The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033056	Morganella morganii strain L241 chromosome, complete genome	3850444	97759	106606	3850444		Escherichia_phage(66.67%)	8	NA	NA
AZP24062.1|97759_100213_+	twin-arginine translocation signal domain-containing protein	NA	A0A077SK27	Escherichia_phage	49.7	1.7e-216
AZP24063.1|100224_100842_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	8.0e-75
AZP24064.1|100843_101704_+	dimethylsulfoxide reductase	NA	A0A077SK59	Escherichia_phage	35.7	1.1e-26
AZP24065.1|101789_102401_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.2	2.4e-23
AZP24066.1|102468_102759_-	hypothetical protein	NA	NA	NA	NA	NA
AZP24067.1|102886_103573_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
AZP24068.1|103661_104282_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	55.5	3.0e-61
AZP24069.1|104650_106606_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.0	5.7e-82
>prophage 2
CP033056	Morganella morganii strain L241 chromosome, complete genome	3850444	1253165	1296432	3850444	terminase,protease,portal,holin,tail	Morganella_phage(41.3%)	55	NA	NA
AZP25042.1|1253165_1253795_-	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	51.2	2.1e-54
AZP25043.1|1253813_1255040_-	DUF3440 domain-containing protein	NA	L0P6Z6	Lactobacillus_phage	33.7	1.1e-62
AZP27402.1|1255272_1255746_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
AZP25044.1|1255990_1257163_-	recombinase	NA	A0A2H4J1K3	uncultured_Caudovirales_phage	29.3	1.4e-30
AZP27403.1|1257164_1257380_-	hypothetical protein	NA	NA	NA	NA	NA
AZP25045.1|1257410_1257980_-	3'-5' exoribonuclease	NA	A0A1W6JP74	Morganella_phage	84.6	5.3e-89
AZP25046.1|1257972_1258452_-	class I SAM-dependent methyltransferase	NA	A0A1W6JP48	Morganella_phage	90.9	3.3e-84
AZP25047.1|1258448_1259144_-	hypothetical protein	NA	A0A1W6JP46	Morganella_phage	99.1	3.0e-134
AZP25048.1|1259154_1259679_-	HD family hydrolase	NA	A0A1W6JP41	Morganella_phage	95.4	2.8e-92
AZP25049.1|1259787_1260615_-	DUF2303 family protein	NA	A0A192Y6E5	Salmonella_phage	53.3	1.6e-78
AZP25050.1|1260680_1261043_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	63.9	9.0e-34
AZP27404.1|1261577_1262210_-	LexA family transcriptional regulator	NA	H9C160	Pectobacterium_phage	43.1	2.5e-39
AZP25051.1|1262311_1262518_+	cell division protein	NA	NA	NA	NA	NA
AZP25052.1|1262556_1263021_+	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	71.9	7.4e-57
AZP25053.1|1263085_1263277_+	hypothetical protein	NA	NA	NA	NA	NA
AZP25054.1|1263273_1263462_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	98.4	4.5e-29
AZP25055.1|1263458_1264301_+	helix-turn-helix domain-containing protein	NA	A0A1W6JP36	Morganella_phage	93.2	1.1e-146
AZP25056.1|1264297_1264546_+	hypothetical protein	NA	A0A1W6JP32	Morganella_phage	95.0	1.3e-39
AZP25057.1|1264545_1265682_+	site-specific DNA-methyltransferase	NA	S4TR98	Salmonella_phage	48.4	2.2e-86
AZP25058.1|1265681_1266077_+	hypothetical protein	NA	A0A1W6JP58	Morganella_phage	42.2	6.6e-14
AZP25059.1|1266058_1266277_+	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
AZP27405.1|1266273_1266669_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1W6JP40	Morganella_phage	98.1	2.0e-55
AZP25060.1|1266686_1267475_+	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	98.1	4.4e-142
AZP25061.1|1267474_1268491_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	87.6	5.8e-179
AZP25062.1|1268521_1269199_+	hypothetical protein	NA	A0A1W6JP37	Morganella_phage	98.7	1.3e-129
AZP25063.1|1269364_1269559_+	hypothetical protein	NA	A0A1W6JP28	Morganella_phage	100.0	1.0e-28
AZP25064.1|1269697_1270756_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	95.9	1.1e-172
AZP25065.1|1270977_1271973_+	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
AZP25066.1|1272599_1272791_+|holin	holin	holin	A0A1W6JP85	Morganella_phage	100.0	4.9e-31
AZP25067.1|1272783_1273260_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	91.7	5.8e-81
AZP25068.1|1273396_1273924_+	hypothetical protein	NA	H9C185	Pectobacterium_phage	40.4	2.6e-18
AZP25069.1|1274221_1274407_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	60.3	1.4e-11
AZP25070.1|1274730_1275234_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	57.2	2.3e-40
AZP25071.1|1275230_1277345_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.3	1.7e-294
AZP25072.1|1277341_1277560_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	58.6	1.1e-15
AZP25073.1|1277556_1279032_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	66.8	2.9e-187
AZP25074.1|1279003_1281040_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	65.2	8.4e-254
AZP25075.1|1281125_1281467_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	56.5	5.7e-22
AZP25076.1|1281471_1281750_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	43.2	5.5e-15
AZP25077.1|1281751_1282315_+|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	55.6	7.1e-46
AZP25078.1|1282314_1282713_+|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	62.4	2.3e-43
AZP25079.1|1282722_1283238_+|tail	phage tail protein	tail	M9NYX0	Enterobacteria_phage	75.5	1.8e-64
AZP25080.1|1283253_1283655_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	37.2	2.2e-12
AZP25081.1|1283678_1283987_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	51.5	2.8e-20
AZP25082.1|1283967_1286904_+|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	35.3	5.6e-142
AZP25083.1|1286906_1287236_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	54.1	7.1e-30
AZP25084.1|1287247_1287544_+	hypothetical protein	NA	NA	NA	NA	NA
AZP25085.1|1287738_1288521_+	DNA-binding protein	NA	Q9MCN2	Enterobacteria_phage	45.0	6.9e-55
AZP25086.1|1288532_1289231_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	50.9	8.5e-65
AZP25087.1|1289248_1289977_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	60.6	3.4e-88
AZP25088.1|1289946_1290525_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	46.3	1.7e-42
AZP25089.1|1290537_1293732_+	host specificity protein J	NA	A0A1W6JNW2	Morganella_phage	51.8	7.3e-305
AZP25090.1|1293728_1294784_+	hypothetical protein	NA	NA	NA	NA	NA
AZP25091.1|1294934_1295123_-	hypothetical protein	NA	NA	NA	NA	NA
AZP27406.1|1295892_1296432_+	hypothetical protein	NA	A0A1W6JNW0	Morganella_phage	96.2	1.6e-87
>prophage 3
CP033056	Morganella morganii strain L241 chromosome, complete genome	3850444	1394579	1433791	3850444	lysis,portal,coat,holin,tail	Morganella_phage(20.45%)	62	NA	NA
AZP25186.1|1394579_1395287_-	helix-turn-helix domain-containing protein	NA	K7P8B2	Enterobacteria_phage	56.1	4.4e-69
AZP25187.1|1395652_1396090_+	hypothetical protein	NA	A0A1W6JNY5	Morganella_phage	47.5	5.2e-28
AZP25188.1|1396162_1396357_+|holin	holin	holin	A0A1W6JNY9	Morganella_phage	73.0	2.6e-24
AZP25189.1|1396346_1396823_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	77.7	6.2e-67
AZP25190.1|1396959_1397337_+	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	38.4	7.7e-12
AZP25191.1|1397308_1397506_+	peptidase	NA	A0A1W6JP52	Morganella_phage	67.9	1.1e-12
AZP25192.1|1397495_1397732_+	hypothetical protein	NA	NA	NA	NA	NA
AZP25193.1|1397995_1398184_-	AlpA family transcriptional regulator	NA	E5AGD1	Erwinia_phage	60.0	7.7e-13
AZP25194.1|1398176_1398386_-	hypothetical protein	NA	A0A1W6JP02	Morganella_phage	77.3	1.9e-12
AZP25195.1|1398382_1398982_-	DNA methyltransferase	NA	A0A248SKY3	Klebsiella_phage	56.1	4.2e-60
AZP25196.1|1399048_1399342_-	hypothetical protein	NA	NA	NA	NA	NA
AZP25197.1|1399547_1399823_-	hypothetical protein	NA	NA	NA	NA	NA
AZP25198.1|1399882_1400374_-	ASCH domain-containing protein	NA	A0A0U1SZL2	Pseudomonas_phage	27.8	9.4e-10
AZP25199.1|1400616_1401213_-	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	55.3	5.4e-52
AZP25200.1|1401193_1401931_-	phage recombination protein Bet	NA	A0A088CBI3	Shigella_phage	70.3	6.0e-69
AZP25201.1|1401927_1402137_-	hypothetical protein	NA	NA	NA	NA	NA
AZP25202.1|1402133_1402607_-	class I SAM-dependent methyltransferase	NA	A0A0N7IRF6	Acinetobacter_phage	70.9	3.7e-64
AZP25203.1|1402603_1402849_-	hypothetical protein	NA	NA	NA	NA	NA
AZP25204.1|1403013_1403247_-	DUF551 domain-containing protein	NA	A0A088F844	Salmonella_phage	53.2	5.4e-16
AZP25205.1|1403275_1403635_-	hypothetical protein	NA	NA	NA	NA	NA
AZP25206.1|1403639_1403828_-	hypothetical protein	NA	A0A1W6JP47	Morganella_phage	90.7	7.4e-24
AZP25207.1|1404101_1404290_+	hypothetical protein	NA	NA	NA	NA	NA
AZP25208.1|1404534_1404819_-	hypothetical protein	NA	NA	NA	NA	NA
AZP27415.1|1405505_1406426_-	serine dehydrogenasease	NA	NA	NA	NA	NA
AZP25209.1|1406758_1407520_-	helix-turn-helix domain-containing protein	NA	K7P850	Enterobacteria_phage	56.9	3.8e-58
AZP25210.1|1407518_1407746_+	DNA-binding protein	NA	G9L677	Escherichia_phage	77.0	3.3e-26
AZP25211.1|1407864_1408191_+	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	90.7	1.4e-49
AZP25212.1|1408319_1409018_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
AZP25213.1|1409017_1409806_+	hypothetical protein	NA	G8C7U5	Escherichia_phage	59.4	6.6e-82
AZP25214.1|1409805_1410534_+	DNA replication protein DnaC	NA	A0A1W6JP39	Morganella_phage	96.7	1.1e-128
AZP25215.1|1410565_1410817_+	hypothetical protein	NA	NA	NA	NA	NA
AZP25216.1|1411015_1411216_+	hypothetical protein	NA	NA	NA	NA	NA
AZP25217.1|1411205_1411475_+	hypothetical protein	NA	NA	NA	NA	NA
AZP25218.1|1411461_1411662_+	DUF551 domain-containing protein	NA	S4TMV4	Salmonella_phage	44.8	1.0e-07
AZP25219.1|1412113_1412557_+	hypothetical protein	NA	A0A1P8DTD8	Proteus_phage	84.9	2.1e-29
AZP25220.1|1412553_1412967_+	hypothetical protein	NA	NA	NA	NA	NA
AZP25221.1|1413053_1413263_+	hypothetical protein	NA	Q5G8S1	Enterobacteria_phage	59.4	1.4e-15
AZP25222.1|1413344_1413635_+	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	75.0	7.7e-36
AZP25223.1|1413985_1414186_+	NinH	NA	A0A0P0ZGE1	Escherichia_phage	51.0	8.2e-05
AZP25224.1|1414182_1414791_+	hypothetical protein	NA	A0A2H4JCH5	uncultured_Caudovirales_phage	48.1	3.8e-45
AZP25225.1|1415299_1415812_-	hypothetical protein	NA	NA	NA	NA	NA
AZP25226.1|1415951_1416188_+	hypothetical protein	NA	NA	NA	NA	NA
AZP25227.1|1416435_1416744_+|holin	holin	holin	E7C9S8	Salmonella_phage	47.5	1.6e-20
AZP25228.1|1416740_1417133_+	M15 family peptidase	NA	E7C9S9	Salmonella_phage	86.0	4.3e-58
AZP27416.1|1417186_1417579_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	63.3	2.3e-35
AZP25229.1|1417608_1417824_-	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	51.4	2.2e-11
AZP25230.1|1418131_1418338_+	hypothetical protein	NA	NA	NA	NA	NA
AZP25231.1|1418538_1418763_+	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	57.5	5.9e-12
AZP25232.1|1418816_1419293_+	DNA packaging protein	NA	A0A2K8HN72	Pseudomonas_phage	53.6	1.7e-32
AZP25233.1|1419270_1420707_+	DNA packaging protein	NA	Q2A0C1	Sodalis_phage	75.7	6.6e-221
AZP25234.1|1420706_1422794_+|portal	portal protein	portal	G5DA97	Enterobacteria_phage	68.9	1.0e-238
AZP25235.1|1422808_1423723_+	scaffolding protein	NA	A0A192Y6T4	Salmonella_phage	75.0	9.0e-115
AZP25236.1|1423722_1425006_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	65.0	4.3e-163
AZP25237.1|1425332_1425830_+	recombinase RmuC	NA	Q76H19	Enterobacteria_phage	59.6	9.1e-45
AZP25238.1|1425801_1427220_+	hypothetical protein	NA	I1TEJ1	Salmonella_phage	69.9	1.2e-203
AZP25239.1|1427219_1427963_+|tail	phage tail protein	tail	C6ZR14	Salmonella_phage	65.9	2.0e-40
AZP25240.1|1427962_1428424_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.0	1.7e-61
AZP25241.1|1428417_1429077_+	DNA transfer protein	NA	Q2A0B2	Sodalis_phage	70.0	1.2e-47
AZP25242.1|1429089_1430478_+	acyltransferase	NA	Q716G3	Shigella_phage	43.0	2.0e-57
AZP25243.1|1430480_1432673_+	hypothetical protein	NA	A0A088CQ71	Enterobacteria_phage	45.4	4.8e-146
AZP25244.1|1432694_1433162_-	hypothetical protein	NA	NA	NA	NA	NA
AZP25245.1|1433287_1433791_-	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	49.3	8.1e-33
>prophage 4
CP033056	Morganella morganii strain L241 chromosome, complete genome	3850444	1650779	1723898	3850444	terminase,protease,portal,head,holin,tail,tRNA,capsid	Morganella_phage(58.82%)	82	NA	NA
AZP25443.1|1650779_1651793_-	hypothetical protein	NA	A4KWR9	Enterobacteria_phage	38.6	1.7e-61
AZP25444.1|1652004_1652340_-	DUF3024 domain-containing protein	NA	A0A1W6JP12	Morganella_phage	46.4	1.1e-22
AZP25445.1|1652373_1653081_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	41.7	2.2e-44
AZP25446.1|1653182_1653428_+	helix-turn-helix domain-containing protein	NA	A0A2D1GLN0	Escherichia_phage	58.8	2.2e-12
AZP25447.1|1653396_1653675_+	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	56.0	3.4e-17
AZP25448.1|1653941_1655570_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	66.7	1.2e-213
AZP25449.1|1655566_1656556_+	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	54.2	4.7e-101
AZP25450.1|1656555_1657335_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	38.1	2.8e-48
AZP27428.1|1657396_1657978_-	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
AZP25451.1|1658245_1658440_+	hypothetical protein	NA	A0A1W6JP28	Morganella_phage	98.4	2.3e-28
AZP25452.1|1658578_1659637_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	91.5	3.8e-173
AZP25453.1|1659859_1660177_+	hypothetical protein	NA	M1PRT9	Cellulophaga_phage	65.7	2.4e-30
AZP25454.1|1660500_1660692_+|holin	holin	holin	A0A1W6JP85	Morganella_phage	100.0	4.9e-31
AZP25455.1|1660684_1661161_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	93.6	1.1e-82
AZP25456.1|1661297_1661675_+	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	73.4	3.8e-43
AZP25457.1|1661562_1661817_+	peptidase	NA	A0A1W6JNV7	Morganella_phage	77.2	1.2e-16
AZP25458.1|1662164_1662515_+	HNH endonuclease	NA	A0A1W6JP27	Morganella_phage	98.3	2.1e-64
AZP25459.1|1662511_1662715_+	hypothetical protein	NA	A0A1W6JP16	Morganella_phage	97.0	3.0e-31
AZP25460.1|1662859_1663354_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	75.0	4.0e-69
AZP25461.1|1663350_1665081_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	81.3	4.1e-286
AZP25462.1|1665228_1666452_+|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	98.0	4.9e-233
AZP25463.1|1666441_1667050_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1W6JP53	Morganella_phage	93.6	7.3e-105
AZP25464.1|1667059_1668280_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	97.5	1.1e-221
AZP25465.1|1668361_1668664_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	98.0	4.8e-49
AZP25466.1|1668673_1668997_+|head,tail	head-tail adaptor	head,tail	A0A1W6JP44	Morganella_phage	96.3	3.3e-56
AZP25467.1|1668989_1669439_+	HK97 gp10 family phage protein	NA	A0A1W6JP15	Morganella_phage	97.3	1.7e-74
AZP25468.1|1669435_1669771_+	hypothetical protein	NA	A0A1W6JP05	Morganella_phage	92.8	3.5e-56
AZP25469.1|1669831_1670299_+|tail	phage tail protein	tail	A0A1W6JP06	Morganella_phage	92.3	2.9e-77
AZP25470.1|1670302_1670686_+|tail	phage tail protein	tail	A0A1W6JP08	Morganella_phage	94.5	4.8e-62
AZP25471.1|1670697_1670982_+	DUF4035 domain-containing protein	NA	A0A1W6JP68	Morganella_phage	98.9	3.6e-46
AZP25472.1|1671006_1674267_+|tail	phage tail tape measure protein	tail	A0A1W6JP49	Morganella_phage	95.9	0.0e+00
AZP25473.1|1674263_1674599_+|tail	phage tail protein	tail	A0A1W6JP11	Morganella_phage	93.7	2.6e-59
AZP25474.1|1674595_1675354_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	96.4	2.4e-145
AZP25475.1|1675356_1676064_+	peptidase P60	NA	A0A1W6JP31	Morganella_phage	94.8	1.2e-135
AZP25476.1|1676053_1676458_-	hypothetical protein	NA	NA	NA	NA	NA
AZP25477.1|1676536_1677139_+|tail	tail assembly protein	tail	A0A1W6JNY8	Morganella_phage	92.0	3.7e-101
AZP25478.1|1677172_1680349_+	host specificity protein J	NA	A0A1W6JNZ7	Morganella_phage	95.0	0.0e+00
AZP25479.1|1680350_1680671_+	hypothetical protein	NA	A0A1W6JNW9	Morganella_phage	98.1	7.6e-61
AZP25480.1|1680667_1681354_+	hypothetical protein	NA	A0A1W6JNU1	Morganella_phage	99.6	2.6e-135
AZP25481.1|1681356_1681623_+	hypothetical protein	NA	A0A1W6JNS1	Morganella_phage	98.9	5.7e-46
AZP27429.1|1682732_1683272_+	hypothetical protein	NA	A0A1W6JNW0	Morganella_phage	97.5	1.6e-87
AZP25482.1|1683304_1683586_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZP25483.1|1683667_1683952_-	hypothetical protein	NA	A0A1W6JP10	Morganella_phage	86.4	2.0e-36
AZP25484.1|1684470_1685520_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B5IW14	Pandoravirus	46.6	1.2e-78
AZP25485.1|1685666_1686530_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
AZP25486.1|1686748_1689127_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.3	3.4e-174
AZP25487.1|1689601_1690717_-	AI-2E family transporter YdiK	NA	NA	NA	NA	NA
AZP25488.1|1690905_1693995_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AZP25489.1|1694029_1694455_+	hotdog fold thioesterase	NA	NA	NA	NA	NA
AZP25490.1|1694793_1695174_+	Fe-S cluster assembly scaffold SufA	NA	A0A218MM00	uncultured_virus	35.9	1.4e-13
AZP25491.1|1695189_1696674_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AZP25492.1|1696725_1697472_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	28.8	4.9e-10
AZP25493.1|1697446_1698751_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AZP25494.1|1698750_1699989_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.5	2.0e-85
AZP25495.1|1699997_1700417_+	cysteine desulfuration protein SufE	NA	NA	NA	NA	NA
AZP25496.1|1700515_1701598_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
AZP25497.1|1701738_1701975_-	major outer membrane lipoprotein	NA	NA	NA	NA	NA
AZP25498.1|1702300_1703713_-	pyruvate kinase PykF	NA	NA	NA	NA	NA
AZP25499.1|1704430_1705804_-	MATE family efflux transporter	NA	NA	NA	NA	NA
AZP25500.1|1706016_1706682_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.8	1.4e-24
AZP25501.1|1706764_1707928_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.5	1.0e-83
AZP25502.1|1708193_1709405_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.3	2.6e-16
AZP25503.1|1709526_1710429_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZP25504.1|1710432_1711458_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.5	2.4e-31
AZP25505.1|1711735_1711819_+	YnhF family membrane protein	NA	NA	NA	NA	NA
AZP25506.1|1711903_1712482_-	superoxide dismutase [Fe]	NA	NA	NA	NA	NA
AZP25507.1|1712606_1712825_-	hypothetical protein	NA	NA	NA	NA	NA
AZP25508.1|1712871_1713189_+	hypothetical protein	NA	NA	NA	NA	NA
AZP25509.1|1713258_1713798_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
AZP25510.1|1713821_1714583_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.6	5.2e-07
AZP25511.1|1714661_1715120_+	hypothetical protein	NA	NA	NA	NA	NA
AZP25512.1|1715183_1715804_-	homoserine/homoserine lactone efflux protein	NA	NA	NA	NA	NA
AZP25513.1|1716087_1716429_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
AZP25514.1|1716567_1717248_+	hypothetical protein	NA	NA	NA	NA	NA
AZP25515.1|1717315_1717963_-	ribonuclease T	NA	NA	NA	NA	NA
AZP25516.1|1718072_1718480_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
AZP25517.1|1718632_1718869_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
AZP25518.1|1719384_1719819_+	transcriptional regulator SlyA	NA	NA	NA	NA	NA
AZP25519.1|1719878_1720346_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
AZP25520.1|1720664_1721783_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
AZP25521.1|1721837_1722488_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
AZP25522.1|1722623_1723898_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	3.3e-83
>prophage 5
CP033056	Morganella morganii strain L241 chromosome, complete genome	3850444	2175911	2236129	3850444	integrase,terminase,protease,head,holin,tail,capsid	Morganella_phage(74.58%)	73	2191795:2191851	2236161:2236217
AZP25935.1|2175911_2176538_-|tail	tail assembly chaperone	tail	A0A218M4J2	Erwinia_phage	33.0	5.4e-26
AZP25936.1|2177891_2178554_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	38.3	7.1e-37
AZP25937.1|2178550_2179738_-	hypothetical protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	38.9	2.4e-75
AZP25938.1|2179730_2180075_-	hypothetical protein	NA	NA	NA	NA	NA
AZP25939.1|2180071_2180764_-	hypothetical protein	NA	A1Z003	Burkholderia_virus	42.0	4.8e-36
AZP25940.1|2180780_2181596_-	hypothetical protein	NA	B5M9T8	Pseudomonas_phage	27.5	2.9e-16
AZP25941.1|2181588_2181882_-	hypothetical protein	NA	NA	NA	NA	NA
AZP25942.1|2181878_2182418_-	hypothetical protein	NA	NA	NA	NA	NA
AZP25943.1|2182414_2184385_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	22.6	4.9e-17
AZP25944.1|2184467_2184926_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	49.3	1.3e-26
AZP25945.1|2184967_2185420_-	hypothetical protein	NA	I7ATP4	Escherichia_phage	37.8	8.3e-21
AZP25946.1|2185435_2186923_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	37.3	9.6e-82
AZP25947.1|2186932_2187448_-	hypothetical protein	NA	NA	NA	NA	NA
AZP25948.1|2187598_2188162_+	hypothetical protein	NA	NA	NA	NA	NA
AZP27459.1|2188310_2188745_-	antitermination protein Q	NA	B6SCU4	Bacteriophage	47.8	5.4e-25
AZP25949.1|2188953_2189640_-	DUF4431 domain-containing protein	NA	NA	NA	NA	NA
AZP25950.1|2189864_2190986_+	glycosyltransferase	NA	NA	NA	NA	NA
AZP25951.1|2191083_2191743_-	hypothetical protein	NA	NA	NA	NA	NA
2191795:2191851	attL	TTTAATATGGTGCCGGCTACCGGAGTCGAACTGGTGACCTACTGATTACAAGTCAGT	NA	NA	NA	NA
AZP25952.1|2192050_2193313_-	translesion error-prone DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	97.4	1.9e-235
AZP25953.1|2193312_2193729_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	94.2	4.1e-67
AZP25954.1|2194174_2194432_+	hypothetical protein	NA	NA	NA	NA	NA
AZP25955.1|2194438_2196079_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AZP25956.1|2196547_2200636_-	DUF1983 domain-containing protein	NA	A0A1W6JNZ7	Morganella_phage	67.5	0.0e+00
AZP25957.1|2200669_2201272_-|tail	tail assembly protein	tail	A0A1W6JNY8	Morganella_phage	90.5	1.5e-97
AZP25958.1|2201304_2202006_-	peptidase P60	NA	A0A1W6JP31	Morganella_phage	94.8	9.3e-136
AZP25959.1|2202008_2202767_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	95.6	7.7e-144
AZP25960.1|2202763_2203099_-|tail	phage tail protein	tail	A0A1W6JP11	Morganella_phage	95.5	6.7e-60
AZP25961.1|2203095_2206356_-|tail	phage tail tape measure protein	tail	A0A1W6JP49	Morganella_phage	94.9	0.0e+00
AZP25962.1|2206381_2206666_-	DUF4035 domain-containing protein	NA	A0A1W6JP68	Morganella_phage	86.0	2.0e-36
AZP25963.1|2206677_2207061_-|tail	phage tail protein	tail	A0A1W6JP08	Morganella_phage	94.5	4.8e-62
AZP25964.1|2207064_2207532_-|tail	phage tail protein	tail	A0A1W6JP06	Morganella_phage	92.3	2.9e-77
AZP25965.1|2207592_2207928_-	hypothetical protein	NA	A0A1W6JP05	Morganella_phage	92.8	3.5e-56
AZP25966.1|2207924_2208374_-	HK97 gp10 family phage protein	NA	A0A1W6JP15	Morganella_phage	97.3	8.4e-74
AZP25967.1|2208366_2208693_-|head,tail	head-tail adaptor	head,tail	A0A1W6JP44	Morganella_phage	82.4	1.0e-44
AZP25968.1|2208703_2208997_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	39.8	6.2e-09
AZP25969.1|2209038_2210250_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	62.8	2.0e-141
AZP25970.1|2210259_2210916_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	76.9	1.7e-94
AZP25971.1|2212119_2212299_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	62.5	4.4e-10
AZP25972.1|2212308_2214039_-|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	93.3	0.0e+00
AZP25973.1|2214042_2214513_-|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	92.9	1.3e-80
AZP25974.1|2214659_2215013_-	HNH endonuclease	NA	A0A1W6JP27	Morganella_phage	94.0	8.4e-61
AZP25975.1|2215121_2215637_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	98.8	1.4e-96
AZP25976.1|2216256_2216634_-	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	96.8	1.7e-59
AZP25977.1|2216770_2217220_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	94.6	1.8e-79
AZP25978.1|2217239_2217431_-|holin	holin	holin	A0A1W6JNY9	Morganella_phage	100.0	1.4e-30
AZP27460.1|2217749_2217956_+	thiamine biosynthesis protein ApbE	NA	NA	NA	NA	NA
AZP25979.1|2218102_2218312_-	hypothetical protein	NA	A0A1W6JNU4	Morganella_phage	67.2	8.5e-21
AZP25980.1|2219081_2219540_-	heat-shock protein	NA	NA	NA	NA	NA
AZP25981.1|2219846_2220287_+	universal stress protein F	NA	A0A1W6JNV4	Morganella_phage	54.0	5.2e-28
AZP25982.1|2220615_2221377_-	sel1 repeat family protein	NA	NA	NA	NA	NA
AZP25983.1|2221448_2222378_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	99.2	2.8e-148
AZP25984.1|2222603_2222816_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	98.6	5.8e-33
AZP25985.1|2223190_2223628_-	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	97.9	1.9e-78
AZP25986.1|2223748_2223916_-	NinH	NA	A0A1W6JNW3	Morganella_phage	97.4	5.6e-15
AZP25987.1|2223917_2224556_-	NinG family protein	NA	A0A1W6JNX3	Morganella_phage	99.5	3.5e-105
AZP25988.1|2224832_2225261_+	universal stress protein UspA	NA	A0A1W6JNV4	Morganella_phage	100.0	9.8e-72
AZP25989.1|2225246_2225696_-	hypothetical protein	NA	A0A1W6JNY5	Morganella_phage	91.9	2.6e-75
AZP25990.1|2225692_2225890_-	hypothetical protein	NA	A0A1W6JP14	Morganella_phage	96.9	3.5e-32
AZP25991.1|2225901_2226345_-	recombination protein NinB	NA	A0A1W6JNZ4	Morganella_phage	99.3	7.0e-81
AZP25992.1|2226593_2227322_-	DNA replication protein DnaC	NA	A0A1W6JP39	Morganella_phage	99.6	1.0e-132
AZP27461.1|2227321_2228113_-	replication protein	NA	A0A1W6JNY0	Morganella_phage	99.2	1.4e-132
AZP25993.1|2228254_2228581_-	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	100.0	1.8e-54
AZP25994.1|2228711_2228921_-	XRE family transcriptional regulator	NA	A0A1W6JNW6	Morganella_phage	97.8	4.8e-16
AZP25995.1|2229020_2229668_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JNY2	Morganella_phage	100.0	4.0e-117
AZP25996.1|2229706_2230048_+	DUF3024 domain-containing protein	NA	A0A1W6JP12	Morganella_phage	100.0	1.6e-61
AZP25997.1|2230199_2230397_-	DUF2767 family protein	NA	A0A1W6JNW1	Morganella_phage	100.0	8.0e-29
AZP27462.1|2230793_2231102_+	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	100.0	1.3e-49
AZP25998.1|2231130_2231340_-	hypothetical protein	NA	A0A1W6JP23	Morganella_phage	100.0	5.9e-30
AZP25999.1|2231694_2231976_-	hypothetical protein	NA	NA	NA	NA	NA
AZP26000.1|2233064_2233427_+	hypothetical protein	NA	A0A1W6JNZ2	Morganella_phage	85.8	6.4e-56
AZP26001.1|2233429_2234044_+	single-stranded DNA-binding protein	NA	A0A1W6JP21	Morganella_phage	98.5	5.0e-109
AZP26002.1|2234044_2234440_+	single-stranded DNA-binding protein	NA	A0A1W6JNW8	Morganella_phage	97.7	1.0e-70
AZP26003.1|2234977_2236129_+|integrase	site-specific integrase	integrase	A0A2H5BFK7	Salmonella_phage	69.8	6.6e-155
2236161:2236217	attR	TTTAATATGGTGCCGGCTACCGGAGTCGAACTGGTGACCTACTGATTACAAGTCAGT	NA	NA	NA	NA
>prophage 6
CP033056	Morganella morganii strain L241 chromosome, complete genome	3850444	2663241	2673084	3850444	protease,tRNA	Bacillus_phage(16.67%)	8	NA	NA
AZP26343.1|2663241_2665011_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.6	2.2e-24
AZP26344.1|2665013_2666780_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.9	5.8e-17
AZP26345.1|2666757_2667477_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AZP26346.1|2667627_2667846_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AZP27484.1|2667922_2670208_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.5	2.8e-173
AZP26347.1|2670241_2670562_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	46.7	2.6e-16
AZP26348.1|2670820_2671051_+	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	56.7	2.6e-15
AZP26349.1|2671137_2673084_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	39.9	1.2e-36
>prophage 7
CP033056	Morganella morganii strain L241 chromosome, complete genome	3850444	2857425	2865480	3850444	tRNA	Mycobacterium_phage(33.33%)	8	NA	NA
AZP26519.1|2857425_2857635_-	cold shock-like protein CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	4.5e-22
AZP26520.1|2857834_2858302_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
AZP26521.1|2858483_2859566_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
AZP26522.1|2859874_2860093_+	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	51.4	2.3e-16
AZP26523.1|2860114_2860531_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	40.4	1.4e-11
AZP26524.1|2860561_2862682_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	52.6	3.6e-207
AZP26525.1|2862706_2863669_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	73.4	2.2e-135
AZP26526.1|2864274_2865480_+	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.5	5.5e-27
>prophage 8
CP033056	Morganella morganii strain L241 chromosome, complete genome	3850444	3799882	3820134	3850444	integrase	Morganella_phage(94.74%)	27	3799689:3799706	3817882:3817899
3799689:3799706	attL	AGTAACACTTCACAGTAA	NA	NA	NA	NA
AZP27284.1|3799882_3801148_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	99.8	3.6e-247
AZP27285.1|3801240_3802149_+	hypothetical protein	NA	NA	NA	NA	NA
AZP27286.1|3802250_3802487_+	AlpA family phage regulatory protein	NA	A0A1W6JPE9	Morganella_phage	96.2	6.2e-36
AZP27287.1|3802486_3802915_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	98.6	1.6e-77
AZP27288.1|3802928_3803522_+	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	99.0	1.2e-107
AZP27532.1|3803848_3804619_+	host cell division inhibitor Icd-like protein	NA	A0A1W6JPK3	Morganella_phage	85.5	2.4e-116
AZP27289.1|3804615_3804876_+	hypothetical protein	NA	NA	NA	NA	NA
AZP27290.1|3804872_3805064_+	hypothetical protein	NA	A0A1W6JPF0	Morganella_phage	95.2	6.8e-25
AZP27291.1|3805060_3805270_+	hypothetical protein	NA	A0A1W6JPF1	Morganella_phage	100.0	3.2e-28
AZP27292.1|3805266_3805464_+	hypothetical protein	NA	A0A1W6JPE5	Morganella_phage	100.0	1.7e-26
AZP27293.1|3805460_3806003_+	hypothetical protein	NA	A0A1W6JPH2	Morganella_phage	97.8	5.9e-98
AZP27294.1|3806014_3806365_+	hypothetical protein	NA	A0A1W6JPD8	Morganella_phage	96.6	4.6e-59
AZP27295.1|3806361_3806736_+	hypothetical protein	NA	NA	NA	NA	NA
AZP27296.1|3806722_3809434_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	94.9	0.0e+00
AZP27533.1|3809903_3810326_+	osmoprotectant transporter ProQ	NA	A0A1W6JPI6	Morganella_phage	63.9	6.2e-18
AZP27297.1|3810322_3810544_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AZP27298.1|3810709_3810922_+	hypothetical protein	NA	A0A1W6JPL2	Morganella_phage	95.7	1.9e-28
AZP27299.1|3810909_3813312_+	hypothetical protein	NA	A0A1W6JPF2	Morganella_phage	97.9	0.0e+00
AZP27300.1|3813380_3813599_+	hypothetical protein	NA	A0A1W6JPG4	Morganella_phage	100.0	2.5e-31
AZP27301.1|3813595_3813940_+	hypothetical protein	NA	A0A1W6JPG1	Morganella_phage	99.1	4.2e-57
AZP27302.1|3814629_3815205_+	hypothetical protein	NA	NA	NA	NA	NA
AZP27303.1|3815214_3815448_+	hypothetical protein	NA	NA	NA	NA	NA
AZP27304.1|3815450_3815852_+	preprotein translocase subunit SecB	NA	NA	NA	NA	NA
AZP27305.1|3815848_3816274_-	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	87.7	3.5e-61
AZP27306.1|3816779_3817010_+	hypothetical protein	NA	NA	NA	NA	NA
AZP27307.1|3817238_3817520_+	hypothetical protein	NA	A0A1W6JPH4	Morganella_phage	96.7	4.8e-43
AZP27308.1|3818733_3820134_-	purine permease	NA	H9YQ34	environmental_Halophage	43.7	2.0e-20
3817882:3817899	attR	AGTAACACTTCACAGTAA	NA	NA	NA	NA
>prophage 1
CP033057	Morganella morganii strain L241 plasmid pNDM5-L241, complete sequence	46161	0	3255	46161	transposase	Staphylococcus_phage(50.0%)	2	NA	NA
AZP27536.1|1128_2130_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.1	2.6e-51
AZP27537.1|2238_3255_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
>prophage 2
CP033057	Morganella morganii strain L241 plasmid pNDM5-L241, complete sequence	46161	6517	10970	46161	transposase	Escherichia_phage(40.0%)	6	NA	NA
AZP27542.1|6517_7222_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
AZP27543.1|7255_7612_-	sOS mutagenesis and repair protein UmuD	NA	A0A222YZE2	Escherichia_phage	46.6	5.5e-20
AZP27544.1|7614_7854_-	DNA polymerase V	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
AZP27545.1|7955_9176_+|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
AZP27586.1|9264_9927_-	resolvase	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
AZP27546.1|10307_10970_+	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
>prophage 3
CP033057	Morganella morganii strain L241 plasmid pNDM5-L241, complete sequence	46161	15570	16086	46161		Tupanvirus(100.0%)	1	NA	NA
AZP27551.1|15570_16086_+	molecular chaperone DnaJ	NA	A0A2K9L588	Tupanvirus	39.8	3.3e-05
>prophage 4
CP033057	Morganella morganii strain L241 plasmid pNDM5-L241, complete sequence	46161	34717	38888	46161		Moraxella_phage(33.33%)	3	NA	NA
AZP27575.1|34717_35212_+	micrococcal nuclease	NA	A0A0R6PHV6	Moraxella_phage	37.3	8.0e-17
AZP27576.1|35294_36557_+	ATP-binding protein	NA	A0A1V0SKF8	Klosneuvirus	31.4	1.3e-07
AZP27577.1|36560_38888_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	28.1	8.6e-37
