The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025476	Lactobacillus curvatus strain IRG2 chromosome, complete genome	1963257	38048	97623	1963257	integrase,transposase,tRNA	Bacillus_phage(26.67%)	60	40618:40633	101408:101423
AZP95539.1|38048_39206_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
AZP95540.1|39250_40039_-	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
AZP95541.1|40159_41104_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
40618:40633	attL	GCAACAGATTGAACAA	NA	NA	NA	NA
AZP97291.1|41208_41697_+	universal stress protein	NA	NA	NA	NA	NA
AZP95542.1|41772_42312_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
AZP95543.1|42401_42893_+	hypothetical protein	NA	NA	NA	NA	NA
AZP95544.1|42916_43753_+	hypothetical protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.2	1.9e-10
AZP95545.1|43739_44474_+	hypothetical protein	NA	NA	NA	NA	NA
AZP95546.1|44606_45542_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AZP95547.1|45559_46027_+	universal stress protein	NA	NA	NA	NA	NA
AZP95548.1|46051_46780_+	hypothetical protein	NA	NA	NA	NA	NA
AZP95549.1|46863_47079_+	hypothetical protein	NA	NA	NA	NA	NA
AZP95550.1|47130_48503_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.0	9.3e-47
AZP95551.1|48919_50107_-	cyclopropane-fatty-acyl-phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	38.1	5.5e-48
AZP95552.1|50262_51303_+	AI-2E family transporter	NA	NA	NA	NA	NA
AZP95553.1|51295_51526_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZP95554.1|51693_51891_+	transcriptional regulator	NA	NA	NA	NA	NA
AZP95555.1|51983_53036_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
AZP95556.1|53228_53669_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AZP95557.1|53716_54256_-	hypothetical protein	NA	NA	NA	NA	NA
AZP95558.1|54410_55307_+	DUF4162 domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.1	5.5e-24
AZP95559.1|55299_56553_+	ABC transporter permease	NA	NA	NA	NA	NA
AZP95560.1|57817_59713_+	peptidase M13	NA	E3T4I7	Cafeteria_roenbergensis_virus	29.4	7.4e-71
AZP95561.1|59773_60391_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
AZP95562.1|60576_61248_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
AZP95563.1|61244_62054_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AZP95564.1|62046_62856_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
AZP95565.1|63147_64095_-	DUF1002 domain-containing protein	NA	NA	NA	NA	NA
AZP95566.1|65604_66885_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	34.5	3.0e-63
AZP95567.1|67054_68365_+	guanine permease	NA	A0A0R6PHV4	Moraxella_phage	32.9	1.5e-49
AZP95568.1|68508_69171_+	class A sortase	NA	NA	NA	NA	NA
AZP95569.1|69220_69415_+	hypothetical protein	NA	NA	NA	NA	NA
AZP95570.1|69520_70093_-	transcriptional regulator	NA	NA	NA	NA	NA
AZP95571.1|70207_70585_+	hypothetical protein	NA	NA	NA	NA	NA
AZP95572.1|70992_71706_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	40.6	6.1e-42
AZP95573.1|71715_73620_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	33.7	9.5e-34
AZP95574.1|73609_74941_+	hypothetical protein	NA	NA	NA	NA	NA
AZP95575.1|74945_75761_+	hypothetical protein	NA	NA	NA	NA	NA
AZP95576.1|75797_76604_+	MBL fold metallo-hydrolase	NA	A0A2H4J3R0	uncultured_Caudovirales_phage	30.9	1.1e-31
AZP95577.1|76773_78012_+	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	27.9	6.2e-18
AZP95578.1|78111_78786_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	33.3	4.3e-29
AZP95579.1|78782_79463_+|integrase	integrase	integrase	A0A1B1P773	Bacillus_phage	29.9	4.3e-13
AZP95580.1|79464_79677_+|transposase	transposase	transposase	NA	NA	NA	NA
AZP95581.1|80218_80698_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
AZP95582.1|80835_81276_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
AZP95583.1|81272_81671_+	hypothetical protein	NA	NA	NA	NA	NA
AZP95584.1|82819_84307_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AZP95585.1|84337_85192_+	transcription antiterminator LicT	NA	NA	NA	NA	NA
AZP95586.1|85298_87128_+	PTS beta-glucoside transporter subunit IIABC	NA	NA	NA	NA	NA
AZP95587.1|87143_88559_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AZP97292.1|88730_90197_+	MFS transporter	NA	NA	NA	NA	NA
AZP95588.1|90332_90980_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
AZP95589.1|91002_92379_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
AZP95590.1|92380_93403_+	DUF4432 domain-containing protein	NA	NA	NA	NA	NA
AZP95591.1|93418_94339_+	ribokinase	NA	NA	NA	NA	NA
AZP95592.1|94318_94465_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AZP95593.1|94491_95421_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.4	2.3e-25
AZP97293.1|95531_96476_+	hypothetical protein	NA	NA	NA	NA	NA
AZP97294.1|96494_96641_+	hypothetical protein	NA	NA	NA	NA	NA
AZP95594.1|96693_97623_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.4	2.3e-25
101408:101423	attR	GCAACAGATTGAACAA	NA	NA	NA	NA
>prophage 2
CP025476	Lactobacillus curvatus strain IRG2 chromosome, complete genome	1963257	213871	249671	1963257	integrase,transposase	Paenibacillus_phage(18.18%)	31	221846:221905	249573:249725
AZP95710.1|213871_214546_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	30.9	3.4e-26
AZP95711.1|215787_216450_+	transcriptional regulator	NA	NA	NA	NA	NA
AZP97299.1|216549_216867_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	37.6	2.6e-13
AZP95712.1|216958_218191_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
AZP95713.1|218568_219315_+	NAD(P)-dependent oxidoreductase	NA	A0A2P0VP75	Tetraselmis_virus	28.2	9.9e-11
AZP95714.1|220902_221832_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BVY4	unidentified_phage	30.1	1.0e-25
221846:221905	attL	CTTAATACCATATTTTCTCGCTATTAATTTATAACCTAAGGGTGACGTTAGATAATCCTG	NA	NA	NA	NA
AZP95715.1|222119_224651_+	peptidase	NA	A0A0P0IY26	Acinetobacter_phage	25.5	4.9e-62
AZP95716.1|224693_225509_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AZP95717.1|225551_226292_-	hypothetical protein	NA	A0A0B5JD41	Pandoravirus	28.3	2.8e-13
AZP95718.1|226462_227532_-|transposase	IS3-like element IS1520 family transposase	transposase	Q6J1X2	Lactobacillus_phage	34.9	6.3e-27
AZP95719.1|227788_228373_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZP95720.1|228523_230218_-	oleate hydratase	NA	NA	NA	NA	NA
AZP97300.1|232031_232553_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZP95721.1|233297_233525_+	hypothetical protein	NA	NA	NA	NA	NA
AZP95722.1|233525_234623_+	glycosyl transferase	NA	NA	NA	NA	NA
AZP95723.1|234615_235134_+	hypothetical protein	NA	NA	NA	NA	NA
AZP97301.1|235249_236068_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
AZP95724.1|236257_237460_+	CHAP domain-containing protein	NA	NA	NA	NA	NA
AZP95725.1|238392_238602_+	hypothetical protein	NA	NA	NA	NA	NA
AZP95726.1|238635_238926_+	hypothetical protein	NA	NA	NA	NA	NA
AZP95727.1|239010_239535_+	hypothetical protein	NA	NA	NA	NA	NA
AZP95728.1|239512_240256_+	hypothetical protein	NA	NA	NA	NA	NA
AZP95729.1|240275_242093_+	glycerophosphodiester phosphodiesterase	NA	M1IEA0	Acanthocystis_turfacea_Chlorella_virus	28.3	6.4e-11
AZP95730.1|242178_243072_-|integrase	integrase	integrase	A0A1B1P773	Bacillus_phage	29.3	2.2e-20
AZP95731.1|243068_243743_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	32.9	1.6e-28
AZP95732.1|243923_244595_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
AZP95733.1|244641_245253_+	amino acid transporter	NA	NA	NA	NA	NA
AZP95734.1|245327_245900_+	hypothetical protein	NA	NA	NA	NA	NA
AZP95735.1|246078_247647_+	divalent metal cation transporter	NA	NA	NA	NA	NA
AZP95736.1|247662_248097_+	universal stress protein	NA	NA	NA	NA	NA
AZP95737.1|248298_249671_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.0	9.3e-47
249573:249725	attR	CTTAATACCATATTTTCTCGCTATTAATTTATAACCTAAGGGTGACGTTAGATAATCCTGAACAACTTTTATTTTTAATGTTTTAGAATATTTGGTCAATATAAAAACCCCCGATATTGGATTTTGGTCCAATATCGGGGGTTCACTTCATAA	NA	NA	NA	NA
>prophage 3
CP025476	Lactobacillus curvatus strain IRG2 chromosome, complete genome	1963257	459987	580444	1963257	bacteriocin,protease,transposase,tRNA,integrase,holin	Bacillus_phage(22.22%)	99	461442:461459	581603:581748
AZP95910.1|459987_461347_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.3	7.0e-47
461442:461459	attL	GGCTTACTGCGCACTCTA	NA	NA	NA	NA
AZP95911.1|461456_461885_-	hypothetical protein	NA	NA	NA	NA	NA
461442:461459	attL	GGCTTACTGCGCACTCTA	NA	NA	NA	NA
AZP95912.1|462303_463506_+	1,2-diacylglycerol 3-glucosyltransferase	NA	NA	NA	NA	NA
AZP95913.1|463586_464603_+	lysylphosphatidylglycerol synthetase family protein	NA	NA	NA	NA	NA
AZP95914.1|464615_465494_+	oxidoreductase	NA	A0A077SLF7	Escherichia_phage	29.0	7.8e-23
AZP95915.1|465565_465799_+	DUF1797 domain-containing protein	NA	NA	NA	NA	NA
AZP95916.1|466016_468074_+	glycerol phosphate lipoteichoic acid synthase	NA	W6LM83	Streptococcus_phage	47.8	9.0e-155
AZP95917.1|468211_468649_+	transcriptional repressor	NA	NA	NA	NA	NA
AZP95918.1|474401_475112_-	hypothetical protein	NA	NA	NA	NA	NA
AZP95919.1|475293_476493_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	68.6	1.4e-147
AZP95920.1|476590_478060_+	MFS transporter	NA	NA	NA	NA	NA
AZP95921.1|478094_479120_-	lactonase family protein	NA	NA	NA	NA	NA
AZP95922.1|479265_479658_+	PTS sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
AZP95923.1|479675_480821_+	AI-2E family transporter	NA	NA	NA	NA	NA
AZP95924.1|480867_481299_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZP95925.1|481469_482447_-	GMP reductase	NA	G3MBI2	Bacillus_virus	76.1	5.4e-142
AZP95926.1|482642_483599_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
AZP95927.1|483933_484767_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AZP95928.1|485020_485530_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
AZP95929.1|485542_485944_+	DUF1149 domain-containing protein	NA	NA	NA	NA	NA
AZP95930.1|486085_488434_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	46.4	9.8e-81
AZP95931.1|488649_489324_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	32.9	1.6e-28
AZP95932.1|489320_490214_+|integrase	integrase	integrase	A0A1B1P773	Bacillus_phage	29.3	2.2e-20
AZP95933.1|490385_491657_+	insulinase family protein	NA	NA	NA	NA	NA
AZP95934.1|491646_492957_+	insulinase family protein	NA	A0A2K9V7S4	Bandra_megavirus	25.6	4.3e-17
AZP95935.1|492949_493678_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AZP95936.1|493760_494684_+	DUF4115 domain-containing protein	NA	NA	NA	NA	NA
AZP95937.1|494706_495291_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
AZP95938.1|495482_496541_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	65.6	1.5e-121
AZP95939.1|496784_498347_+	ribonuclease Y	NA	NA	NA	NA	NA
AZP95940.1|499398_500496_+	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
AZP95941.1|500520_501183_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	43.5	3.3e-42
AZP95942.1|501239_502574_+	DNA/RNA helicase	NA	A0A1X9I5S6	Streptococcus_phage	39.4	2.7e-75
AZP95943.1|502573_503248_+	ComF family protein	NA	NA	NA	NA	NA
AZP95944.1|503373_503919_+	ribosomal subunit interface protein	NA	NA	NA	NA	NA
AZP95945.1|504147_506511_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
AZP95946.1|506582_507698_+	peptide chain release factor 2	NA	B5LLF2	Mycobacterium_phage	35.1	5.4e-05
AZP95947.1|507829_508516_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	33.5	9.7e-29
AZP95948.1|508481_509393_+	ABC transporter permease	NA	NA	NA	NA	NA
AZP95949.1|509464_510837_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.0	9.3e-47
AZP95950.1|511035_512172_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
AZP95951.1|512192_512906_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.7	9.4e-35
AZP95952.1|512892_514554_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	32.3	4.0e-28
AZP95953.1|514648_515509_+	phosphate ABC transporter substrate-binding protein	NA	R9S7J3	Prochlorococcus_phage	28.5	6.0e-12
AZP95954.1|515519_516443_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
AZP95955.1|516442_517327_+	phosphate ABC transporter, permease protein PstA	NA	NA	NA	NA	NA
AZP95956.1|517336_518146_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	26.9	2.2e-11
AZP95957.1|518166_518925_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.1	3.2e-17
AZP95958.1|518943_519621_+	phosphate transport system regulatory protein PhoU	NA	NA	NA	NA	NA
AZP95959.1|519695_520166_+	nucleoside 2-deoxyribosyltransferase	NA	NA	NA	NA	NA
AZP95960.1|520239_521133_-|integrase	integrase	integrase	A0A1B1P773	Bacillus_phage	29.3	1.3e-20
AZP95961.1|521129_521804_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	32.9	6.2e-28
AZP95962.1|522029_523484_+	hypothetical protein	NA	NA	NA	NA	NA
AZP95963.1|523511_523745_+	PspC domain-containing protein	NA	NA	NA	NA	NA
AZP95964.1|523744_524044_+	hypothetical protein	NA	NA	NA	NA	NA
AZP95965.1|524043_524397_+|holin	phage holin family protein	holin	NA	NA	NA	NA
AZP95966.1|524541_525483_+	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
AZP95967.1|525849_526683_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
525575:525592	attR	TAGAGTGCGCAGTAAGCC	NA	NA	NA	NA
AZP95968.1|526710_527739_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
525575:525592	attR	TAGAGTGCGCAGTAAGCC	NA	NA	NA	NA
AZP95969.1|527904_528261_+	hypothetical protein	NA	NA	NA	NA	NA
AZP95970.1|528348_529269_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	51.1	4.9e-84
AZP95971.1|529646_531371_+	phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	55.3	5.0e-183
AZP95972.1|531483_532116_+	HD domain-containing protein	NA	NA	NA	NA	NA
AZP95973.1|532532_534536_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
AZP95974.1|534548_537401_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	54.5	2.6e-301
AZP95975.1|537555_538092_+	hypothetical protein	NA	NA	NA	NA	NA
AZP95976.1|538293_539178_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.7	1.3e-09
AZP95977.1|539174_540209_+	hypothetical protein	NA	A1IMD5	Streptococcus_phage	54.5	1.5e-94
AZP95978.1|540211_541156_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.7	1.1e-51
AZP95979.1|541246_541702_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZP95980.1|541806_542325_-	thioredoxin	NA	NA	NA	NA	NA
AZP95981.1|542446_543031_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	53.9	5.3e-52
AZP95982.1|547262_548234_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AZP95983.1|548371_549325_+	nucleoside hydrolase	NA	NA	NA	NA	NA
AZP95984.1|549669_551076_+	hypothetical protein	NA	NA	NA	NA	NA
AZP95985.1|551173_554554_+	hypothetical protein	NA	NA	NA	NA	NA
AZP95986.1|555009_555651_+	NAD-dependent dehydratase	NA	NA	NA	NA	NA
AZP95987.1|555763_556285_+	hypothetical protein	NA	NA	NA	NA	NA
AZP95988.1|557427_558282_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZP95989.1|559421_560063_-	3-methyladenine DNA glycosylase	NA	NA	NA	NA	NA
AZP95990.1|560205_561078_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.4	4.4e-18
AZP95991.1|561824_562949_+	hypothetical protein	NA	NA	NA	NA	NA
AZP95992.1|564210_565842_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZP95993.1|566004_566412_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
AZP95994.1|566457_567087_-	glutathione S-transferase	NA	NA	NA	NA	NA
AZP95995.1|567230_567521_+	hypothetical protein	NA	NA	NA	NA	NA
AZP95996.1|567719_568067_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AZP95997.1|568197_569266_+|transposase	IS3-like element IS1163 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	33.2	1.4e-34
AZP95998.1|569379_569706_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AZP95999.1|570049_570382_-	hypothetical protein	NA	NA	NA	NA	NA
AZP96000.1|571675_572296_-	endonuclease III	NA	NA	NA	NA	NA
AZP96001.1|572343_572772_-	hypothetical protein	NA	NA	NA	NA	NA
AZP96002.1|572930_574286_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AZP96003.1|574523_576305_-	glycerophosphodiester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	23.6	2.0e-09
AZP96004.1|576564_576663_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AZP96005.1|576689_577619_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.4	1.8e-25
AZP96006.1|577764_578106_+	hypothetical protein	NA	A0A2H4JHE6	uncultured_Caudovirales_phage	40.7	6.1e-08
AZP96007.1|578186_579107_+|transposase	IS30 family transposase ISLsa1	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
AZP96008.1|579451_580444_+|integrase	site-specific integrase	integrase	Q6SEA7	Lactobacillus_prophage	33.1	6.7e-39
581603:581748	attR	TCCCAAATTGCAAGAACAAATTAGCCACACGGTAAATCCTATTAAATCAGTATTTTCATTAATATTCATATTTTATGGACTTAACTTAACCGGCGGAAGCAGCGGAGAAAAGCTCTTTGGGTGTTTGATAGCCAGTTTGCCGGCGC	NA	NA	NA	NA
>prophage 4
CP025476	Lactobacillus curvatus strain IRG2 chromosome, complete genome	1963257	630915	639213	1963257		Synechococcus_phage(33.33%)	8	NA	NA
AZP96055.1|630915_632214_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	31.8	3.6e-16
AZP96056.1|632324_633050_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FUQ7	Synechococcus_phage	40.1	2.1e-37
AZP96057.1|633042_633303_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AZP96058.1|633299_633974_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AZP96059.1|633970_636193_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.6	1.6e-149
AZP96060.1|636177_637620_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	5.5e-50
AZP96061.1|637616_638639_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.7	5.2e-63
AZP96062.1|638643_639213_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	4.6e-24
>prophage 5
CP025476	Lactobacillus curvatus strain IRG2 chromosome, complete genome	1963257	689975	730159	1963257	capsid,portal,protease,tRNA,tail,head,terminase	Lactobacillus_phage(76.0%)	50	NA	NA
AZP96115.1|689975_690716_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AZP96116.1|690836_691184_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AZP96117.1|691258_691447_+	hypothetical protein	NA	NA	NA	NA	NA
AZP96118.1|691443_691857_-	hypothetical protein	NA	NA	NA	NA	NA
AZP96119.1|691945_692305_-	hypothetical protein	NA	NA	NA	NA	NA
AZP96120.1|692468_692903_+	glyoxalase	NA	NA	NA	NA	NA
AZP96121.1|693308_694523_-	hypothetical protein	NA	Q6SEG4	Lactobacillus_prophage	33.6	6.5e-52
AZP96122.1|694634_696167_-	hypothetical protein	NA	NA	NA	NA	NA
AZP96123.1|696249_696651_-	ImmA/IrrE family metallo-endopeptidase	NA	D6PSS8	Lactobacillus_phage	38.6	5.5e-16
AZP96124.1|696656_696977_-	XRE family transcriptional regulator	NA	A0A1B0Y3N1	Lactobacillus_phage	50.0	1.5e-24
AZP96125.1|697231_697444_+	transcriptional regulator	NA	NA	NA	NA	NA
AZP96126.1|697602_697989_-	hypothetical protein	NA	D2KRD9	Lactobacillus_phage	43.2	2.0e-23
AZP96127.1|698026_698728_+	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	58.5	9.1e-67
AZP96128.1|698730_698916_+	hypothetical protein	NA	NA	NA	NA	NA
AZP96129.1|698912_699194_-	hypothetical protein	NA	A0A2H4JEH2	uncultured_Caudovirales_phage	45.2	1.7e-16
AZP96130.1|699319_699517_+	XRE family transcriptional regulator	NA	D2IZX1	Enterococcus_phage	62.9	8.6e-15
AZP96131.1|699519_699801_+	hypothetical protein	NA	NA	NA	NA	NA
AZP96132.1|699905_700112_+	hypothetical protein	NA	NA	NA	NA	NA
AZP96133.1|700194_700554_-	hypothetical protein	NA	NA	NA	NA	NA
AZP96134.1|700760_701030_+	hypothetical protein	NA	NA	NA	NA	NA
AZP96135.1|701032_701671_+	ERF superfamily protein	NA	NA	NA	NA	NA
AZP96136.1|701667_702354_+	hypothetical protein	NA	U5U4M2	Lactobacillus_phage	48.2	1.9e-56
AZP97310.1|703115_703856_+	DNA replication protein	NA	O03914	Lactobacillus_phage	53.6	1.7e-63
AZP96137.1|703964_704390_+	RusA family crossover junction endodeoxyribonuclease	NA	D6PSU4	Lactobacillus_phage	55.1	1.2e-34
AZP96138.1|704367_704589_+	hypothetical protein	NA	NA	NA	NA	NA
AZP96139.1|704601_705114_+	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	57.6	8.5e-46
AZP96140.1|705125_705458_+	hypothetical protein	NA	NA	NA	NA	NA
AZP96141.1|705460_705652_+	hypothetical protein	NA	NA	NA	NA	NA
AZP96142.1|706307_706739_+	transcriptional regulator	NA	O03925	Lactobacillus_phage	47.4	1.4e-30
AZP96143.1|707123_707645_+	hypothetical protein	NA	NA	NA	NA	NA
AZP96144.1|707628_707931_+	hypothetical protein	NA	NA	NA	NA	NA
AZP96145.1|708435_708747_+	hypothetical protein	NA	NA	NA	NA	NA
AZP96146.1|709131_709386_+	hypothetical protein	NA	NA	NA	NA	NA
AZP96147.1|710309_710756_+|terminase	terminase	terminase	E9LUH9	Lactobacillus_phage	69.8	1.3e-47
AZP97311.1|710770_712456_+	amino acid transporter	NA	Q8LTC3	Lactobacillus_phage	73.9	2.6e-248
AZP96148.1|712470_712674_+	hypothetical protein	NA	NA	NA	NA	NA
AZP96149.1|712680_713907_+|portal	phage portal protein	portal	D2KRA7	Lactobacillus_phage	59.6	1.3e-137
AZP96150.1|713863_714493_+|head,protease	HK97 family phage prohead protease	head,protease	B4XYP5	Lactobacillus_phage	54.6	1.1e-58
AZP96151.1|714541_715747_+|capsid	phage major capsid protein	capsid	A0A2D1GPG3	Lactobacillus_phage	52.3	9.1e-107
AZP96152.1|715866_716196_+	DNA-packaging protein	NA	D2KRB0	Lactobacillus_phage	59.0	3.0e-28
AZP97312.1|716197_716518_+|tail	phage tail protein	tail	E9LUI6	Lactobacillus_phage	50.0	1.4e-22
AZP96153.1|716514_716877_+	hypothetical protein	NA	B4XYP9	Lactobacillus_phage	35.2	5.1e-13
AZP96154.1|716869_717292_+	hypothetical protein	NA	E9LUI8	Lactobacillus_phage	38.2	3.3e-19
AZP96155.1|717278_717848_+|tail	phage tail protein	tail	M1PRQ7	Streptococcus_phage	50.8	2.5e-46
AZP96156.1|717938_718241_+	hypothetical protein	NA	NA	NA	NA	NA
AZP96157.1|718461_722793_+|tail	phage tail tape measure protein	tail	A0A2D1GPD5	Lactobacillus_phage	52.2	1.4e-202
AZP96158.1|722792_724244_+	hypothetical protein	NA	U5U775	Lactobacillus_phage	41.1	1.6e-25
AZP96159.1|724246_724432_+	hypothetical protein	NA	NA	NA	NA	NA
AZP96160.1|724412_725069_-	hypothetical protein	NA	NA	NA	NA	NA
AZP96161.1|725128_730159_+	hypothetical protein	NA	Q9AZL2	Lactococcus_phage	31.8	1.3e-93
>prophage 6
CP025476	Lactobacillus curvatus strain IRG2 chromosome, complete genome	1963257	907300	914939	1963257	tRNA	Staphylococcus_phage(33.33%)	7	NA	NA
AZP96330.1|907300_908158_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	41.5	6.6e-59
AZP96331.1|908305_909505_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A1B0V011	Roseobacter_phage	40.6	1.9e-32
AZP96332.1|909568_910030_+	hypothetical protein	NA	NA	NA	NA	NA
AZP96333.1|910172_912056_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.4	6.5e-51
AZP96334.1|912436_913387_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	65.9	4.1e-126
AZP96335.1|913402_913897_+	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	38.6	3.2e-26
AZP96336.1|914081_914939_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	41.9	3.9e-19
>prophage 7
CP025476	Lactobacillus curvatus strain IRG2 chromosome, complete genome	1963257	923914	978194	1963257	protease,transposase,tRNA,integrase	Bacillus_phage(15.79%)	47	953060:953088	984310:984338
AZP96347.1|923914_925225_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
AZP96348.1|925291_926197_+	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	28.4	6.3e-28
AZP96349.1|926680_927226_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
AZP97315.1|927246_928656_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IBU3	Erwinia_phage	24.9	3.3e-31
AZP96350.1|928679_929558_+	aldose epimerase	NA	NA	NA	NA	NA
AZP96351.1|929716_931399_+	acetolactate synthase AlsS	NA	NA	NA	NA	NA
AZP96352.1|931416_932136_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
AZP96353.1|932180_932975_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AZP96354.1|933132_933792_+	spermidine/putrescine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	8.7e-19
AZP96355.1|933775_934537_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
AZP96356.1|934576_935194_-	acyl-phosphate glycerol 3-phosphate acyltransferase	NA	NA	NA	NA	NA
AZP96357.1|935395_937408_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	41.4	2.0e-119
AZP96358.1|937426_939889_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.7	4.8e-94
AZP96359.1|940171_942433_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	40.4	6.4e-162
AZP96360.1|942537_943356_+	pyruvate formate lyase-activating protein	NA	NA	NA	NA	NA
AZP96361.1|943467_944433_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZP96362.1|944486_945410_+	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
AZP96363.1|945467_945818_+	hypothetical protein	NA	NA	NA	NA	NA
AZP96364.1|945866_947238_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.0	9.3e-47
AZP96365.1|947378_949172_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	28.2	6.4e-64
AZP96366.1|949283_949958_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	33.3	4.3e-29
AZP96367.1|949954_950848_+|integrase	integrase	integrase	A0A1B1P773	Bacillus_phage	29.3	2.2e-20
AZP96368.1|950936_951143_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
AZP96369.1|951303_952977_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
953060:953088	attL	TAAGCGCAGAAAGTTAGCTTGAAAAGCAC	NA	NA	NA	NA
AZP96370.1|953180_953636_+	signal peptidase II	NA	NA	NA	NA	NA
AZP96371.1|953628_954534_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.4	3.0e-09
AZP96372.1|954703_955246_+	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
AZP96373.1|955409_956717_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.2	7.2e-65
AZP96374.1|956703_957621_+	aspartate carbamoyltransferase catalytic subunit	NA	M1HGA5	Paramecium_bursaria_Chlorella_virus	34.3	3.8e-28
AZP96375.1|957635_958937_+	dihydroorotase	NA	NA	NA	NA	NA
AZP96376.1|959057_960134_+	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.6	3.4e-60
AZP96377.1|960152_963335_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
AZP96378.1|963407_964196_+	dihydroorotate dehydrogenase electron transfer subunit	NA	NA	NA	NA	NA
AZP96379.1|964195_965122_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AZP96380.1|965114_965834_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
AZP96381.1|965830_966469_+	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	36.0	7.4e-31
AZP96382.1|966580_968296_-	DUF814 domain-containing protein	NA	M1I4X7	Acanthocystis_turfacea_Chlorella_virus	36.8	1.9e-09
AZP96383.1|968447_968870_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZP96384.1|968969_969839_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.8	9.4e-13
AZP96385.1|969881_970400_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
AZP96386.1|970554_971199_+	hemolysin III	NA	NA	NA	NA	NA
AZP96387.1|971219_972062_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	37.4	1.2e-15
AZP96388.1|972192_972774_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZP96389.1|972775_973786_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
AZP96390.1|975274_976336_+	tyrosine recombinase XerS	NA	NA	NA	NA	NA
AZP96391.1|976623_977226_+	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
AZP96392.1|977300_978194_-|integrase	integrase	integrase	A0A1B1P773	Bacillus_phage	29.3	2.2e-20
984310:984338	attR	TAAGCGCAGAAAGTTAGCTTGAAAAGCAC	NA	NA	NA	NA
>prophage 8
CP025476	Lactobacillus curvatus strain IRG2 chromosome, complete genome	1963257	1166756	1174284	1963257	transposase	Leuconostoc_phage(16.67%)	7	NA	NA
AZP96570.1|1166756_1167137_-	hypothetical protein	NA	E3W8I0	Leuconostoc_phage	29.5	3.7e-06
AZP97324.1|1167129_1168395_-	excinuclease ABC subunit A	NA	M1Q231	Streptococcus_phage	39.0	1.5e-80
AZP96571.1|1168426_1168696_-	hypothetical protein	NA	NA	NA	NA	NA
AZP96572.1|1168834_1169443_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A249XZV3	Enterococcus_phage	49.2	4.6e-22
AZP96573.1|1169668_1171702_-	potassium transporter Kup	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	35.6	2.2e-68
AZP96574.1|1172155_1172635_+	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	37.5	6.5e-16
AZP96575.1|1173363_1174284_+|transposase	IS30 family transposase ISLsa1	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
>prophage 9
CP025476	Lactobacillus curvatus strain IRG2 chromosome, complete genome	1963257	1227366	1296568	1963257	protease,transposase,tRNA,integrase	Bacillus_phage(35.29%)	59	1223829:1223845	1297858:1297874
1223829:1223845	attL	TGTTTCTGGCATTTCTG	NA	NA	NA	NA
AZP96626.1|1227366_1228284_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
AZP96627.1|1228452_1229382_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.4	2.3e-25
AZP96628.1|1229408_1229528_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AZP96629.1|1230428_1230947_-	hypothetical protein	NA	NA	NA	NA	NA
AZP96630.1|1232324_1232681_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
AZP96631.1|1232703_1235490_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	24.2	6.7e-20
AZP96632.1|1235507_1235813_-	hypothetical protein	NA	NA	NA	NA	NA
AZP96633.1|1235809_1236112_-	DUF448 domain-containing protein	NA	NA	NA	NA	NA
AZP96634.1|1236123_1237296_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
AZP96635.1|1237314_1237788_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
AZP96636.1|1237929_1238940_-	lactate dehydrogenase	NA	M1HMI7	Paramecium_bursaria_Chlorella_virus	31.7	6.4e-37
AZP96637.1|1238955_1239996_-	malate permease	NA	NA	NA	NA	NA
AZP96638.1|1240201_1240552_+	DUF2200 domain-containing protein	NA	NA	NA	NA	NA
AZP96639.1|1240788_1241754_-	restriction endonuclease	NA	NA	NA	NA	NA
AZP96640.1|1241800_1243834_-|protease	BREX system Lon protease-like protein BrxL	protease	NA	NA	NA	NA
AZP96641.1|1243846_1246384_-	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
AZP96642.1|1246398_1247334_-	hypothetical protein	NA	NA	NA	NA	NA
AZP96643.1|1247460_1248396_+|integrase	site-specific integrase	integrase	Q5YAA6	Bacillus_phage	40.7	1.8e-54
AZP96644.1|1248433_1249750_+	hypothetical protein	NA	NA	NA	NA	NA
AZP96645.1|1249733_1250803_-|transposase	IS3-like element IS1163 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	33.2	1.4e-34
AZP96646.1|1251226_1253887_-	restriction endonuclease	NA	NA	NA	NA	NA
AZP96647.1|1253904_1257564_-	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
AZP96648.1|1257576_1258164_-	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
AZP96649.1|1258164_1258770_-	DUF1819 domain-containing protein	NA	NA	NA	NA	NA
AZP96650.1|1259212_1263553_-	PolC-type DNA polymerase III	NA	A0A0A8WJ41	Clostridium_phage	38.1	1.7e-17
AZP96651.1|1263765_1265487_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AZP96652.1|1265512_1266784_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
AZP96653.1|1267171_1267960_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AZP96654.1|1267974_1268727_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.6	5.1e-23
AZP96655.1|1269040_1271788_+	phage infection protein	NA	NA	NA	NA	NA
AZP96656.1|1271841_1272399_-	ribosome recycling factor	NA	NA	NA	NA	NA
AZP96657.1|1272400_1273126_-	UMP kinase	NA	NA	NA	NA	NA
AZP96658.1|1273262_1274138_-	elongation factor Ts	NA	NA	NA	NA	NA
AZP96659.1|1274244_1275039_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
AZP96660.1|1275200_1275740_-	ribosomal protein acetylating enzyme	NA	NA	NA	NA	NA
AZP96661.1|1275755_1276031_-	hypothetical protein	NA	W8W2G4	Invertebrate_iridovirus	35.9	6.0e-06
AZP96662.1|1276023_1276767_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
AZP96663.1|1276871_1277495_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AZP96664.1|1277534_1277777_-	hypothetical protein	NA	NA	NA	NA	NA
AZP96665.1|1277801_1278890_-	Mg(2+) transport ATPase, P-type	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	27.7	1.5e-20
AZP96666.1|1278893_1279493_-	hypothetical protein	NA	NA	NA	NA	NA
AZP96667.1|1279520_1280096_-	hypothetical protein	NA	NA	NA	NA	NA
AZP96668.1|1280378_1281311_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZP96669.1|1281370_1283161_-	multidrug ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	23.4	3.1e-18
AZP96670.1|1283162_1284908_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.9	6.9e-47
AZP96671.1|1285064_1285292_-	hypothetical protein	NA	NA	NA	NA	NA
AZP96672.1|1285372_1285615_-	DUF896 family protein	NA	NA	NA	NA	NA
AZP96673.1|1285750_1286365_+	transcriptional repressor LexA	NA	A0A1B1P7Q3	Bacillus_phage	57.4	1.3e-16
AZP96674.1|1286705_1287224_-	adenine phosphoribosyltransferase	NA	A0A2K9L2N8	Tupanvirus	31.1	2.8e-12
AZP96675.1|1287258_1289553_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.3	8.7e-74
AZP96676.1|1289705_1290701_+	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	34.9	8.2e-45
AZP96677.1|1290810_1291176_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
AZP96678.1|1291191_1291518_+	hypothetical protein	NA	M4STD1	Rhodobacter_phage	35.6	2.4e-06
AZP96679.1|1291597_1291849_-	hypothetical protein	NA	NA	NA	NA	NA
AZP96680.1|1291870_1292578_-	hypothetical protein	NA	NA	NA	NA	NA
AZP96681.1|1292606_1293206_-	cell surface protein	NA	NA	NA	NA	NA
AZP96682.1|1293353_1293863_-	DinB family protein	NA	NA	NA	NA	NA
AZP96683.1|1294054_1294966_+	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
AZP96684.1|1295195_1296568_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.0	7.1e-47
1297858:1297874	attR	TGTTTCTGGCATTTCTG	NA	NA	NA	NA
>prophage 10
CP025476	Lactobacillus curvatus strain IRG2 chromosome, complete genome	1963257	1500062	1507787	1963257	transposase	Bacillus_phage(50.0%)	9	NA	NA
AZP96878.1|1500062_1501131_+|transposase	IS3-like element IS1163 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	33.2	1.4e-34
AZP96879.1|1501115_1501454_-	hypothetical protein	NA	NA	NA	NA	NA
AZP96880.1|1501499_1502333_-	DDE domain-containing protein	NA	A0A1P8CWQ3	Bacillus_phage	48.3	2.1e-65
AZP96881.1|1502368_1502626_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	47.1	1.0e-15
AZP96882.1|1502808_1503888_-	hypothetical protein	NA	NA	NA	NA	NA
AZP96883.1|1503936_1504905_-	glycosyltransferase family 2 protein	NA	K7Z8A5	Megavirus	38.5	5.4e-09
AZP96884.1|1504941_1506072_-	glycosyl transferase	NA	NA	NA	NA	NA
AZP96885.1|1506639_1507530_-	hypothetical protein	NA	Q6J1X2	Lactobacillus_phage	98.2	8.7e-155
AZP96886.1|1507535_1507787_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
>prophage 11
CP025476	Lactobacillus curvatus strain IRG2 chromosome, complete genome	1963257	1583429	1636995	1963257	protease,transposase,tRNA	Bacillus_phage(17.65%)	41	NA	NA
AZP96962.1|1583429_1583687_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	47.1	1.0e-15
AZP96963.1|1583722_1584556_+	DDE domain-containing protein	NA	A0A1P8CWQ3	Bacillus_phage	48.3	2.1e-65
AZP96964.1|1584667_1586185_+	hypothetical protein	NA	NA	NA	NA	NA
AZP96965.1|1587661_1588582_+|transposase	IS30 family transposase ISLsa1	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
AZP96966.1|1588929_1589361_-	hypothetical protein	NA	NA	NA	NA	NA
AZP96967.1|1589472_1590541_+|transposase	IS3-like element IS1163 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	33.2	1.4e-34
AZP96968.1|1590698_1591400_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZP96969.1|1591418_1592558_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AZP96970.1|1592825_1594076_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	59.6	4.8e-111
AZP96971.1|1594437_1595352_+	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AZP96972.1|1595418_1596222_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	37.4	1.2e-35
AZP96973.1|1596601_1598062_-	peptide ABC transporter permease	NA	A0A0P0IY73	Acinetobacter_phage	36.3	1.6e-81
AZP97332.1|1598496_1598979_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AZP97333.1|1604849_1606334_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	38.7	9.3e-85
AZP96974.1|1606436_1607423_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AZP96975.1|1607511_1608390_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
AZP96976.1|1608463_1610560_-	cell division protein FtsH	NA	A9YVR1	Ostreococcus_tauri_virus	49.2	2.7e-106
AZP96977.1|1610648_1611194_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	28.8	1.6e-10
AZP96978.1|1611216_1612587_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	R4TVK3	Phaeocystis_globosa_virus	27.2	3.9e-13
AZP96979.1|1612682_1613123_-	RNA-binding protein S1	NA	NA	NA	NA	NA
AZP96980.1|1613254_1613641_-	septum formation initiator family protein	NA	NA	NA	NA	NA
AZP96981.1|1613796_1614063_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
AZP96982.1|1614062_1615655_-	sugar transporter	NA	NA	NA	NA	NA
AZP96983.1|1615677_1619202_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
AZP96984.1|1619503_1620061_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AZP96985.1|1620290_1621268_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
AZP96986.1|1621476_1622856_+	hypothetical protein	NA	NA	NA	NA	NA
AZP96987.1|1623130_1623808_+	CBS domain-containing protein	NA	NA	NA	NA	NA
AZP96988.1|1623851_1624379_-	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	29.9	2.6e-05
AZP96989.1|1624541_1624907_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A1S5RCS0	Lactobacillus_phage	34.5	3.7e-11
AZP96990.1|1624928_1625189_-	hypothetical protein	NA	NA	NA	NA	NA
AZP96991.1|1625266_1626409_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	30.2	2.8e-33
AZP96992.1|1626413_1626767_-	holo-ACP synthase	NA	NA	NA	NA	NA
AZP96993.1|1626902_1628510_-	ATP-dependent helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	40.7	2.5e-67
AZP96994.1|1628724_1630104_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
AZP96995.1|1630226_1631465_-	DUF3114 domain-containing protein	NA	NA	NA	NA	NA
AZP96996.1|1631592_1632492_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
AZP96997.1|1632505_1633069_-	hypothetical protein	NA	A0A1X9IGG1	Lactococcus_phage	27.8	4.4e-11
AZP96998.1|1633214_1633949_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
AZP96999.1|1633975_1635217_+	MFS transporter	NA	NA	NA	NA	NA
AZP97000.1|1636074_1636995_+|transposase	IS30 family transposase ISLsa1	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
>prophage 12
CP025476	Lactobacillus curvatus strain IRG2 chromosome, complete genome	1963257	1817786	1889939	1963257	protease,transposase,tRNA,integrase	Streptococcus_phage(16.67%)	51	1882076:1882135	1890183:1891484
AZP97175.1|1817786_1820252_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpC	protease	A0A0A8J958	Klebsiella_phage	39.1	1.2e-126
AZP97176.1|1820269_1820740_-	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
AZP97177.1|1827476_1828142_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AZP97178.1|1828162_1828711_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
AZP97179.1|1828723_1828945_-	copper chaperone	NA	NA	NA	NA	NA
AZP97180.1|1829021_1830884_-	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.9	4.3e-95
AZP97181.1|1831028_1832426_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	28.6	9.7e-44
AZP97182.1|1832578_1833850_+	PTS system, cellobiose-specific IIC component	NA	NA	NA	NA	NA
AZP97183.1|1833907_1834627_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZP97184.1|1834678_1837579_-	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
AZP97185.1|1837797_1839078_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.5	9.7e-91
AZP97186.1|1839374_1839770_-	hypothetical protein	NA	NA	NA	NA	NA
AZP97187.1|1839785_1840130_-	hypothetical protein	NA	NA	NA	NA	NA
AZP97188.1|1840175_1841072_-	hypothetical protein	NA	NA	NA	NA	NA
AZP97189.1|1841332_1842583_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	59.6	4.8e-111
AZP97190.1|1842903_1843572_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	50.7	9.7e-58
AZP97191.1|1843617_1845195_-	hypothetical protein	NA	NA	NA	NA	NA
AZP97192.1|1845384_1845756_-	hypothetical protein	NA	NA	NA	NA	NA
AZP97193.1|1845770_1846307_-	hypothetical protein	NA	NA	NA	NA	NA
AZP97194.1|1846471_1847887_+	hypothetical protein	NA	NA	NA	NA	NA
AZP97195.1|1847956_1849387_-	amino acid permease	NA	NA	NA	NA	NA
AZP97196.1|1849735_1850794_-	hypothetical protein	NA	NA	NA	NA	NA
AZP97197.1|1850815_1853044_-	hypothetical protein	NA	NA	NA	NA	NA
AZP97198.1|1853144_1853735_-	hypothetical protein	NA	NA	NA	NA	NA
AZP97199.1|1854097_1854613_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AZP97200.1|1854643_1855180_-	hypothetical protein	NA	NA	NA	NA	NA
AZP97201.1|1855270_1855795_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZP97202.1|1855962_1856247_+	hypothetical protein	NA	NA	NA	NA	NA
AZP97203.1|1856707_1858081_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
AZP97204.1|1858123_1858717_-	hypothetical protein	NA	M1Q152	Streptococcus_phage	42.4	4.9e-37
AZP97205.1|1858806_1860543_-	pyruvate oxidase	NA	NA	NA	NA	NA
AZP97206.1|1860737_1861694_+	peroxidase	NA	S4VXK8	Pandoravirus	29.5	3.7e-18
AZP97207.1|1862112_1863066_+	NADPH:quinone reductase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	25.5	3.1e-09
AZP97208.1|1863277_1864207_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.1	6.7e-25
AZP97209.1|1864468_1864972_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
AZP97210.1|1865052_1866201_-	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.6	1.6e-15
AZP97211.1|1870196_1870484_+	hypothetical protein	NA	NA	NA	NA	NA
AZP97212.1|1870690_1871203_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AZP97213.1|1871199_1872051_-	acetylxylan esterase	NA	NA	NA	NA	NA
AZP97214.1|1872146_1875026_-	DUF3427 domain-containing protein	NA	Q9T1H9	Lactobacillus_phage	26.8	9.1e-28
AZP97215.1|1875035_1875446_-	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
AZP97216.1|1875774_1876843_+|transposase	IS3-like element IS1163 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	33.2	1.4e-34
AZP97217.1|1876905_1877232_+	hypothetical protein	NA	NA	NA	NA	NA
AZP97218.1|1877664_1878972_-	hypothetical protein	NA	NA	NA	NA	NA
AZP97219.1|1879170_1880724_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	5.8e-21
AZP97220.1|1880885_1881815_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	38.0	1.5e-32
1882076:1882135	attL	GGCTCCTATGTCAAGAATCCGGACATAAAAGTACGAACAAATTTGACTTTCAATTTAAAT	NA	NA	NA	NA
AZP97221.1|1883453_1885721_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	30.9	2.5e-126
AZP97222.1|1886130_1886721_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	33.1	9.2e-20
AZP97223.1|1887363_1887831_+	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
AZP97224.1|1888175_1888703_-	HTH domain-containing protein	NA	NA	NA	NA	NA
AZP97225.1|1888870_1889939_+|transposase	IS3-like element IS1163 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	33.2	6.3e-35
1890183:1891484	attR	GGCTCCTATGTCAAGAATCCGGACATAAAAGTACGAACAAATTTGACTTTCAATTTAAATTACTTAATTTAATTTTCGGTGGCCGAAGTTTTAGCCCCGTTCAGATTTTAAAAACGCTTTAGAGTATATTAAATAAGCCCCAACATTATTGAATTTAATAGCCTGTAGCTACGCTACAAGTGAAATACGATCACTGTTATACCAACGAATATAGTTATCAATTCCGGCGATTGCTTCATGAATTGTCTTAAAATCTTGGAAATTAACGTATTCACGTTTCAAAATTGAATGAAAACTTTCAATTCGCGCGTTATCGCCGGGCTGACCCTTTCGGGAGTAAGAATGCTTGATACCATACTTCGATAAAGTGTTTTCAAATAAGTCACTTGTGTATTGGCTTCCCATATCACTATGAATAATTTATGGTTTAACTGCTTGCGCCATGACTTGGGTAATAACGTTAGTCGCTAGTTCTTTAGTCATCTGCGTATTAAGTTGGTAAGCAATAACCCGTCGGGTTACTGGATTATAGACACTAGCTAGGTAACACCAAGTATGGTTAAGGGGAATGTACGTAATATCAGTCAATAAAATACCAGATTGATCAGTTAACTGCTTAATCAAGTTTGGTCGCTGATCATAATCAGTCTGAGTGGTTGGCTTATTGATTCGTTTAACCATTCTAGATCTAATCCCTAATTCACACATTTGTTGATAGACCAGACGCTGACTAACGTGAATATCAGACTGTTGATTTAGTAAGATCGTTAATCGTGGGTAGCCATACATTGGATATCTTAACCAAGCCGTTAACACTTCTTGTTTAATTAAATGCCGGCGGCGTTCAGTTCTACTTGGCTGCCAATGTAGATAATCATAGTAGGTTGAGCGCGGAATTTTGAGTACTGATAAGATACGCGTAATGCGGTGCCCAGCAAGTAAATTAGCGTTGACGACTTCTAACACGAGGGCACGCCCTTTAATAATTAGCTTTTTGCCATGAGCACCGCCGCTCGTTTTAAAATATCAAGTTCTTCTTTTAACCGTTTATTTTCTTTAATCAGAGCACGTTCATTTGATGATAGCACTTTAGTGTTGTTAGGATCAGCTTGTTTAATCCACTTAGTGACCGTTGAAACACTGACGTTGTATTCTTTAGCCAGTGAGTTGGCCGAACGGCCAGTCTGACTTAAGCTAACAATCGATTCTTTAAATTCATTTGAATATTTAATTGCCATAATAAAAAGCTCCTTTATGATGTATTATATCGAACAGTTTGTCCGTAATTCCATCATAGGAGCC	NA	NA	NA	NA
