+	RNA-binding protein Hfq	NA	NA	NA	NA	NA
AZP32196.1|643275_644556_+	GTPase HflX	NA	NA	NA	NA	NA
AZP32197.1|644727_645972_+|protease	FtsH protease activity modulator HflK	protease	S4VT23	Pandoravirus	25.7	1.7e-07
AZP32198.1|645974_646979_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 3
CP028974	Cronobacter sakazakii strain GZcsf-1 chromosome, complete genome	4432028	1034179	1106062	4432028	capsid,portal,tRNA,protease,terminase,holin,integrase,tail,head	Cronobacter_phage(21.57%)	75	1025360:1025382	1095049:1095071
1025360:1025382	attL	AGGGTGGGTAAGCGAAGCGCACC	NA	NA	NA	NA
AZP32557.1|1034179_1035370_-|integrase	integrase	integrase	I6PDJ1	Cronobacter_phage	67.6	1.2e-148
AZP32558.1|1035330_1035537_-	excisionase	NA	I6PBM8	Cronobacter_phage	72.1	3.4e-22
AZP32559.1|1035576_1036149_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	58.4	8.5e-63
AZP32560.1|1036145_1036817_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	48.9	5.0e-22
AZP32561.1|1036820_1037024_-	hypothetical protein	NA	NA	NA	NA	NA
AZP32562.1|1037025_1037523_-	hypothetical protein	NA	A0A193GYL1	Enterobacter_phage	87.3	1.2e-25
AZP32563.1|1037513_1038050_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	73.0	1.5e-69
AZP32564.1|1038142_1039072_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	61.6	7.3e-104
AZP32565.1|1039745_1040072_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35528.1|1040234_1040882_-	LexA family transcriptional repressor	NA	H9C160	Pectobacterium_phage	62.5	1.6e-73
AZP32566.1|1040986_1041184_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	72.9	3.7e-18
AZP32567.1|1041212_1041767_+	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	65.8	4.8e-63
AZP32568.1|1041930_1042110_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	65.5	1.1e-13
AZP32569.1|1042099_1042969_+	GntR family transcriptional regulator	NA	U5P0A0	Shigella_phage	85.5	2.5e-42
AZP32570.1|1042965_1043844_+	DNA methylase	NA	A0A1C9II58	Salmonella_phage	70.9	3.0e-123
AZP32571.1|1043853_1044102_+	hypothetical protein	NA	NA	NA	NA	NA
AZP32572.1|1044098_1044467_+	hypothetical protein	NA	A0A1C9IIA0	Salmonella_phage	85.6	1.0e-56
AZP32573.1|1044567_1045365_+	DNA-binding protein	NA	A0A0P0ZCS0	Stx2-converting_phage	75.8	1.7e-114
AZP35529.1|1045372_1046362_+	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	66.3	2.0e-131
AZP32574.1|1046379_1047201_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	44.6	1.6e-57
AZP32575.1|1047440_1047875_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	51.0	6.8e-28
AZP32576.1|1048235_1048622_+	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	94.5	1.9e-58
AZP32577.1|1048608_1048890_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	46.0	2.7e-17
AZP32578.1|1048889_1049519_+	endolysin	NA	G8C7W0	Escherichia_phage	90.4	2.0e-105
AZP32579.1|1049526_1049802_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	80.0	3.3e-28
AZP32580.1|1049752_1049932_+	hypothetical protein	NA	K7PM01	Enterobacterial_phage	91.1	2.0e-18
AZP32581.1|1049998_1050292_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	72.2	2.3e-32
AZP32582.1|1050397_1050622_+	hypothetical protein	NA	NA	NA	NA	NA
AZP32583.1|1050799_1051225_+	hypothetical protein	NA	NA	NA	NA	NA
AZP32584.1|1051357_1051708_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	80.7	5.4e-52
AZP32585.1|1051704_1051905_+	hypothetical protein	NA	Q6UAR8	Klebsiella_phage	89.4	1.7e-10
AZP32586.1|1052097_1052571_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	89.8	1.7e-77
AZP32587.1|1052570_1054328_+|terminase	terminase	terminase	K7PKT2	Enterobacteria_phage	91.5	0.0e+00
AZP32588.1|1054327_1055632_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	87.6	7.1e-222
AZP32589.1|1055640_1056495_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	76.4	6.9e-117
AZP32590.1|1056508_1057729_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	92.1	1.1e-203
AZP32591.1|1057780_1057966_+	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	89.5	9.9e-13
AZP32592.1|1057975_1058302_+	hypothetical protein	NA	K7PKT4	Enterobacteria_phage	52.8	8.6e-28
AZP32593.1|1058298_1058640_+|head,tail	head-tail adaptor protein	head,tail	A0A1J0GUY4	Halomonas_phage	39.6	3.9e-07
AZP32594.1|1058636_1059086_+	hypothetical protein	NA	A0A220NRP5	Escherichia_phage	84.6	1.6e-64
AZP32595.1|1059082_1059412_+	DUF3168 domain-containing protein	NA	A0A1P8DTJ3	Proteus_phage	54.5	5.0e-23
AZP32596.1|1059458_1059914_+|tail	phage tail protein	tail	A0A1W6JP06	Morganella_phage	75.0	1.4e-55
AZP32597.1|1059962_1060358_+|tail	phage tail protein	tail	F1C576	Cronobacter_phage	87.8	3.0e-59
AZP32598.1|1060381_1060651_+	DUF4035 domain-containing protein	NA	K7PLY6	Enterobacterial_phage	62.1	2.0e-22
AZP32599.1|1061118_1064391_+|tail	phage tail tape measure protein	tail	F1C575	Cronobacter_phage	96.9	0.0e+00
AZP32600.1|1064436_1064775_+|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	61.6	1.6e-37
AZP32601.1|1064781_1065534_+|tail	phage minor tail protein L	tail	F1C574	Cronobacter_phage	99.6	8.1e-146
AZP32602.1|1065536_1066241_+	peptidase P60	NA	F1C573	Cronobacter_phage	98.3	7.4e-141
AZP32603.1|1066237_1066834_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	97.5	1.7e-101
AZP32604.1|1066883_1070090_+	host specificity protein	NA	F1C571	Cronobacter_phage	95.8	0.0e+00
AZP32605.1|1070092_1071049_+	hypothetical protein	NA	I6PBN9	Cronobacter_phage	63.0	1.8e-118
AZP32606.1|1071975_1072557_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	40.9	1.2e-32
AZP32607.1|1072914_1073352_+	DNA polymerase V subunit UmuD	NA	F1C5A6	Cronobacter_phage	93.1	8.5e-71
AZP32608.1|1073335_1074601_+	DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	97.6	3.9e-241
AZP32609.1|1074898_1075594_+	hypothetical protein	NA	NA	NA	NA	NA
AZP32610.1|1075594_1076260_+	hypothetical protein	NA	NA	NA	NA	NA
AZP32611.1|1077640_1077841_-	hypothetical protein	NA	NA	NA	NA	NA
AZP32612.1|1078092_1090122_+	Ig-like domain	NA	NA	NA	NA	NA
AZP32613.1|1090206_1091556_+	type I secretion system outer membrane protein	NA	NA	NA	NA	NA
AZP32614.1|1091579_1093715_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	29.1	1.7e-26
AZP32615.1|1093724_1094894_+	secretion protein HlyD	NA	NA	NA	NA	NA
AZP32616.1|1095120_1095603_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	48.1	8.0e-30
1095049:1095071	attR	AGGGTGGGTAAGCGAAGCGCACC	NA	NA	NA	NA
AZP32617.1|1095751_1096189_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AZP32618.1|1096178_1096469_+	RnfH family protein	NA	NA	NA	NA	NA
AZP32619.1|1096578_1096923_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AZP32620.1|1097140_1098802_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AZP32621.1|1098888_1099767_-	NAD(+) kinase	NA	NA	NA	NA	NA
AZP32622.1|1099781_1099925_-	inorganic polyphosphate kinase	NA	NA	NA	NA	NA
AZP32623.1|1099889_1100483_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AZP32624.1|1100557_1101847_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AZP32625.1|1101865_1102660_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AZP32626.1|1102822_1104184_+	signal recognition particle protein	NA	NA	NA	NA	NA
AZP32627.1|1104442_1104691_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AZP32628.1|1104709_1105258_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AZP32629.1|1105288_1106062_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 4
CP028974	Cronobacter sakazakii strain GZcsf-1 chromosome, complete genome	4432028	1588807	1597778	4432028		Enterobacteria_phage(33.33%)	9	NA	NA
AZP33046.1|1588807_1590223_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.2	1.6e-17
AZP33047.1|1590438_1591434_+	UDP-N-acetylglucosamine 4-epimerase	NA	A0A0K1L6Z1	Scale_drop_disease_virus	26.1	2.5e-09
AZP33048.1|1591663_1592554_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	40.3	5.6e-45
AZP33049.1|1592945_1594025_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.1	3.1e-98
AZP33050.1|1594021_1594894_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	64.6	7.3e-106
AZP33051.1|1594895_1595297_+	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
AZP33052.1|1595289_1595742_+	N-acetyltransferase	NA	NA	NA	NA	NA
AZP33053.1|1595742_1596678_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZP33054.1|1596674_1597778_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	32.9	1.1e-47
>prophage 5
CP028974	Cronobacter sakazakii strain GZcsf-1 chromosome, complete genome	4432028	1700996	1709985	4432028		Burkholderia_phage(33.33%)	9	NA	NA
AZP33135.1|1700996_1701236_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	84.8	5.5e-32
AZP33136.1|1701389_1702514_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.5	3.2e-106
AZP33137.1|1703159_1703858_+	phosphohydrolase	NA	S4W232	Pandoravirus	26.8	4.3e-08
AZP33138.1|1703906_1705352_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.4	3.1e-101
AZP33139.1|1705335_1705833_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	49.0	7.2e-34
AZP33140.1|1705836_1706748_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AZP33141.1|1706926_1707841_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AZP33142.1|1707930_1708113_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AZP33143.1|1708314_1709985_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	38.6	1.7e-23
>prophage 6
CP028974	Cronobacter sakazakii strain GZcsf-1 chromosome, complete genome	4432028	2082822	2146872	4432028	capsid,portal,plate,protease,tRNA,terminase,holin,integrase,tail,head	Salmonella_phage(38.64%)	77	2080641:2080657	2084781:2084797
2080641:2080657	attL	ACAGCTCGCCATTATCG	NA	NA	NA	NA
AZP33479.1|2082822_2084106_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	58.4	1.7e-148
AZP33480.1|2084131_2084383_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	47.4	2.0e-16
AZP33481.1|2084463_2085564_-	hypothetical protein	NA	I6PCV5	Cronobacter_phage	91.5	7.8e-198
2084781:2084797	attR	ACAGCTCGCCATTATCG	NA	NA	NA	NA
AZP33482.1|2085565_2085856_-	host-nuclease inhibitor protein	NA	I6PDJ2	Cronobacter_phage	70.5	1.4e-32
AZP33483.1|2085942_2086149_-	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	62.9	9.6e-17
AZP33484.1|2086325_2086736_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	58.4	1.6e-31
AZP33485.1|2086816_2087056_+	transcriptional regulator	NA	NA	NA	NA	NA
AZP33486.1|2087055_2087508_+	hypothetical protein	NA	NA	NA	NA	NA
AZP33487.1|2087531_2088416_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	40.9	2.3e-54
AZP33488.1|2088561_2088879_-	hypothetical protein	NA	NA	NA	NA	NA
AZP33489.1|2088865_2089504_-	nucleotidyltransferase	NA	NA	NA	NA	NA
AZP33490.1|2089506_2090316_-	hypothetical protein	NA	NA	NA	NA	NA
AZP33491.1|2090631_2090826_-	hypothetical protein	NA	U5P4I9	Shigella_phage	69.0	1.3e-15
AZP33492.1|2091082_2092747_+	hypothetical protein	NA	X2KLG0	Campylobacter_phage	27.2	4.3e-14
AZP33493.1|2092992_2093886_-	hypothetical protein	NA	NA	NA	NA	NA
AZP33494.1|2094375_2094591_+	hypothetical protein	NA	NA	NA	NA	NA
AZP33495.1|2094747_2095203_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	86.1	3.8e-74
AZP33496.1|2095205_2095406_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	66.2	2.0e-19
AZP33497.1|2095396_2095693_+	hypothetical protein	NA	A0A0M3ULJ7	Salmonella_phage	72.7	2.2e-30
AZP33498.1|2095689_2096052_+	RusA family crossover junction endodeoxyribonuclease	NA	I6PBN1	Cronobacter_phage	89.2	5.4e-55
AZP33499.1|2096048_2096744_+	antiterminator	NA	I6PDF8	Cronobacter_phage	66.2	5.7e-77
AZP33500.1|2096877_2097111_+	hypothetical protein	NA	NA	NA	NA	NA
AZP33501.1|2097859_2098075_+|holin	holin	holin	A5LH82	Enterobacteria_phage	84.5	6.7e-29
AZP33502.1|2098074_2098560_+	lysozyme	NA	A0A2H4FND7	Salmonella_phage	73.0	2.0e-65
AZP33503.1|2098559_2098910_+	hypothetical protein	NA	S4TW58	Salmonella_phage	31.8	3.8e-05
AZP33504.1|2099447_2099699_+	hypothetical protein	NA	NA	NA	NA	NA
AZP33505.1|2101495_2101855_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	63.5	8.6e-37
AZP33506.1|2102020_2102449_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	57.5	4.6e-29
AZP33507.1|2102452_2104180_+|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	60.3	3.2e-206
AZP33508.1|2104325_2105567_+|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	71.5	1.8e-174
AZP33509.1|2105559_2106183_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.7	9.3e-79
AZP33510.1|2106252_2107473_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	64.5	2.7e-143
AZP33511.1|2107478_2107745_+|tail	phage tail protein	tail	X4YE12	Lactococcus_phage	50.0	8.1e-08
AZP33512.1|2107779_2108097_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	59.8	3.1e-30
AZP33513.1|2108093_2108489_+|head,tail	head-tail adaptor protein	head,tail	M1FJ87	Enterobacteria_phage	53.5	1.3e-30
AZP33514.1|2108481_2109000_+	hypothetical protein	NA	A0A192Y6D2	Salmonella_phage	72.2	1.3e-65
AZP33515.1|2108996_2109557_+	hypothetical protein	NA	Q8HAC7	Salmonella_phage	58.1	3.1e-57
AZP33516.1|2109562_2109727_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	63.5	3.3e-12
AZP33517.1|2109716_2111558_+|tail	phage tail protein	tail	Q8W623	Enterobacteria_phage	53.6	2.0e-169
AZP33518.1|2111550_2111907_+|tail	phage tail protein	tail	A0A192Y8K0	Salmonella_phage	77.1	1.1e-49
AZP33519.1|2111903_2112230_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	63.0	2.9e-31
AZP33520.1|2112317_2114243_+|tail	phage tail tape measure protein	tail	Q8W620	Enterobacteria_phage	56.6	1.2e-201
AZP33521.1|2114278_2115598_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	62.1	1.6e-152
AZP33522.1|2115594_2116653_+|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	67.3	4.2e-132
AZP33523.1|2116652_2117237_+|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	47.2	3.2e-33
AZP33524.1|2117240_2117657_+	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	62.3	3.8e-44
AZP33525.1|2117649_2119053_+|plate	phage baseplate protein	plate	A0A192Y6E4	Salmonella_phage	60.6	9.9e-121
AZP33526.1|2119043_2119616_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	60.5	5.2e-60
AZP33527.1|2119673_2120897_+|tail	phage tail protein	tail	Q8W613	Enterobacteria_phage	33.9	1.0e-28
AZP33528.1|2120902_2121334_+|tail	tail assembly chaperone	tail	A0A1S6KZY8	Salmonella_phage	39.8	3.1e-17
AZP33529.1|2121510_2121798_+	hypothetical protein	NA	NA	NA	NA	NA
AZP33530.1|2122039_2122366_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
AZP33531.1|2122904_2123957_+	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AZP33532.1|2123953_2126197_+	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
AZP33533.1|2126193_2126871_+	beta-phosphoglucomutase	NA	NA	NA	NA	NA
AZP33534.1|2126886_2127969_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	28.3	1.3e-11
AZP33535.1|2128018_2129011_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AZP35575.1|2129176_2130574_+	YcjX family protein	NA	NA	NA	NA	NA
AZP33536.1|2130570_2131614_+	TIGR01620 family protein	NA	NA	NA	NA	NA
AZP33537.1|2131762_2133325_+	transcriptional regulator TyrR	NA	NA	NA	NA	NA
AZP33538.1|2133376_2133883_-	thiol peroxidase	NA	NA	NA	NA	NA
AZP33539.1|2134019_2135018_+	L-Ala-D/L-Glu epimerase	NA	NA	NA	NA	NA
AZP33540.1|2134999_2135722_-	murein tripeptide amidase MpaA	NA	NA	NA	NA	NA
AZP33541.1|2135966_2137583_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
AZP33542.1|2137643_2138084_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
AZP33543.1|2138201_2138549_-	anti-adapter protein IraM	NA	NA	NA	NA	NA
AZP33544.1|2139023_2139605_-	hypothetical protein	NA	NA	NA	NA	NA
AZP33545.1|2139845_2140100_+	hypothetical protein	NA	NA	NA	NA	NA
AZP33546.1|2140246_2140486_-	stress-induced protein	NA	NA	NA	NA	NA
AZP33547.1|2141208_2142960_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
AZP33548.1|2143161_2143353_-	hypothetical protein	NA	I6S5X8	Salmonella_phage	46.6	2.9e-07
AZP33549.1|2143426_2143750_-	hypothetical protein	NA	NA	NA	NA	NA
AZP33550.1|2143951_2144125_+	DUF2566 domain-containing protein	NA	NA	NA	NA	NA
AZP33551.1|2144203_2144407_+	hypothetical protein	NA	NA	NA	NA	NA
AZP33552.1|2144446_2145430_+	zinc transporter ZntB	NA	NA	NA	NA	NA
AZP33553.1|2145532_2145778_+	hypothetical protein	NA	NA	NA	NA	NA
AZP33554.1|2145939_2146872_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.8	2.2e-140
>prophage 7
CP028974	Cronobacter sakazakii strain GZcsf-1 chromosome, complete genome	4432028	2587506	2597704	4432028	tRNA	Bacillus_phage(14.29%)	11	NA	NA
AZP33921.1|2587506_2587971_-	endopeptidase	NA	S5MM68	Bacillus_phage	36.0	1.0e-10
AZP33922.1|2588048_2588792_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.5	4.1e-09
AZP33923.1|2588794_2589346_-	glutathione peroxidase	NA	NA	NA	NA	NA
AZP33924.1|2589375_2590377_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
AZP33925.1|2590454_2590754_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AZP33926.1|2590758_2593146_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	27.1	2.1e-06
AZP33927.1|2593161_2594145_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	6.4e-34
AZP33928.1|2594530_2594887_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AZP33929.1|2594934_2595132_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AZP33930.1|2595229_2595772_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.3	1.1e-14
AZP33931.1|2595775_2597704_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.6	1.1e-130
>prophage 1
CP028975	Cronobacter sakazakii strain GZcsf-1 plasmid pGW1, complete sequence	340723	16922	49842	340723	transposase,integrase	Escherichia_phage(44.44%)	38	23999:24058	49846:50665
AZP35676.1|16922_17927_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AZP35677.1|18005_18440_-	mercuric resistance operon regulatory protein	NA	NA	NA	NA	NA
AZP35678.1|18511_18862_+	mercuric transporter	NA	NA	NA	NA	NA
AZP35679.1|18875_19151_+	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AZP35999.1|19186_19609_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AZP35680.1|19660_21355_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AZP35681.1|21372_21735_+	transcriptional regulator	NA	NA	NA	NA	NA
AZP35682.1|21731_21968_+	mercury resistance protein	NA	NA	NA	NA	NA
AZP35683.1|21964_22672_+	Tn21 family protein Urf2	NA	NA	NA	NA	NA
AZP35684.1|22710_24015_+|transposase	TniA putative transposase	transposase	NA	NA	NA	NA
23999:24058	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
AZP35685.1|24061_24766_+|transposase	IS26 transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZP35686.1|26537_27425_-	class A extended-spectrum beta-lactamase SFO-1	NA	A0A1B0VBP7	Salmonella_phage	74.5	7.4e-114
AZP35687.1|27557_28433_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZP35688.1|29135_29486_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35689.1|32664_33435_+	conjugal transfer protein TraX	NA	NA	NA	NA	NA
AZP35690.1|33566_33893_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35691.1|33867_34674_-	DUF4225 domain-containing protein	NA	NA	NA	NA	NA
AZP35692.1|34844_35027_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35693.1|35973_36978_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AZP35694.1|37205_38411_+	chromate transporter	NA	NA	NA	NA	NA
AZP35695.1|38421_38727_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AZP35696.1|38742_38925_-	resolvase	NA	NA	NA	NA	NA
AZP36000.1|38953_39718_+|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AZP35697.1|39908_40265_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35698.1|40210_40795_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZP35699.1|40794_42033_-	MFS transporter	NA	NA	NA	NA	NA
AZP35700.1|42029_42935_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AZP35701.1|43056_43761_-|transposase	IS26 transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZP35702.1|43836_44337_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZP35703.1|44355_44535_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35704.1|44464_45304_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AZP35705.1|45297_45645_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AZP35706.1|45808_46600_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AZP35707.1|46605_46896_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
AZP35708.1|47007_47505_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
AZP35709.1|47649_48663_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AZP35710.1|48601_48916_+|transposase	transposase	transposase	NA	NA	NA	NA
AZP35711.1|49137_49842_-|transposase	IS26 transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
49846:50665	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTATAGTGTTTTGCAGTTTAGAGGAGATATCGCGATGCATACGCGGAAGGCAATAACGGAGGCGCTTCAAAAACTCGGAGTCCAAACCGGTGACCTCTTGATGGTGCATGCCTCACTTAAAGCGATTGGTCCGGTCGAAGGAGGAGCGGAGACGGTCGTTGCCGCGTTACGCTCCGCGGTTGGGCCGACTGGCACTGTGATGGGATACGCGTCGTGGGACCGATCACCCTACGAGGAGACTCTGAATGGCGCTCGGCTGGATGACGAAGCCCGCCGTACCTGGCTGCCGTTCGATCCCGCAACAGCCGGGACTTACCGTGGGTTCGGCCTGCTGAATCAATTTCTGGTTCAAGCCCCCGGCGCGCGGCGCAGCGCGCACCCCGATGCATCGATGGTCGCGGTTGGTCCGCTGGCTGAAACGCTGACGGAGCCTCACGAACTCGGTCACGCCTTGGGGGAAGGATCGCCCGTCGAGCGGTTCGTTCGCCTTGGCGGGAAGGCCCTGCTGTTGGGTGCGCCGCTAAACTCCGTTACCGCATTGCACTACGCCGAGGCGGTTGCCGATATCCCCAACAAACGGTGGGTGACGTATGAGATGCCGATGCTTGGAAGAGACGGTGAAGTC	NA	NA	NA	NA
>prophage 2
CP028975	Cronobacter sakazakii strain GZcsf-1 plasmid pGW1, complete sequence	340723	53715	103183	340723	transposase,integrase	uncultured_Caudovirales_phage(30.0%)	55	49086:49145	77103:77922
49086:49145	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
AZP35717.1|53715_55086_+|transposase	IS1182 family transposase ISCfr1	transposase	NA	NA	NA	NA
AZP35718.1|55906_56767_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AZP35719.1|57337_57460_+	ABC transporter	NA	NA	NA	NA	NA
AZP35720.1|57498_58479_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
AZP35721.1|58524_59148_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35722.1|59205_59586_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35723.1|63743_64448_-|transposase	IS26 transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZP36001.1|64418_65000_+|transposase	Truncated ISCR1 transposase	transposase	NA	NA	NA	NA
AZP35724.1|65265_65766_+	hypothetical protein	NA	A0A1V0SB21	Catovirus	31.7	3.3e-10
AZP35725.1|65765_66335_+	trimethoprim-resistant dihydrofolate reductase DfrA18	NA	A0A1V0SD48	Indivirus	27.2	3.5e-08
AZP35726.1|66717_66999_-|transposase	transposase	transposase	NA	NA	NA	NA
AZP35727.1|66937_67951_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AZP35728.1|68108_68912_+	aminoglycoside 3'-phosphotransferase	NA	NA	NA	NA	NA
AZP35729.1|68911_69748_+	aminoglycoside/hydroxyurea antibiotic resistance kinase	NA	NA	NA	NA	NA
AZP35730.1|70237_70450_+	resolvase	NA	NA	NA	NA	NA
AZP35731.1|70462_71671_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AZP35732.1|71704_73138_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
AZP35733.1|73519_73726_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35734.1|73730_74372_-	restriction endonuclease	NA	NA	NA	NA	NA
AZP35735.1|74427_74739_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35736.1|74774_75089_-	IncN plasmid KikA protein	NA	NA	NA	NA	NA
AZP35737.1|75085_75430_-	hypothetical protein	NA	NA	NA	NA	NA
AZP36002.1|75445_75796_-	KorB	NA	NA	NA	NA	NA
AZP35738.1|75859_76597_+	traL protein	NA	NA	NA	NA	NA
AZP35739.1|76605_76887_+	transcriptional regulator	NA	NA	NA	NA	NA
AZP35740.1|77154_77859_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZP35741.1|78024_78501_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
77103:77922	attR	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCC	NA	NA	NA	NA
AZP35742.1|78577_80197_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
AZP35743.1|80385_81309_-|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	2.4e-176
AZP35744.1|81392_82739_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	8.8e-18
AZP35745.1|82956_83391_+	copper-binding protein	NA	NA	NA	NA	NA
AZP35746.1|83648_84764_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
AZP35747.1|84886_85159_+	transcriptional repressor RcnR	NA	NA	NA	NA	NA
AZP35748.1|85624_86443_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AZP35749.1|86439_87645_+	ATP/GTP-binding protein	NA	NA	NA	NA	NA
AZP35750.1|87708_87912_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35751.1|87924_89244_-	DUF1173 domain-containing protein	NA	NA	NA	NA	NA
AZP35752.1|89494_90922_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
AZP35753.1|91136_91652_+	nuclease	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
AZP35754.1|91654_92551_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35755.1|92598_92913_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35756.1|92986_93244_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35757.1|93302_93536_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35758.1|93581_93836_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35759.1|93873_94161_+	hypothetical protein	NA	NA	NA	NA	NA
AZP36003.1|94230_94428_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35760.1|94568_94844_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35761.1|95335_96814_+	sodium-independent anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.4	9.5e-199
AZP35762.1|96832_97660_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.2	4.9e-43
AZP35763.1|97719_98145_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
AZP35764.1|98157_99447_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	9.9e-168
AZP36004.1|99492_99813_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.7	1.7e-20
AZP35765.1|99899_100604_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.9	8.8e-86
AZP35766.1|100636_102040_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AZP35767.1|102259_103183_-|transposase	IS5-like element IS903B family transposase	transposase	Q1MVF0	Enterobacteria_phage	98.7	4.6e-175
>prophage 3
CP028975	Cronobacter sakazakii strain GZcsf-1 plasmid pGW1, complete sequence	340723	107268	209566	340723	transposase,protease	Escherichia_phage(33.33%)	120	NA	NA
AZP36005.1|107268_108192_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
AZP35772.1|108238_108661_-	hypothetical protein	NA	A0A1B0VFY5	Salmonella_phage	97.6	6.7e-65
AZP36006.1|108714_109347_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35773.1|109375_110779_-|transposase	ISNCY family transposase ISKpn21	transposase	NA	NA	NA	NA
AZP35774.1|110968_111364_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZP36007.1|111412_112759_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AZP35775.1|112979_113297_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35776.1|113319_113625_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35777.1|113669_114341_+|protease	serine protease	protease	NA	NA	NA	NA
AZP35778.1|114798_115206_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35779.1|115256_115574_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35780.1|115572_115701_+	ABC transporter	NA	NA	NA	NA	NA
AZP35781.1|115739_116654_-|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	98.4	3.6e-172
AZP35782.1|117964_118399_+	peptidase	NA	F1C5A6	Cronobacter_phage	48.8	2.5e-22
AZP35783.1|118382_119642_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	44.5	1.5e-96
AZP35784.1|119687_120497_-	DsbA family protein	NA	NA	NA	NA	NA
AZP35785.1|120603_121215_+	hypothetical protein	NA	NA	NA	NA	NA
AZP36008.1|121274_121535_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35786.1|121730_122123_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35787.1|122147_122897_-	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AZP35788.1|123044_123584_+	lytic transglycosylase	NA	NA	NA	NA	NA
AZP35789.1|123666_124224_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35790.1|124347_125409_+	HNH endonuclease	NA	NA	NA	NA	NA
AZP35791.1|125418_125925_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35792.1|126047_129998_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AZP35793.1|130006_131422_-	conjugal transfer protein	NA	NA	NA	NA	NA
AZP35794.1|131411_132458_-	thioredoxin family protein	NA	NA	NA	NA	NA
AZP35795.1|133049_133562_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35796.1|133563_134364_-	trhR	NA	NA	NA	NA	NA
AZP35797.1|135123_135609_+	plasmid transfer protein	NA	NA	NA	NA	NA
AZP35798.1|135605_136343_+	hypothetical protein	NA	NA	NA	NA	NA
AZP36009.1|136352_139499_+	helicase	NA	NA	NA	NA	NA
AZP35799.1|139498_141583_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35800.1|141582_142692_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35801.1|142678_143341_+	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
AZP35802.1|143351_144533_+	S49 family peptidase	NA	B8QTU8	Erwinia_phage	29.2	7.5e-13
AZP35803.1|144534_145266_+	NERD domain-containing protein	NA	NA	NA	NA	NA
AZP35804.1|145552_145906_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35805.1|145971_146256_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35806.1|146612_146912_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35807.1|147344_147713_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35808.1|147938_148475_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35809.1|148542_148980_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35810.1|149024_149321_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35811.1|149455_150157_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35812.1|150471_150753_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35813.1|150818_152003_-	DNA-binding protein	NA	NA	NA	NA	NA
AZP35814.1|152419_152614_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35815.1|153106_154051_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35816.1|154146_154749_+	hypothetical protein	NA	A0A1V0E5L6	Salmonella_phage	42.6	1.7e-08
AZP36010.1|154808_155159_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35817.1|155205_155409_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35818.1|155690_156011_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35819.1|156619_156778_-	Hok/Gef family protein	NA	NA	NA	NA	NA
AZP35820.1|156849_157137_-	mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
AZP35821.1|157136_157376_-	antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
AZP35822.1|157400_157595_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35823.1|157638_158562_-	cation transporter	NA	NA	NA	NA	NA
AZP36011.1|158761_159334_-	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
AZP35824.1|159809_161048_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	23.1	2.5e-11
AZP35825.1|161469_162810_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AZP35826.1|162984_164354_-|transposase	IS3-like element ISKpn8 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	95.5	9.4e-108
AZP35827.1|164686_165292_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35828.1|165508_165790_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35829.1|166165_166477_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35830.1|166699_166900_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35831.1|166939_167164_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35832.1|167218_167422_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35833.1|167601_167895_-	hypothetical protein	NA	I7B2L9	Escherichia_phage	38.6	4.1e-05
AZP35834.1|167974_168466_-	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
AZP35835.1|168470_168782_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
AZP35836.1|168983_169202_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35837.1|169298_169619_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35838.1|169797_170028_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35839.1|170199_171093_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35840.1|171402_172107_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZP35841.1|172596_173706_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	2.8e-33
AZP35842.1|173800_174985_-	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
AZP35843.1|175080_175737_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZP35844.1|175748_176453_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZP35845.1|176596_177238_-	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
AZP35846.1|177387_177888_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35847.1|177967_178672_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZP35848.1|178705_179197_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35849.1|180037_180262_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35850.1|180383_180560_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
AZP35851.1|180741_181746_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AZP35852.1|181824_184791_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.8	0.0e+00
AZP35853.1|184911_185616_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZP35854.1|186153_187140_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35855.1|189078_190083_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AZP35856.1|190161_190719_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
AZP35857.1|190712_191084_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35858.1|191080_191581_-|transposase	transposase	transposase	NA	NA	NA	NA
AZP35859.1|191577_191904_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35860.1|192158_192515_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AZP35861.1|192504_192906_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
AZP35862.1|192902_193193_-	nucleotidyltransferase	NA	NA	NA	NA	NA
AZP35863.1|193637_194642_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AZP35864.1|194720_195155_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AZP35865.1|195226_195577_+	mercuric transporter	NA	NA	NA	NA	NA
AZP35866.1|195590_195866_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
AZP35867.1|196053_197763_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.3e-34
AZP35868.1|197798_198452_+	sel1 repeat family protein	NA	NA	NA	NA	NA
AZP35869.1|198532_199171_+	organomercurial lyase MerB	NA	NA	NA	NA	NA
AZP35870.1|199167_199515_+	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
AZP36012.1|199605_199818_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35871.1|200391_201396_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AZP35872.1|201474_201909_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AZP36013.1|201838_202192_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35873.1|202206_202845_+	organomercurial lyase MerB	NA	NA	NA	NA	NA
AZP35874.1|202956_203322_+	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
AZP35875.1|203318_203555_+	mercury resistance protein	NA	NA	NA	NA	NA
AZP35876.1|203570_203891_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AZP35877.1|203929_204544_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.0	5.1e-37
AZP35878.1|204604_205822_-|transposase	transposase	transposase	NA	NA	NA	NA
AZP35879.1|205818_206727_-|transposase	transposase	transposase	NA	NA	NA	NA
AZP35880.1|206729_208412_-|transposase	transposase	transposase	M4T586	Rhodobacter_phage	24.7	3.7e-05
AZP35881.1|208458_208599_+	NTP-binding protein	NA	NA	NA	NA	NA
AZP35882.1|208561_209566_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
>prophage 4
CP028975	Cronobacter sakazakii strain GZcsf-1 plasmid pGW1, complete sequence	340723	271743	330754	340723	transposase	Salmonella_phage(28.57%)	53	NA	NA
AZP35939.1|271743_272667_-|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	100.0	8.4e-177
AZP35940.1|273257_274295_-	stbA family protein	NA	A0A0A7NPX4	Enterobacteria_phage	35.0	3.6e-43
AZP35941.1|274658_275606_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35942.1|275602_276439_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35943.1|276431_276953_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35944.1|276949_277339_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35945.1|277400_278405_-	peptide transporter	NA	A0A1I9KFW9	Aeromonas_phage	33.8	2.7e-11
AZP35946.1|278401_279655_-	ParA family protein	NA	NA	NA	NA	NA
AZP35947.1|283493_286175_-	conjugal transfer protein	NA	NA	NA	NA	NA
AZP35948.1|286183_287134_-	TrhV	NA	NA	NA	NA	NA
AZP36016.1|287143_287977_-	DsbC family protein	NA	NA	NA	NA	NA
AZP36017.1|288014_288437_-	transcriptional regulator	NA	NA	NA	NA	NA
AZP35949.1|288504_289860_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
AZP35950.1|289849_290311_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35951.1|290312_291584_-	TrhK	NA	NA	NA	NA	NA
AZP35952.1|291583_292372_-	pilus assembly protein	NA	NA	NA	NA	NA
AZP35953.1|292383_292734_-	plasmid transfer protein	NA	NA	NA	NA	NA
AZP35954.1|292751_293105_-	pili assembly chaperone	NA	NA	NA	NA	NA
AZP35955.1|293627_293876_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35956.1|294921_295902_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
AZP35957.1|295940_296072_-	ABC transporter	NA	NA	NA	NA	NA
AZP35958.1|296086_297206_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.0	8.6e-51
AZP35959.1|298030_299083_+	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	31.2	1.1e-12
AZP35960.1|299102_299303_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35961.1|299299_300016_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35962.1|300250_301105_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35963.1|301890_302703_-	DNA modification methylase	NA	A0A1C9II58	Salmonella_phage	38.9	1.2e-46
AZP35964.1|303072_304236_+	DNA-binding protein	NA	A0A1P8DTT7	Salmonella_phage	32.1	1.3e-17
AZP35965.1|304483_306175_+	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	31.1	5.8e-67
AZP35966.1|306396_306852_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35967.1|306838_307120_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35968.1|307177_307804_-	hypothetical protein	NA	NA	NA	NA	NA
AZP35969.1|308176_310633_+	DUF4165 domain-containing protein	NA	NA	NA	NA	NA
AZP36018.1|311773_312829_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	50.9	2.1e-83
AZP35970.1|313224_313881_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35971.1|316869_317793_-|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	100.0	8.4e-177
AZP35972.1|317817_318909_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35973.1|319314_319692_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35974.1|319783_320212_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35975.1|320276_320534_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35976.1|320689_321298_+	hypothetical protein	NA	K4JV11	Caulobacter_phage	38.5	4.4e-25
AZP35977.1|321468_322719_+	site-specific DNA-methyltransferase	NA	NA	NA	NA	NA
AZP35978.1|323013_323334_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35979.1|323576_323903_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35980.1|323968_324226_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35981.1|324455_325247_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35982.1|325297_325498_+	hypothetical protein	NA	NA	NA	NA	NA
AZP36019.1|325544_326468_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	3.8e-177
AZP35983.1|326584_326914_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35984.1|328729_328969_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35985.1|329031_329343_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35986.1|329339_329534_+	hypothetical protein	NA	NA	NA	NA	NA
AZP35987.1|330049_330754_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
