The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034482	Rahnella aquatilis strain KM12 chromosome, complete genome	4878627	685634	752788	4878627	tail,tRNA,plate	Erwinia_phage(33.33%)	62	NA	NA
AZP48828.1|685634_686684_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
AZP48827.1|686661_687429_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.7	8.2e-69
AZP45247.1|687418_688045_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	8.8e-37
AZP48829.1|688305_689310_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.2	2.2e-05
AZP45248.1|689361_690348_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	33.1	7.1e-33
AZP45249.1|690446_693002_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	24.7	4.9e-25
AZP45250.1|693424_696085_+	hypothetical protein	NA	NA	NA	NA	NA
AZP45251.1|696239_697343_+	murein transglycosylase B	NA	NA	NA	NA	NA
AZP45252.1|697504_697999_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	48.7	1.7e-27
AZP45253.1|698106_699171_+	DNA recombination/repair protein RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.6	3.2e-111
AZP45254.1|699291_699981_+	recombination regulator RecX	NA	NA	NA	NA	NA
AZP45255.1|699900_700182_-	hypothetical protein	NA	NA	NA	NA	NA
AZP45256.1|700119_702747_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.8	5.5e-80
AZP45257.1|703003_703189_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
AZP45258.1|704353_704920_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
AZP45259.1|704916_705345_+	DedA family protein	NA	NA	NA	NA	NA
AZP45260.1|705430_707002_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AZP45261.1|707159_707675_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
AZP45262.1|707744_709034_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AZP45263.1|709050_709842_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AZP45264.1|710006_711368_+	signal recognition particle protein	NA	NA	NA	NA	NA
AZP48830.1|711546_711795_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AZP45265.1|711813_712362_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AZP45266.1|712429_713203_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AZP45267.1|713251_713599_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AZP45268.1|713690_713870_-	late control protein B	NA	F1BUT0	Erwinia_phage	75.5	6.4e-17
AZP45269.1|713934_715035_-|tail	phage tail protein	tail	Q6K1G4	Salmonella_virus	43.9	4.4e-84
AZP45270.1|715037_715508_-|tail	phage tail protein	tail	U5N3F6	Enterobacteria_phage	50.0	1.7e-37
AZP45271.1|715504_717136_-|tail	phage tail tape measure protein	tail	F1BUT7	Erwinia_phage	28.2	7.7e-16
AZP45272.1|717128_717263_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	78.9	6.7e-11
AZP45273.1|717283_717571_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	60.9	4.3e-23
AZP45274.1|717630_718140_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	68.4	3.1e-64
AZP45275.1|718154_719324_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	80.2	1.1e-181
AZP45276.1|719515_720502_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	66.1	3.8e-119
AZP45277.1|720491_721106_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	70.9	1.7e-80
AZP45278.1|721098_722007_-|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	73.8	7.8e-119
AZP45279.1|722012_722363_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	63.8	9.9e-38
AZP45280.1|722359_723001_-|plate	phage baseplate assembly protein V	plate	A0A0F7LBP2	Escherichia_phage	60.4	6.4e-67
AZP45281.1|723082_723544_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	43.3	2.4e-23
AZP45282.1|723636_724065_-	transcriptional regulator	NA	F1BUQ1	Erwinia_phage	48.3	1.4e-06
AZP45283.1|724065_724575_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	61.1	1.5e-55
AZP45284.1|724555_724777_-	hypothetical protein	NA	NA	NA	NA	NA
AZP45285.1|724767_724971_-|tail	phage tail protein	tail	F1BUQ5	Erwinia_phage	56.7	8.6e-18
AZP45286.1|725182_725377_-	hypothetical protein	NA	NA	NA	NA	NA
AZP45287.1|725525_727418_-	replication endonuclease	NA	A0A0F7LA09	Escherichia_phage	50.9	5.2e-181
AZP45288.1|727511_727733_-	conjugal transfer protein TraR	NA	A0A1S6L007	Salmonella_phage	44.3	4.6e-09
AZP45289.1|727732_728008_-	hypothetical protein	NA	NA	NA	NA	NA
AZP45290.1|728140_728731_+	CI repressor	NA	Q6K1G0	Salmonella_virus	51.3	1.8e-52
AZP45291.1|729019_730096_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	48.3	3.9e-85
AZP45292.1|730102_731224_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AZP45293.1|731301_732456_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AZP45294.1|732767_733112_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AZP45295.1|733393_734128_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AZP45296.1|734258_735236_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AZP45297.1|735235_735973_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AZP45298.1|736103_738677_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.1	2.2e-126
AZP45299.1|744506_745805_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.3	2.9e-42
AZP45300.1|745994_747353_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AZP45301.1|747434_750155_-	bifunctional acyl-CoA synthetase/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZP45302.1|750186_750891_-	DTW domain-containing protein	NA	NA	NA	NA	NA
AZP45303.1|751020_751440_-	thioredoxin TrxC	NA	A0A191VYI2	Roseobacter_phage	34.4	4.5e-13
AZP45304.1|751684_752788_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 2
CP034482	Rahnella aquatilis strain KM12 chromosome, complete genome	4878627	1815012	1825273	4878627		Enterobacteria_phage(37.5%)	9	NA	NA
AZP46200.1|1815012_1815654_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	37.9	3.2e-34
AZP46201.1|1815691_1816273_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	1.5e-30
AZP46202.1|1816316_1818167_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
AZP46203.1|1818245_1819835_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.6	8.2e-39
AZP46204.1|1820297_1821185_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.9	1.2e-60
AZP46205.1|1821299_1822172_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	65.6	1.0e-107
AZP46206.1|1822191_1823256_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.0	4.6e-102
AZP46207.1|1823867_1824404_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.0	5.5e-56
AZP46208.1|1824400_1825273_+	dTDP-4-dehydrorhamnose reductase	NA	K7QJU0	Escherichia_phage	37.5	6.3e-41
>prophage 3
CP034482	Rahnella aquatilis strain KM12 chromosome, complete genome	4878627	2943990	2952474	4878627		Tupanvirus(33.33%)	8	NA	NA
AZP47151.1|2943990_2945973_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	24.6	2.8e-20
AZP47152.1|2945972_2946953_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	32.4	5.4e-33
AZP47153.1|2946952_2948095_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	28.9	5.0e-30
AZP48917.1|2948443_2949193_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	7.1e-09
AZP47154.1|2949212_2949764_-	glutathione peroxidase	NA	A0A1S7DMQ0	Molluscum_contagiosum_virus	41.6	9.2e-14
AZP47155.1|2949837_2950845_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
AZP47156.1|2950998_2951397_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
AZP47157.1|2952177_2952474_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	3.2e-13
>prophage 4
CP034482	Rahnella aquatilis strain KM12 chromosome, complete genome	4878627	3880284	3960935	4878627	tRNA,tail,head,terminase,lysis,capsid,portal,plate,protease,integrase,holin,coat	Erwinia_phage(44.19%)	80	3926661:3926685	3958612:3958636
AZP47975.1|3880284_3880803_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
AZP47976.1|3880811_3881357_+	SCPU domain-containing protein	NA	NA	NA	NA	NA
AZP47977.1|3881376_3882174_+	molecular chaperone	NA	NA	NA	NA	NA
AZP47978.1|3882192_3884640_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AZP47979.1|3884636_3885605_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
AZP47980.1|3885661_3886141_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
AZP47981.1|3886250_3886904_-	DNA oxidative demethylase AlkB	NA	A0A0H3Y8P5	Apricot_vein_clearing_associated_virus	33.7	7.1e-05
AZP47982.1|3887041_3887860_+	shikimate 5-dehydrogenase	NA	NA	NA	NA	NA
AZP47983.1|3887921_3889259_-	glucarate dehydratase	NA	NA	NA	NA	NA
AZP48958.1|3889287_3890628_-	glucarate dehydratase	NA	NA	NA	NA	NA
AZP47984.1|3890627_3892001_-	MFS transporter	NA	NA	NA	NA	NA
AZP47985.1|3892227_3893388_-	CdaR family transcriptional regulator	NA	NA	NA	NA	NA
AZP47986.1|3893625_3895077_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.7	3.9e-27
AZP47987.1|3895284_3896799_-	dGTPase	NA	NA	NA	NA	NA
AZP47988.1|3896982_3897687_+	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
AZP47989.1|3897686_3898493_+	vitamin B12 ABC transporter substrate-binding protein BtuF	NA	NA	NA	NA	NA
AZP47990.1|3898824_3899070_+	hypothetical protein	NA	NA	NA	NA	NA
AZP48959.1|3899177_3899522_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	7.7e-27
AZP47991.1|3899625_3901089_-	H(+)/Cl(-) exchange transporter ClcA	NA	NA	NA	NA	NA
AZP47992.1|3901275_3902556_+	glutamate-1-semialdehyde-2,1-aminomutase	NA	NA	NA	NA	NA
AZP47993.1|3902659_3904648_-	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
AZP47994.1|3904644_3905547_-	Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD	NA	NA	NA	NA	NA
AZP47995.1|3905548_3906361_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.6	1.3e-11
AZP47996.1|3906456_3908679_-	ferrichrome porin FhuA	NA	NA	NA	NA	NA
AZP47997.1|3908975_3911615_-	bifunctional glycosyl transferase/transpeptidase	NA	NA	NA	NA	NA
AZP48960.1|3911805_3914250_-	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	31.1	1.9e-42
AZP47998.1|3914346_3914889_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
AZP47999.1|3914937_3915672_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AZP48000.1|3915902_3916358_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
AZP48001.1|3916420_3917296_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AZP48002.1|3917428_3919135_+	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	37.4	1.0e-26
AZP48003.1|3919131_3919611_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AZP48004.1|3919616_3921002_-	two-component system sensor histidine kinase QseC	NA	NA	NA	NA	NA
AZP48005.1|3920998_3921685_-	response regulator	NA	NA	NA	NA	NA
AZP48006.1|3921843_3922638_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
AZP48007.1|3922652_3923507_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
AZP48008.1|3923615_3923996_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
AZP48009.1|3924139_3924910_-	ABC transporter permease	NA	NA	NA	NA	NA
AZP48010.1|3924909_3925833_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.3	1.2e-21
AZP48011.1|3925968_3926625_+	carbonate dehydratase	NA	NA	NA	NA	NA
3926661:3926685	attL	AAGGCACAAAAATGTGCCTTTTTTA	NA	NA	NA	NA
AZP48012.1|3926773_3927781_-|integrase	integrase	integrase	Q83VS6	Escherichia_phage	58.2	8.4e-114
AZP48013.1|3927856_3928156_-	XRE family transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	67.7	7.7e-31
AZP48014.1|3928263_3928536_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	70.0	1.6e-30
AZP48015.1|3928546_3928711_+	DUF2724 domain-containing protein	NA	F1BUS5	Erwinia_phage	49.0	7.9e-06
AZP48961.1|3928805_3929045_+	hypothetical protein	NA	NA	NA	NA	NA
AZP48016.1|3929111_3929294_+	DUF2732 family protein	NA	Q6K1F6	Salmonella_virus	51.7	3.2e-08
AZP48017.1|3929293_3929518_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	47.9	1.3e-11
AZP48018.1|3931895_3932279_-	hypothetical protein	NA	A0A0P0IE45	Acinetobacter_phage	38.6	1.5e-07
AZP48019.1|3932275_3932692_-	hypothetical protein	NA	NA	NA	NA	NA
AZP48020.1|3934452_3936141_+	hypothetical protein	NA	D0UIM0	Aggregatibacter_phage	55.1	1.7e-180
AZP48021.1|3936228_3937260_-|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	78.3	1.5e-158
AZP48022.1|3937261_3939028_-|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	76.9	3.2e-270
AZP48023.1|3939172_3940024_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	62.2	1.5e-87
AZP48024.1|3940070_3941135_+|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	73.7	1.4e-143
AZP48025.1|3941147_3941804_+	hypothetical protein	NA	F1BUQ7	Erwinia_phage	54.1	2.3e-56
AZP48026.1|3941899_3942370_+|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	50.7	2.1e-35
AZP48027.1|3942369_3942573_+|tail	phage tail protein	tail	F1BUQ5	Erwinia_phage	64.2	4.5e-19
AZP48028.1|3942578_3942788_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	47.8	6.8e-10
AZP48029.1|3942768_3943278_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	64.5	4.5e-55
AZP48030.1|3943277_3943703_+|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	46.7	4.4e-24
AZP48031.1|3943662_3943836_+|holin	holin	holin	F1BUQ0	Erwinia_phage	55.6	3.3e-10
AZP48032.1|3943798_3944266_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	65.8	3.2e-52
AZP48033.1|3944258_3944708_+	phage virion morphogenesis protein	NA	F1BUP7	Erwinia_phage	67.1	1.8e-44
AZP48034.1|3944727_3945885_-	hypothetical protein	NA	NA	NA	NA	NA
AZP48035.1|3945993_3946638_+|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	58.5	1.5e-63
AZP48036.1|3946772_3947123_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	67.2	3.4e-38
AZP48037.1|3947125_3948034_+|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	76.5	4.9e-121
AZP48038.1|3948026_3948554_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	77.1	4.0e-75
AZP48039.1|3948563_3951080_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	42.6	3.9e-75
AZP48040.1|3951089_3951545_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	49.2	5.6e-25
AZP48041.1|3951676_3952846_+|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	77.9	3.9e-179
AZP48042.1|3952859_3953369_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	71.5	6.2e-65
AZP48043.1|3953427_3953709_+|tail	phage tail assembly protein	tail	F1BUU0	Erwinia_phage	62.9	6.5e-24
AZP48044.1|3953741_3953861_+|tail	GpE family phage tail protein	tail	Q858U8	Yersinia_virus	74.4	1.7e-10
AZP48045.1|3953853_3956328_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	63.6	4.3e-204
AZP48046.1|3956340_3956811_+|tail	phage tail protein	tail	U5N3F6	Enterobacteria_phage	61.7	6.0e-46
AZP48047.1|3956807_3957968_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	67.7	3.1e-144
AZP48962.1|3958287_3958509_+	DNA-binding transcriptional regulator	NA	F1BUT0	Erwinia_phage	68.6	3.1e-21
AZP48048.1|3959461_3959794_+	hypothetical protein	NA	NA	NA	NA	NA
3958612:3958636	attR	AAGGCACAAAAATGTGCCTTTTTTA	NA	NA	NA	NA
AZP48049.1|3960398_3960935_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	1.3e-17
