The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
AP018802	Escherichia coli E2863 DNA, complete genome	5357442	324588	364894	5357442	integrase,transposase,holin	Escherichia_phage(21.05%)	44	327127:327143	348214:348230
BBF51826.1|324588_325644_-	outer membrane phosphoporin protein E	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
BBF51827.1|325931_327035_+	gamma-glutamate kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
BBF51828.1|327046_328300_+	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
327127:327143	attL	GCTGGAAAAAATCGCCG	NA	NA	NA	NA
BBF51829.1|328655_329870_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	56.5	7.5e-133
BBF51830.1|329933_330893_+	hypothetical protein	NA	NA	NA	NA	NA
BBF51831.1|331090_331288_+	putative phage protein	NA	A0A1V0E8E5	Vibrio_phage	48.1	1.7e-07
BBF51832.1|331287_331719_+	putative phage protein	NA	A0A1W6JPH9	Morganella_phage	49.0	5.1e-28
BBF51833.1|331731_332565_+	phage antirepressor	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
BBF51834.1|332686_333097_+	hypothetical protein	NA	G5DES5	Salmonella_phage	41.9	2.1e-26
BBF51835.1|333162_334101_+	hypothetical protein	NA	NA	NA	NA	NA
BBF51836.1|334190_335009_+	hypothetical protein	NA	A0A2C9CX26	Yersinia_phage	39.0	4.7e-46
BBF51837.1|335100_335586_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	2.0e-12
BBF51838.1|335601_336078_+	DNA repair protein	NA	NA	NA	NA	NA
BBF51839.1|336146_336368_+	hypothetical protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.1e-10
BBF51840.1|336463_336856_+	antitoxin of toxin-antitoxin system	NA	NA	NA	NA	NA
BBF51841.1|337250_338138_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF51842.1|338244_338463_-|transposase	IS629 transposase	transposase	B6ETC4	Enterobacteria_phage	100.0	2.0e-28
BBF51843.1|338963_340034_+	DNA methylase	NA	A0A1B1IRZ3	uncultured_Mediterranean_phage	29.6	2.6e-20
BBF51844.1|340012_340672_-	hypothetical protein	NA	NA	NA	NA	NA
BBF51845.1|341218_341578_+	hypothetical protein	NA	NA	NA	NA	NA
BBF51846.1|341570_342113_-	hypothetical protein	NA	NA	NA	NA	NA
BBF51847.1|342233_342419_-	hypothetical protein	NA	NA	NA	NA	NA
BBF51848.1|342714_342996_-	transcriptional regulator PchE	NA	NA	NA	NA	NA
BBF51849.1|343227_343419_-	hypothetical protein	NA	NA	NA	NA	NA
BBF51850.1|343670_343856_+	putative phage protein	NA	NA	NA	NA	NA
BBF51851.1|344434_344536_-	hypothetical protein	NA	NA	NA	NA	NA
BBF51852.1|344489_344861_-	hypothetical protein	NA	NA	NA	NA	NA
BBF51853.1|345572_345713_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
BBF51854.1|345712_345979_-	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
BBF51855.1|346339_346441_-	hypothetical protein	NA	NA	NA	NA	NA
BBF51856.1|347555_349070_+	invasin	NA	NA	NA	NA	NA
348214:348230	attR	GCTGGAAAAAATCGCCG	NA	NA	NA	NA
BBF51857.1|349098_351804_+	invasin	NA	NA	NA	NA	NA
BBF51858.1|351924_352782_-	transcriptional regulator	NA	NA	NA	NA	NA
BBF51859.1|353030_353900_+	reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.4	1.3e-51
BBF51860.1|354059_354653_-	reactive chlorine species stress resistance inner membrane protein	NA	NA	NA	NA	NA
BBF51861.1|354733_355060_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF51862.1|355059_355947_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF51863.1|356322_357648_-	pyridine nucleotide-dependent disulfide oxidoreductase of reactive chlorine stress species resistance	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
BBF51864.1|357873_358728_+	reactive chlorine species-specific activator of the rcl genes	NA	NA	NA	NA	NA
BBF51865.1|359254_359974_+	cysteine-rich LutA family protein	NA	NA	NA	NA	NA
BBF51866.1|359984_361412_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
BBF51867.1|361404_362100_+	hypothetical protein	NA	NA	NA	NA	NA
BBF51868.1|362345_363011_-	inner membrane protein	NA	NA	NA	NA	NA
BBF51869.1|363223_364894_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	2.3e-60
>prophage 2
AP018802	Escherichia coli E2863 DNA, complete genome	5357442	483965	537066	5357442	transposase,tRNA,protease	Bacillus_phage(30.0%)	48	NA	NA
BBF51979.1|483965_485414_+|tRNA	tRNA s(4)U8 sulfurtransferase	tRNA	NA	NA	NA	NA
BBF51980.1|485467_486058_-	oxidative stress resistance chaperone	NA	NA	NA	NA	NA
BBF51981.1|486020_486932_-	2-dehydropantoate reductase	NA	NA	NA	NA	NA
BBF51982.1|487099_487591_+	nucleotide binding protein	NA	NA	NA	NA	NA
BBF51983.1|487718_489083_-	transporter	NA	NA	NA	NA	NA
BBF51984.1|489454_490426_+	hypothetical protein	NA	NA	NA	NA	NA
BBF51985.1|490481_491024_-	acetyltransferase	NA	NA	NA	NA	NA
BBF51986.1|491007_491319_-	toxin-antitoxin system antitoxin component	NA	NA	NA	NA	NA
BBF51987.1|491503_492394_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
BBF51988.1|492405_492735_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
BBF51989.1|492734_493349_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
BBF51990.1|493338_495330_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
BBF51991.1|495351_496299_-	cytochrome o ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
BBF51992.1|496758_498234_-	muropeptide transporter	NA	NA	NA	NA	NA
BBF51993.1|498277_498856_-	lipoprotein	NA	NA	NA	NA	NA
BBF51994.1|499163_499478_+	transcriptional regulator BolA	NA	NA	NA	NA	NA
BBF51995.1|499821_501120_+	peptidyl-prolyl cis/trans isomerase	NA	NA	NA	NA	NA
BBF51996.1|501365_501989_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
BBF51997.1|502114_503389_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
BBF51998.1|503576_505931_+|protease	lon protease	protease	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
BBF51999.1|506139_506412_+	transcriptional regulator HU subunit beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
BBF52000.1|506603_508475_+	peptidyl-prolyl cis-trans isomerase D	NA	NA	NA	NA	NA
BBF52001.1|508625_508997_+	competence-suppressing periplasmic helix-hairpin-helix DNA-binding protein	NA	NA	NA	NA	NA
BBF52002.1|509090_509489_+	long-chain acyl-CoA thioesterase III	NA	NA	NA	NA	NA
BBF52003.1|509540_510236_-	7-cyano-7-deazaguanine synthase	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.6	5.5e-88
BBF52004.1|510300_512001_-	ABC transporter periplasmic binding protein	NA	NA	NA	NA	NA
BBF52005.1|512100_512919_+	thiamine pyrimidine pyrophosphate hydrolase	NA	NA	NA	NA	NA
BBF52006.1|513071_513530_+	transcriptional regulator	NA	NA	NA	NA	NA
BBF52007.1|513559_515332_+	multidrug ABC transporter ATPase	NA	W8CYL7	Bacillus_phage	30.1	3.4e-49
BBF52008.1|515324_517106_+	multidrug ABC transporter ATPase	NA	W8CYL7	Bacillus_phage	27.1	1.4e-42
BBF52009.1|517286_517625_+	nitrogen regulatory protein P-II 2	NA	NA	NA	NA	NA
BBF52010.1|517654_518941_+	ammonium transporter	NA	NA	NA	NA	NA
BBF52011.1|518988_519849_-	acyl-CoA thioesterase 2	NA	NA	NA	NA	NA
BBF52012.1|520066_520639_+	outer membrane lipoprotein	NA	NA	NA	NA	NA
BBF52013.1|520669_520981_-	6-O-methylguanine DNA methyltransferase	NA	NA	NA	NA	NA
BBF52014.1|521359_521713_+	hypothetical protein	NA	NA	NA	NA	NA
BBF52015.1|521754_523305_-	membrane-anchored cyclic-di-GMP phosphodiesterase	NA	NA	NA	NA	NA
BBF52016.1|523468_523939_-	hypothetical protein	NA	NA	NA	NA	NA
BBF52017.1|524054_524606_-	maltose O-acetyltransferase	NA	NA	NA	NA	NA
BBF52018.1|524777_524996_-	modulator of gene expression with H-NS	NA	NA	NA	NA	NA
BBF52019.1|525021_525396_-	Hha toxicity attenuator TomB	NA	NA	NA	NA	NA
BBF52020.1|525941_529091_-	multidrug efflux system protein	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
BBF52021.1|529113_530307_-	multidrug efflux system	NA	NA	NA	NA	NA
BBF52022.1|530448_531096_+	transcriptional repressor	NA	NA	NA	NA	NA
BBF52023.1|531223_534586_+	mechanosensitive channel protein	NA	NA	NA	NA	NA
BBF52024.1|535022_535334_+|transposase	IS602 transposase	transposase	Q716C1	Shigella_phage	40.8	2.4e-11
BBF52025.1|535453_536200_+|transposase	IS602 transposase	transposase	Q716C2	Shigella_phage	59.0	4.3e-83
BBF52026.1|536169_537066_-|transposase	IS621 transposase	transposase	NA	NA	NA	NA
>prophage 3
AP018802	Escherichia coli E2863 DNA, complete genome	5357442	553830	623457	5357442	transposase,protease,tRNA,tail,head,capsid	Escherichia_phage(29.17%)	69	NA	NA
BBF52042.1|553830_554310_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase	tRNA	NA	NA	NA	NA
BBF52043.1|554513_555308_-	hypothetical protein	NA	NA	NA	NA	NA
BBF52044.1|555391_555787_+	transcriptional regulator	NA	A0A222YWD7	Escherichia_phage	74.5	3.1e-40
BBF52045.1|555900_558405_-	copper transporter	NA	A0A218MNH6	uncultured_virus	38.4	3.8e-115
BBF52046.1|558666_559599_+	glutaminase 1	NA	NA	NA	NA	NA
BBF52047.1|559601_560894_+	amino acid transporter	NA	NA	NA	NA	NA
BBF52048.1|561018_561426_+	copper-responsive regulon transcriptional regulator	NA	NA	NA	NA	NA
BBF52049.1|561426_561882_-	membrane protein	NA	NA	NA	NA	NA
BBF52050.1|561881_562799_-|protease	protease	protease	NA	NA	NA	NA
BBF52051.1|562944_563622_+	iron export ABC transporter ATPase	NA	G3M9Y6	Bacillus_virus	33.8	3.1e-27
BBF52052.1|563608_564391_+	iron export ABC transporter permease	NA	NA	NA	NA	NA
BBF52053.1|564453_565308_-	thioredoxin	NA	NA	NA	NA	NA
BBF52054.1|565368_566178_-	oxidoreductase	NA	NA	NA	NA	NA
BBF52055.1|566167_566761_-	acyl-CoA thioesterase I	NA	NA	NA	NA	NA
BBF52056.1|566761_567448_+	ABC transporter ATPase	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
BBF52057.1|567444_568314_+	ABC transporter permease	NA	NA	NA	NA	NA
BBF52058.1|568331_569858_+	ABC transporter permease	NA	NA	NA	NA	NA
BBF52059.1|570286_574057_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	31.0	1.9e-17
BBF52060.1|574479_574740_+	hypothetical protein	NA	NA	NA	NA	NA
BBF52061.1|575484_575856_-	transcriptional regulator	NA	A0A077SLK2	Escherichia_phage	75.4	3.1e-50
BBF52062.1|575971_577066_-|tRNA	tRNA 2-selenouridine synthase	tRNA	NA	NA	NA	NA
BBF52063.1|577134_578061_-	allD operon transcriptional activator	NA	NA	NA	NA	NA
BBF52064.1|578290_578773_+	ureidoglycolate hydrolase	NA	NA	NA	NA	NA
BBF52065.1|578850_579666_+	glyoxylate-inducible transcriptional repressor of all and gcl operons	NA	NA	NA	NA	NA
BBF52066.1|579755_581537_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	7.8e-38
BBF52067.1|581549_582326_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
BBF52068.1|582425_583304_+	tartronate semialdehyde reductase	NA	NA	NA	NA	NA
BBF52069.1|583472_584927_+	allantoin transporter	NA	NA	NA	NA	NA
BBF52070.1|584986_586348_+	allantoinase	NA	NA	NA	NA	NA
BBF52071.1|586404_587706_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
BBF52072.1|587727_588873_+	glycerate kinase II	NA	W6LM47	Streptococcus_phage	41.9	1.1e-48
BBF52073.1|589001_589787_-	hypothetical protein	NA	NA	NA	NA	NA
BBF52074.1|589797_591033_-	allantoate amidohydrolase	NA	NA	NA	NA	NA
BBF52075.1|591054_592104_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
BBF52076.1|592420_594088_+	NAD(P)-binding acyl-CoA synthetase	NA	NA	NA	NA	NA
BBF52077.1|594097_595357_+	hypothetical protein	NA	NA	NA	NA	NA
BBF52078.1|595367_596183_+	anaerobic allantoin catabolic oxamate carbamoyltransferase	NA	NA	NA	NA	NA
BBF52079.1|596179_597073_+	carbonate kinase	NA	NA	NA	NA	NA
BBF52080.1|597209_598277_-	N5-carboxyaminoimidazole ribonucleotide synthase	NA	NA	NA	NA	NA
BBF52081.1|598273_598783_-	N5-carboxyaminoimidazole ribonucleotide mutase	NA	NA	NA	NA	NA
BBF52082.1|598900_599623_-	UDP-2,3-diacylglucosamine pyrophosphohydrolase	NA	NA	NA	NA	NA
BBF52083.1|599625_600120_-	peptidyl-prolyl cis-trans isomerase B	NA	NA	NA	NA	NA
BBF52084.1|600293_601679_+|tRNA	cysteinyl-tRNA synthetase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
BBF52085.1|601714_602236_-	inner membrane protein	NA	NA	NA	NA	NA
BBF52086.1|602343_602556_-	ribosome-associated protein	NA	NA	NA	NA	NA
BBF52087.1|602557_603424_-	5,10-methylene-tetrahydrofolate dehydrogenase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
BBF52088.1|603904_604447_+	type-1 fimbrial protein subunit A	NA	NA	NA	NA	NA
BBF52089.1|604666_605359_+	periplasmic pilus chaperone	NA	NA	NA	NA	NA
BBF52090.1|605389_607999_+	outer membrane usher protein FimD	NA	NA	NA	NA	NA
BBF52091.1|608040_609006_+	fimbrial-like adhesin protein	NA	NA	NA	NA	NA
BBF52092.1|609050_609566_+	fimbrial protein	NA	NA	NA	NA	NA
BBF52093.1|609568_610201_-	response regulator	NA	NA	NA	NA	NA
BBF52094.1|610883_611402_+|head,protease	phage prohead protease	head,protease	A0A0K2FI53	Enterobacteria_phage	97.7	1.7e-81
BBF52095.1|611411_611744_+|head	phage head-DNA stabilization protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
BBF52096.1|611799_612825_+|capsid	phage major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	3.1e-188
BBF52097.1|612866_613262_+	phage DNA packaging protein	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
BBF52098.1|613273_613573_+|head,tail	phage head-tail adaptor protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.9	8.4e-46
BBF52099.1|613629_613941_+|transposase	IS602 transposase	transposase	Q716C1	Shigella_phage	40.8	2.4e-11
BBF52100.1|614060_614807_+|transposase	IS602 transposase	transposase	Q716C2	Shigella_phage	59.0	2.5e-83
BBF52101.1|614899_615478_+|tail	phage minor tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
BBF52102.1|615474_615870_+|tail	phage minor tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	1.4e-69
BBF52103.1|615877_616618_+|tail	phage major tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
BBF52104.1|616633_617056_+|tail	phage minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
BBF52105.1|617037_617472_+|tail	phage minor tail protein	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
BBF52106.1|617464_619633_+|tail	phage tail length tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.7	0.0e+00
BBF52107.1|619618_620287_-	hypothetical protein	NA	NA	NA	NA	NA
BBF52108.1|620343_620649_+|tail	phage tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
BBF52109.1|620832_622317_-	hydrolase	NA	NA	NA	NA	NA
BBF52110.1|622503_623457_-|protease	outer membrane protease VII	protease	NA	NA	NA	NA
>prophage 4
AP018802	Escherichia coli E2863 DNA, complete genome	5357442	853253	890278	5357442	transposase,protease,tail,head,integrase,holin	Enterobacteria_phage(46.67%)	49	847846:847862	878324:878340
847846:847862	attL	CGGCCATTGTGGGGCTG	NA	NA	NA	NA
BBF52310.1|853253_854330_-|integrase	integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	1.8e-199
BBF52311.1|854343_854841_-	phage lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
BBF52312.1|854840_855047_-|holin	phage holine protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
BBF52313.1|855494_857345_-	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
BBF52314.1|857887_858631_-	membrane protein	NA	NA	NA	NA	NA
BBF52315.1|858815_859505_-	phage antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
BBF52316.1|859981_860941_+	outer membrane protein	NA	NA	NA	NA	NA
BBF52317.1|861152_861341_-	phage protein NinH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
BBF52318.1|861337_861700_-	phage endonuclease RUS	NA	A5VW85	Enterobacteria_phage	98.3	3.5e-62
BBF52319.1|861696_861987_-	hypothetical protein	NA	K7PK25	Enterobacteria_phage	97.9	7.1e-50
BBF52320.1|861979_862192_-	hypothetical protein	NA	K7PK10	Enterobacteria_phage	100.0	1.6e-35
BBF52321.1|862184_862361_-	phage protein NinF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
BBF52322.1|862360_862720_-	hypothetical protein	NA	G8EYI2	Enterobacteria_phage	95.0	2.7e-62
BBF52323.1|862722_862899_-	hypothetical protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
BBF52324.1|862895_863306_-	recombination protein	NA	A0A0P0ZCW6	Stx2-converting_phage	98.5	2.1e-71
BBF52325.1|863277_863640_-	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	67.9	4.4e-33
BBF52326.1|863657_863864_-	hypothetical protein	NA	G8C7M4	Escherichia_phage	98.5	7.9e-27
BBF52327.1|863936_864227_-	phage exclusion protein	NA	K7PH23	Enterobacteria_phage	100.0	2.5e-50
BBF52328.1|864402_864642_+|transposase	IS629 transposase OrfA	transposase	A0A0N7C1Z2	Escherichia_phage	95.8	7.2e-32
BBF52329.1|864641_865529_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF52330.1|865915_866164_+|tail	phage tail protein	tail	E4WL21	Enterobacteria_phage	63.2	6.2e-18
BBF52331.1|866153_867659_+|head,protease	phage prohead protease	head,protease	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
BBF52332.1|867695_868043_+|head	phage head-DNA stabilization protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
BBF52333.1|868100_869129_+|head	phage head protein	head	C6ZCY2	Enterobacteria_phage	61.3	1.3e-114
BBF52334.1|869147_869555_+	phage DNA packaging protein	NA	NA	NA	NA	NA
BBF52335.1|869547_869901_+|head,tail	phage head-tail adaptor protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
BBF52336.1|869915_870491_+|tail	phage minor tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
BBF52337.1|870487_870883_+|tail	phage minor tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
BBF52338.1|870890_871643_+|tail	phage major tail protein	tail	Q687F6	Enterobacteria_phage	97.2	3.9e-132
BBF52339.1|871656_872088_+|tail	phage minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
BBF52340.1|872114_872528_+|tail	phage minor tail protein	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
BBF52341.1|872508_875088_+|tail	phage tail length tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.6	0.0e+00
BBF52342.1|875084_875414_+|tail	phage minor tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
BBF52343.1|875413_875761_+|tail	phage minor tail protein	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	2.0e-51
BBF52344.1|875718_876111_+|tail	phage minor tail protein	tail	Q687F1	Enterobacteria_phage	97.7	9.9e-71
BBF52345.1|876121_876865_+|tail	phage tail assembly protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
BBF52346.1|876861_877440_+|tail	phage tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.4e-99
BBF52347.1|877680_881157_+	phage host specificity protein	NA	A0A0P0ZBW1	Stx2-converting_phage	89.5	0.0e+00
878324:878340	attR	CGGCCATTGTGGGGCTG	NA	NA	NA	NA
BBF52348.1|881224_881824_+	outer membrane precursor Lom	NA	Q687E7	Enterobacteria_phage	98.0	1.8e-108
BBF52349.1|881888_883202_+|tail	phage tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	9.7e-78
BBF52350.1|883315_884203_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF52351.1|884202_884529_-|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF52352.1|884582_884786_+	hypothetical protein	NA	A0A1I9LJT0	Stx_converting_phage	97.0	1.4e-28
BBF52353.1|885164_885773_+	T3SS secreted effector NleH	NA	A5LH48	Enterobacteria_phage	89.6	1.4e-95
BBF52354.1|885996_886827_+	hypothetical protein	NA	A5LH49	Enterobacteria_phage	97.8	7.6e-153
BBF52355.1|887765_887864_+	T3SS secreted effector NleG	NA	H6WZN1	Escherichia_phage	93.5	1.7e-08
BBF52356.1|888540_888921_+	hypothetical protein	NA	NA	NA	NA	NA
BBF52357.1|889064_889391_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF52358.1|889390_890278_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
>prophage 5
AP018802	Escherichia coli E2863 DNA, complete genome	5357442	1067300	1126474	5357442	integrase,transposase,tRNA,protease	Enterobacteria_phage(21.43%)	57	1116012:1116071	1121737:1121801
BBF52516.1|1067300_1067849_+|protease	M15A protease-related family periplasmic protein	protease	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
BBF52517.1|1067875_1068523_+	hypothetical protein	NA	NA	NA	NA	NA
BBF52518.1|1068744_1069935_-	aspartate aminotransferase	NA	NA	NA	NA	NA
BBF52519.1|1070119_1071208_-	outer membrane porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
BBF52520.1|1071809_1073210_-|tRNA	asparaginyl tRNA synthetase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
BBF52521.1|1073378_1074581_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
BBF52522.1|1074846_1077459_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	4.1e-19
BBF52523.1|1077665_1078433_-	aliphatic sulfonate ABC transporter ATPase	NA	G3M9Y6	Bacillus_virus	37.6	1.7e-29
BBF52524.1|1078429_1079221_-	aliphatic sulfonate ABC transporter permease	NA	NA	NA	NA	NA
BBF52525.1|1079231_1080377_-	alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
BBF52526.1|1080373_1081333_-	aliphatic sulfonate ABC transporter periplasmic binding protein	NA	NA	NA	NA	NA
BBF52527.1|1081325_1081901_-	NAD(P)H-dependent FMN reductase	NA	NA	NA	NA	NA
BBF52528.1|1082256_1082799_+	fimbrial-like adhesin protein	NA	NA	NA	NA	NA
BBF52529.1|1082881_1083583_+	periplasmic pilin chaperone	NA	NA	NA	NA	NA
BBF52530.1|1083607_1086208_+	outer membrane usher protein FimD	NA	NA	NA	NA	NA
BBF52531.1|1086198_1087269_+	fimbrial-like adhesin protein	NA	NA	NA	NA	NA
BBF52532.1|1087280_1087823_+	fimbrial protein	NA	NA	NA	NA	NA
BBF52533.1|1087782_1088346_+	fimbrial-like adhesin protein	NA	NA	NA	NA	NA
BBF52534.1|1088359_1089049_+	periplasmic pilin chaperone	NA	NA	NA	NA	NA
BBF52535.1|1089159_1090170_+	dihydro-orotate oxidase	NA	NA	NA	NA	NA
BBF52536.1|1090343_1090886_+	cell division protein ZapC	NA	NA	NA	NA	NA
BBF52537.1|1090882_1091992_-	6-N-hydroxylaminopurine detoxification oxidoreductase	NA	NA	NA	NA	NA
BBF52538.1|1092235_1094344_+	23S rRNA m(2)G2445 and m(7)G2069 methyltransferases	NA	NA	NA	NA	NA
BBF52539.1|1094355_1096263_+	replication regulatory ABC-F family DNA-binding ATPase	NA	A0A2K9L3Z8	Tupanvirus	29.5	3.2e-53
BBF52540.1|1096392_1097646_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
BBF52541.1|1097650_1099291_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
BBF52542.1|1099287_1099851_+	lipoprotein	NA	NA	NA	NA	NA
BBF52543.1|1100106_1100274_+	ribosome modulation factor	NA	NA	NA	NA	NA
BBF52544.1|1100343_1100970_-	beta-hydroxydecanoyl thioester dehydrase	NA	NA	NA	NA	NA
BBF52545.1|1100930_1102691_-	peptidase	NA	NA	NA	NA	NA
BBF52546.1|1102876_1103329_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
BBF52547.1|1103404_1104445_-	outer membrane protein OmpA	NA	NA	NA	NA	NA
BBF52548.1|1104801_1105311_-	SOS cell division inhibitor	NA	NA	NA	NA	NA
BBF52549.1|1105583_1106159_+	CRP-S-dependent promoter expression factor	NA	NA	NA	NA	NA
BBF52550.1|1106121_1108284_-	transporter	NA	NA	NA	NA	NA
BBF52551.1|1108293_1108740_-	inner membrane protein	NA	NA	NA	NA	NA
BBF52552.1|1108862_1110917_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
BBF52553.1|1110948_1111407_-	methylglyoxal synthase	NA	NA	NA	NA	NA
BBF52554.1|1111502_1112165_-	hypothetical protein	NA	NA	NA	NA	NA
BBF52555.1|1112337_1112751_+	CoA-binding protein	NA	NA	NA	NA	NA
BBF52556.1|1112795_1113113_-	heat shock protein hspQ	NA	NA	NA	NA	NA
BBF52557.1|1113170_1114346_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
BBF52558.1|1114455_1114734_+	weak acylphosphatase	NA	NA	NA	NA	NA
BBF52559.1|1114730_1115060_-|tRNA	mnm(5)-s(2)U34-tRNA 2-thiolation sulfurtransferase	tRNA	NA	NA	NA	NA
BBF52560.1|1115150_1115810_-	membrane protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
1116012:1116071	attL	TTATTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAA	NA	NA	NA	NA
BBF52561.1|1116217_1116487_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	56.1	1.4e-20
BBF52562.1|1116519_1117233_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	47.9	9.7e-48
BBF52563.1|1117210_1117453_-	phage excisionase	NA	NA	NA	NA	NA
BBF52564.1|1117520_1118561_-	exodeoxyribonuclease VIII	NA	K7PLW7	Enterobacteria_phage	61.2	2.1e-59
BBF52565.1|1118615_1119503_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF52566.1|1119502_1119829_-|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF52567.1|1119915_1120809_-	T3SS secreted effector TccP2	NA	NA	NA	NA	NA
BBF52568.1|1121254_1121638_-	hypothetical protein	NA	Q6H9S1	Enterobacteria_phage	84.3	4.4e-55
BBF52569.1|1122255_1123374_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
1121737:1121801	attR	TTATTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGACCG	NA	NA	NA	NA
BBF52570.1|1123370_1125164_+	hydrogenase 1 large subunit	NA	NA	NA	NA	NA
BBF52571.1|1125182_1125890_+	hydrogenase 1 b-type cytochrome subunit	NA	NA	NA	NA	NA
BBF52572.1|1125886_1126474_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 6
AP018802	Escherichia coli E2863 DNA, complete genome	5357442	1177174	1254695	5357442	integrase,transposase	Escherichia_phage(35.71%)	77	1169411:1169425	1200637:1200651
1169411:1169425	attL	TTCTGGCGGCGGTAA	NA	NA	NA	NA
BBF52619.1|1177174_1178377_+|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
BBF52620.1|1178563_1180381_-	membrane protein	NA	NA	NA	NA	NA
BBF52621.1|1181614_1181800_-	hypothetical protein	NA	NA	NA	NA	NA
BBF52622.1|1182431_1183865_+	hypothetical protein	NA	NA	NA	NA	NA
BBF52623.1|1184685_1185249_+	hypothetical protein	NA	NA	NA	NA	NA
BBF52624.1|1185403_1187764_+	IS-excision enhancer IEE	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
BBF52625.1|1187925_1188195_-	hypothetical protein	NA	NA	NA	NA	NA
BBF52626.1|1188520_1190059_-|transposase	ISEc8 transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.7e-299
BBF52627.1|1190270_1190597_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF52628.1|1190596_1191484_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF52629.1|1192340_1192700_+	diacylglycerol kinase	NA	NA	NA	NA	NA
BBF52630.1|1192792_1194412_-	membrane-associated metal-dependent hydrolase	NA	NA	NA	NA	NA
BBF52631.1|1194636_1194912_-	hypothetical protein	NA	NA	NA	NA	NA
BBF52632.1|1195292_1195991_+	urease accessory protein	NA	NA	NA	NA	NA
BBF52633.1|1196081_1196384_+	urease subunit gamma	NA	NA	NA	NA	NA
BBF52634.1|1196392_1196713_+	urease subunit beta	NA	NA	NA	NA	NA
BBF52635.1|1196705_1198409_+	urease subunit alpha	NA	NA	NA	NA	NA
BBF52636.1|1198418_1198883_+	urease accessory protein	NA	NA	NA	NA	NA
BBF52637.1|1198883_1199558_+	urease accessory protein	NA	NA	NA	NA	NA
BBF52638.1|1199569_1200187_+	urease accessory protein	NA	NA	NA	NA	NA
BBF52639.1|1200225_1200489_+	hypothetical protein	NA	NA	NA	NA	NA
BBF52640.1|1200442_1200784_-|transposase	IS600 transposase OrfA	transposase	NA	NA	NA	NA
1200637:1200651	attR	TTCTGGCGGCGGTAA	NA	NA	NA	NA
BBF52641.1|1200845_1200974_-	complement resistance protein precursor TraT	NA	NA	NA	NA	NA
BBF52642.1|1201398_1201662_+	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
BBF52643.1|1201963_1202104_+	hypothetical protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
BBF52644.1|1202949_1203648_-	membrane protein	NA	NA	NA	NA	NA
BBF52645.1|1205180_1205666_-	hypothetical protein	NA	A0A218MNE7	uncultured_virus	42.0	9.5e-31
BBF52646.1|1205985_1206411_+|transposase	IS682 transposase	transposase	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
BBF52647.1|1206407_1206758_+|transposase	IS682 transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
BBF52648.1|1206788_1208402_+|transposase	IS682 transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
BBF52649.1|1208405_1209263_-|transposase	transposase	transposase	S5VLC8	Leptospira_phage	30.0	3.3e-26
BBF52650.1|1209344_1209686_-	hypothetical protein	NA	NA	NA	NA	NA
BBF52651.1|1209672_1210002_-	hypothetical protein	NA	NA	NA	NA	NA
BBF52652.1|1210262_1210730_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
BBF52653.1|1210747_1211956_-	hypothetical protein	NA	NA	NA	NA	NA
BBF52654.1|1211966_1212923_-	ATP synthase	NA	NA	NA	NA	NA
BBF52655.1|1212922_1214002_-	hypothetical protein	NA	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
BBF52656.1|1214003_1214777_-	hypothetical protein	NA	NA	NA	NA	NA
BBF52657.1|1214769_1215912_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
BBF52658.1|1215921_1216980_-	hypothetical protein	NA	NA	NA	NA	NA
BBF52659.1|1217301_1217883_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
BBF52660.1|1217882_1219040_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
BBF52661.1|1219062_1219518_+	tellurium resistance protein TerB	NA	NA	NA	NA	NA
BBF52662.1|1219540_1220581_+	tellurium resistance protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.9e-77
BBF52663.1|1220629_1221208_+	tellurium resistance protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
BBF52664.1|1221276_1221852_+	tellurium resistance protein TerE	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
BBF52665.1|1222275_1222662_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
BBF52666.1|1223175_1225266_-	bifunctional enterobactin receptor/adhesin protein	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
BBF52667.1|1226718_1226937_+	hypothetical protein	NA	NA	NA	NA	NA
BBF52668.1|1228215_1228344_-|transposase	transposase	transposase	NA	NA	NA	NA
BBF52669.1|1228686_1228881_-	hypothetical protein	NA	NA	NA	NA	NA
BBF52670.1|1228932_1229106_-	hypothetical protein	NA	NA	NA	NA	NA
BBF52671.1|1229194_1229467_+	hypothetical protein	NA	NA	NA	NA	NA
BBF52672.1|1229656_1229983_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF52673.1|1229982_1230870_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.4e-168
BBF52674.1|1231344_1231542_+	regulatory protein	NA	NA	NA	NA	NA
BBF52675.1|1232271_1233396_+	glucosyl-transferase	NA	NA	NA	NA	NA
BBF52676.1|1233814_1234108_-|transposase	IS1 transposase InsB	transposase	U5P0U6	Shigella_phage	92.8	8.3e-46
BBF52677.1|1234749_1235208_-	membrane protein	NA	NA	NA	NA	NA
BBF52678.1|1235665_1236175_+	hypothetical protein	NA	NA	NA	NA	NA
BBF52679.1|1236263_1236887_+	DNA-binding protein	NA	NA	NA	NA	NA
BBF52680.1|1236982_1237216_+	hypothetical protein	NA	NA	NA	NA	NA
BBF52681.1|1237268_1237460_-	hypothetical protein	NA	NA	NA	NA	NA
BBF52682.1|1238134_1239181_+	HecB-like protein	NA	NA	NA	NA	NA
BBF52683.1|1239421_1242103_+	UvrD/REP helicase-like protein	NA	NA	NA	NA	NA
BBF52684.1|1242603_1242819_+	phosphoadenosine phosphosulfate reductase	NA	A0A218M763	Flavobacterium_phage	53.4	1.7e-08
BBF52685.1|1242858_1243836_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	32.7	3.0e-47
BBF52686.1|1243820_1244459_+	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	52.5	1.9e-55
BBF52687.1|1244522_1245410_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF52688.1|1245409_1245736_-|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF52689.1|1245817_1246999_+	siderophore biosynthesis protein	NA	NA	NA	NA	NA
BBF52690.1|1246999_1247947_+	siderophore biosynthesis protein	NA	NA	NA	NA	NA
BBF52691.1|1247946_1249689_+	siderophore biosynthesis protein	NA	NA	NA	NA	NA
BBF52692.1|1249685_1251023_+	siderophore biosynthesis protein	NA	NA	NA	NA	NA
BBF52693.1|1251028_1253224_+	ferric siderophore receptor	NA	NA	NA	NA	NA
BBF52694.1|1253481_1254369_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.4e-168
BBF52695.1|1254368_1254695_-|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
>prophage 7
AP018802	Escherichia coli E2863 DNA, complete genome	5357442	1346527	1409063	5357442	transposase,protease,terminase,tRNA,portal,tail,head,integrase,holin	Stx2-converting_phage(43.75%)	66	1341621:1341635	1348102:1348116
1341621:1341635	attL	GATCGCGATGTACGC	NA	NA	NA	NA
BBF52797.1|1346527_1347646_-|integrase	integrase	integrase	Q77Z04	Phage_21	43.9	2.9e-83
BBF52798.1|1347614_1347884_-	phage excisionase	NA	NA	NA	NA	NA
BBF52799.1|1347945_1350411_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.1	8.8e-56
1348102:1348116	attR	GCGTACATCGCGATC	NA	NA	NA	NA
BBF52800.1|1350503_1350695_-	hypothetical protein	NA	NA	NA	NA	NA
BBF52801.1|1350691_1350880_-	cell division inhibition protein	NA	NA	NA	NA	NA
BBF52802.1|1351363_1351582_-	hypothetical protein	NA	NA	NA	NA	NA
BBF52803.1|1351622_1352012_-	hypothetical protein	NA	NA	NA	NA	NA
BBF52804.1|1352307_1352586_-	hypothetical protein	NA	NA	NA	NA	NA
BBF52805.1|1352587_1352779_-	hypothetical protein	NA	NA	NA	NA	NA
BBF52806.1|1352799_1353171_-	phage repressor protein CI	NA	NA	NA	NA	NA
BBF52807.1|1353323_1354211_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF52808.1|1354210_1354537_-|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF52809.1|1355084_1356212_+	hypothetical protein	NA	U5P0K4	Shigella_phage	47.8	6.8e-88
BBF52810.1|1356212_1356578_+	phage endonuclease RUS	NA	V5URS4	Shigella_phage	64.3	1.6e-38
BBF52811.1|1356586_1357117_+	phage antiterminator	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
BBF52812.1|1357358_1357556_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
BBF52813.1|1357706_1358765_+	DNA methylase	NA	S5MDR0	Escherichia_phage	94.0	2.0e-198
BBF52814.1|1359561_1361412_+	hypothetical protein	NA	H6WZJ9	Escherichia_phage	98.1	0.0e+00
BBF52815.1|1361859_1362066_+|holin	phage holine protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
BBF52816.1|1362070_1362415_+	hypothetical protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
BBF52817.1|1362465_1362999_+	phage endolysin	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
BBF52818.1|1363269_1363839_+	phage antirepressor	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
BBF52819.1|1363838_1363985_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
BBF52820.1|1363992_1364460_+	phage endopeptidase	NA	Q6H9V3	Enterobacteria_phage	100.0	6.9e-79
BBF52821.1|1364822_1365050_-	hypothetical protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
BBF52822.1|1365091_1365457_+	DNase	NA	B6ETE5	Enterobacteria_phage	99.2	2.0e-65
BBF52823.1|1365747_1366311_+|terminase	phage terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	3.8e-79
BBF52824.1|1366307_1367969_+|terminase	phage terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.9	0.0e+00
BBF52825.1|1368032_1369970_+|head,protease	phage prohead protease	head,protease	B6ETE8	Enterobacteria_phage	99.7	0.0e+00
BBF52826.1|1370014_1370236_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
BBF52827.1|1370181_1371546_+|portal	phage portal protein	portal	B6DZX6	Stx2-converting_phage	98.0	1.9e-254
BBF52828.1|1371542_1372928_+|portal	phage portal protein	portal	H6WZL3	Escherichia_phage	84.2	2.1e-83
BBF52829.1|1372924_1373251_+	phage DNA packaging protein	NA	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
BBF52830.1|1373260_1373611_+|head,tail	phage head-tail adaptor	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
BBF52831.1|1373607_1374054_+|tail	phage minor tail protein	tail	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
BBF52832.1|1374050_1374395_+|tail	phage minor tail protein	tail	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
BBF52833.1|1374461_1375178_+|tail	phage major tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
BBF52834.1|1375183_1375558_+|tail	phage tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	6.6e-64
BBF52835.1|1375653_1375863_+|tail	phage minor tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
BBF52836.1|1375914_1379157_+|tail	phage tail length tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	98.5	0.0e+00
BBF52837.1|1379149_1379491_+|tail	phage minor tail protein	tail	H6WZM2	Escherichia_phage	95.6	5.3e-60
BBF52838.1|1379490_1380189_+|tail	phage minor tail protein	tail	A0A0P0ZBE3	Stx2-converting_phage	97.4	4.4e-130
BBF52839.1|1380205_1380526_-	regulatory protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
BBF52840.1|1380633_1380807_+	transcriptional regulator	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
BBF52841.1|1380796_1381483_+	antirepressor	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	3.1e-120
BBF52842.1|1381854_1382592_+|tail	phage tail assembly protein	tail	A0A0P0ZDT1	Stx2-converting_phage	98.8	1.9e-147
BBF52843.1|1382588_1383170_+|tail	phage tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.4	7.3e-94
BBF52844.1|1383406_1386886_+	phage host specificity protein	NA	A0A0P0ZDT4	Stx2-converting_phage	97.4	0.0e+00
BBF52845.1|1386952_1387552_+	outer membrane precursor Lom	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
BBF52846.1|1387712_1388939_+|tail	phage tail fiber protein	tail	Q687E6	Enterobacteria_phage	99.0	2.1e-58
BBF52847.1|1388940_1389210_+	hypothetical protein	NA	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
BBF52848.1|1389316_1389406_+	hypothetical protein	NA	NA	NA	NA	NA
BBF52849.1|1389425_1391774_+	T3SS secreted effector EspX	NA	NA	NA	NA	NA
BBF52850.1|1392364_1395766_+	T3SS secreted effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.0e-219
BBF52851.1|1395934_1396513_+|transposase	transposase	transposase	NA	NA	NA	NA
BBF52852.1|1396654_1396888_+	hypothetical protein	NA	NA	NA	NA	NA
BBF52853.1|1397076_1398438_-	T3SS secreted effector EspK	NA	Q9MBM1	Phage_Gifsy-1	28.9	4.0e-50
BBF52854.1|1398801_1399665_-	spermidine/putrescine ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
BBF52855.1|1399648_1400785_-	spermidine/putrescine ABC transporter ATPase	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
BBF52856.1|1401034_1402264_+	peptidase T	NA	NA	NA	NA	NA
BBF52857.1|1402409_1403531_-	50S ribosomal protein L16 arginine hydroxylase	NA	NA	NA	NA	NA
BBF52858.1|1403606_1405067_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
BBF52859.1|1405066_1405738_-	two-component regulatory system response regulator PhoP	NA	NA	NA	NA	NA
BBF52860.1|1405905_1407276_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
BBF52861.1|1407279_1407921_-	lysogenization regulator	NA	NA	NA	NA	NA
BBF52862.1|1407956_1409063_-|tRNA	tRNA(Gln,Lys,Glu) U34 2-thiouridylase	tRNA	NA	NA	NA	NA
>prophage 8
AP018802	Escherichia coli E2863 DNA, complete genome	5357442	1494955	1562898	5357442	transposase,protease,terminase,tRNA,portal,tail,lysis	Enterobacteria_phage(43.86%)	80	NA	NA
BBF52949.1|1494955_1495141_-|transposase	IS4 transposase	transposase	NA	NA	NA	NA
BBF52950.1|1495264_1497940_-	acetaldehyde dehydrogenase	NA	NA	NA	NA	NA
BBF52951.1|1498416_1499064_+	inner membrane protein	NA	NA	NA	NA	NA
BBF52952.1|1499090_1499246_+	hypothetical protein	NA	NA	NA	NA	NA
BBF52953.1|1499221_1499383_-	hypothetical protein	NA	NA	NA	NA	NA
BBF52954.1|1499756_1501433_+	oligopeptide ABC transporter periplasmic binding protein	NA	NA	NA	NA	NA
BBF52955.1|1501518_1502439_+	oligopeptide ABC transporter permease	NA	NA	NA	NA	NA
BBF52956.1|1502453_1503362_+	oligopeptide ABC transporter permease	NA	NA	NA	NA	NA
BBF52957.1|1503373_1504387_+	oligopeptide ABC transporter ATPase	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
BBF52958.1|1504383_1505388_+	oligopeptide ABC transporter ATPase	NA	G9BWD6	Planktothrix_phage	35.6	8.0e-24
BBF52959.1|1505440_1505770_-	hypothetical protein	NA	NA	NA	NA	NA
BBF52960.1|1505804_1507265_-	cardiolipin synthase 1	NA	NA	NA	NA	NA
BBF52961.1|1507635_1508889_-	voltage-gated potassium channel	NA	NA	NA	NA	NA
BBF52962.1|1509187_1509580_-	hypothetical protein	NA	NA	NA	NA	NA
BBF52963.1|1510279_1510489_+	site-specific recombinases	NA	NA	NA	NA	NA
BBF52964.1|1510540_1510867_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF52965.1|1510866_1511754_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	99.7	8.1e-169
BBF52966.1|1511823_1512141_+	site-specific recombinases	NA	Q2A092	Sodalis_phage	37.9	3.0e-09
BBF52967.1|1513651_1513840_-	hypothetical protein	NA	NA	NA	NA	NA
BBF52968.1|1513987_1514314_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF52969.1|1514313_1515201_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF52970.1|1515294_1515801_+	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	74.2	6.6e-59
BBF52971.1|1515860_1516115_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	73.2	2.4e-25
BBF52972.1|1516111_1516408_+	hypothetical protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	4.4e-47
BBF52973.1|1516404_1516866_+	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	95.2	6.9e-39
BBF52974.1|1516843_1517200_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	6.7e-58
BBF52975.1|1517295_1517667_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.9	2.7e-49
BBF52976.1|1517663_1518017_+	putative phage protein	NA	Q9EY98	Enterobacteria_phage	65.0	5.5e-36
BBF52977.1|1518222_1518522_-	plasmid stabilization protein	NA	A0A2R2Z2Y1	Escherichia_phage	96.0	1.6e-49
BBF52978.1|1518527_1518785_-	transcriptional regulator	NA	A0A0N7C055	Escherichia_phage	88.0	6.6e-31
BBF52979.1|1519200_1520250_+	hypothetical protein	NA	U5P0K4	Shigella_phage	54.3	1.0e-109
BBF52980.1|1520262_1520637_+	phage endonuclease RUS	NA	V5URS4	Shigella_phage	62.7	2.4e-34
BBF52981.1|1520633_1521455_+	phage antitermination protein Q	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
BBF52982.1|1521681_1521879_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
BBF52983.1|1522029_1523088_+	DNA methylase	NA	S5MDR0	Escherichia_phage	98.0	1.7e-205
BBF52984.1|1523682_1525629_+	hypothetical protein	NA	Q9EYC8	Enterobacteria_phage	99.1	0.0e+00
BBF52985.1|1525766_1525946_+	hypothetical protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
BBF52986.1|1525986_1526232_+	hypothetical protein	NA	A0A088CE63	Shigella_phage	98.8	3.2e-19
BBF52987.1|1526309_1526525_+|lysis	phage lysis protein	lysis	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
BBF52988.1|1526528_1526774_+	hypothetical protein	NA	NA	NA	NA	NA
BBF52989.1|1526799_1527126_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF52990.1|1527125_1528013_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF52991.1|1528210_1528399_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	72.6	4.2e-19
BBF52992.1|1528435_1528969_+	phage endolysin	NA	B6DZ92	Enterobacteria_phage	97.2	2.1e-100
BBF52993.1|1529092_1529266_+	hypothetical protein	NA	Q687G2	Enterobacteria_phage	95.6	3.6e-17
BBF52994.1|1529267_1529735_+	phage endopeptidase	NA	Q7AYI6	Enterobacteria_phage	96.1	3.9e-74
BBF52995.1|1530147_1530624_+|terminase	phage terminase small subunit	terminase	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
BBF52996.1|1530620_1532744_+|terminase	phage terminase large subunit	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
BBF52997.1|1532740_1532953_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
BBF52998.1|1532952_1534455_+|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	100.0	1.8e-290
BBF52999.1|1534399_1536424_+|protease	phage protease/scaffold protein	protease	Q8VNN5	Enterobacteria_phage	99.9	0.0e+00
BBF53000.1|1536511_1536838_+	membrane protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
BBF53001.1|1536830_1537112_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
BBF53002.1|1537114_1537738_+|tail	phage minor tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
BBF53003.1|1537750_1538149_+|tail	phage minor tail protein	tail	Q9EYD7	Enterobacteria_phage	99.2	1.0e-70
BBF53004.1|1538156_1538909_+|tail	phage major tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
BBF53005.1|1538922_1539345_+|tail	phage minor tail protein	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
BBF53006.1|1539371_1539680_+|tail	phage minor tail protein	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
BBF53007.1|1539723_1542369_+|tail	phage tail length tape measure protein	tail	Q9EYE1	Enterobacteria_phage	99.4	0.0e+00
BBF53008.1|1542365_1542695_+|tail	phage minor tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
BBF53009.1|1542694_1543042_+|tail	phage minor tail protein	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	2.0e-51
BBF53010.1|1542999_1543392_+|tail	phage minor tail protein	tail	Q687F1	Enterobacteria_phage	97.7	9.9e-71
BBF53011.1|1543402_1544146_+|tail	phage tail assembly protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
BBF53012.1|1544142_1544724_+|tail	phage tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.4	7.3e-94
BBF53013.1|1544960_1548437_+	phage host specificity protein	NA	Q687E8	Enterobacteria_phage	96.6	0.0e+00
BBF53014.1|1548504_1549104_+	outer membrane precursor Lom	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
BBF53015.1|1549168_1550482_+|tail	phage tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.0	3.7e-77
BBF53016.1|1550483_1550753_+	hypothetical protein	NA	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
BBF53017.1|1551207_1551600_+|transposase	IS1 transposase InsB	transposase	U5P0U6	Shigella_phage	85.3	8.4e-54
BBF53018.1|1551888_1552479_+	T3SS secreted effector OspG	NA	NA	NA	NA	NA
BBF53019.1|1552856_1553027_+|tail	phage tail component	tail	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
BBF53020.1|1553515_1554022_-	hypothetical protein	NA	NA	NA	NA	NA
BBF53021.1|1554067_1554568_-	hypothetical protein	NA	NA	NA	NA	NA
BBF53022.1|1554653_1554833_-	hypothetical protein	NA	NA	NA	NA	NA
BBF53023.1|1555213_1556020_-	tryptophan synthase alpha chain	NA	NA	NA	NA	NA
BBF53024.1|1556019_1557213_-	tryptophan synthase beta chain	NA	NA	NA	NA	NA
BBF53025.1|1557358_1558582_-	indole-3-glycerolphosphate synthetase and N-(5-phosphoribosyl)anthranilate isomerase	NA	A0A0P0IR83	Acinetobacter_phage	40.7	7.7e-37
BBF53026.1|1558585_1560181_-	anthranilate synthase component II	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
BBF53027.1|1560180_1561743_-	component I of anthranilate synthase	NA	NA	NA	NA	NA
BBF53028.1|1562016_1562898_+|tRNA	S-adenosylmethionine tRNA ribosyltransferase	tRNA	NA	NA	NA	NA
>prophage 9
AP018802	Escherichia coli E2863 DNA, complete genome	5357442	1643683	1739600	5357442	transposase,protease,terminase,tRNA,portal,tail,head,integrase,holin	Escherichia_phage(40.91%)	116	1702548:1702607	1733293:1734604
BBF53109.1|1643683_1644916_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
BBF53110.1|1645170_1646154_+	Zn(II) transporter	NA	NA	NA	NA	NA
BBF53111.1|1646428_1646602_+	hypothetical protein	NA	NA	NA	NA	NA
BBF53112.1|1646631_1648005_+	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
BBF53113.1|1648133_1649069_-|tRNA	tRNA s(2)C32 thioltransferase	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
BBF53114.1|1649120_1650356_-|integrase	integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
BBF53115.1|1650357_1650573_-	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
BBF53116.1|1650672_1650861_-	hypothetical protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
BBF53117.1|1651103_1651913_-	recombination and repair protein	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
BBF53118.1|1651905_1654506_-	exonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
BBF53119.1|1654607_1654883_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
BBF53120.1|1654957_1655128_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
BBF53121.1|1655127_1655349_-	phage cell division inhibitor protein	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
BBF53122.1|1655667_1656279_+	phage superinfection exclusion protein	NA	NA	NA	NA	NA
BBF53123.1|1656275_1656431_-	hypothetical protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
BBF53124.1|1656863_1657283_-	regulator for DicB	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
BBF53125.1|1657362_1657617_+	phage antirepressor Cro	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
BBF53126.1|1657613_1658036_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
BBF53127.1|1658113_1658902_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
BBF53128.1|1658908_1659655_+	phage DNA replication protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
BBF53129.1|1659677_1660439_+	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
BBF53130.1|1660454_1660877_+	phage exclusion protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
BBF53131.1|1660982_1661195_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
BBF53132.1|1661446_1661710_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
BBF53133.1|1661720_1661882_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
BBF53134.1|1662637_1663789_+	DNA methylase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
BBF53135.1|1663756_1664746_-	hypothetical protein	NA	NA	NA	NA	NA
BBF53136.1|1664745_1666137_-	hypothetical protein	NA	NA	NA	NA	NA
BBF53137.1|1666636_1667236_+	hypothetical protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
BBF53138.1|1667235_1667526_+	hypothetical protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
BBF53139.1|1667522_1668077_+	phage antiterminator	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
BBF53140.1|1668638_1669070_+	TciA/TerB-like protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
BBF53141.1|1668882_1669401_-	hypothetical protein	NA	NA	NA	NA	NA
BBF53142.1|1669640_1671494_+	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
BBF53143.1|1671643_1671859_+|holin	phage holin protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
BBF53144.1|1671863_1672208_+	hypothetical protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
BBF53145.1|1672258_1672792_+	phage endolysin	NA	B6DZ92	Enterobacteria_phage	97.7	1.3e-100
BBF53146.1|1673065_1673755_+	hypothetical protein	NA	Q5MBW0	Stx1-converting_phage	98.3	9.8e-122
BBF53147.1|1673751_1673847_+	hypothetical protein	NA	NA	NA	NA	NA
BBF53148.1|1673992_1674451_+	endopeptidase	NA	Q7AYI6	Enterobacteria_phage	93.4	2.6e-70
BBF53149.1|1674789_1675116_+	membrane protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
BBF53150.1|1675247_1675448_-	hypothetical protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
BBF53151.1|1675489_1675855_+	DNase	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
BBF53152.1|1676143_1676707_+|terminase	phage terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
BBF53153.1|1676703_1678365_+|terminase	phage terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
BBF53154.1|1678428_1680366_+|head,protease	phage prohead protease	head,protease	H6WZL0	Escherichia_phage	99.7	0.0e+00
BBF53155.1|1680410_1680632_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
BBF53156.1|1680577_1683157_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.8	0.0e+00
BBF53157.1|1683159_1683486_+	phage DNA packaging protein	NA	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
BBF53158.1|1683495_1683846_+|head,tail	phage head-tail adaptor	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
BBF53159.1|1683842_1684289_+|tail	phage minor tail protein	tail	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
BBF53160.1|1684285_1684630_+|tail	phage minor tail protein	tail	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
BBF53161.1|1684696_1685413_+|tail	phage major tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	95.8	1.3e-124
BBF53162.1|1685418_1685793_+|tail	phage tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	5.0e-64
BBF53163.1|1685888_1686098_+|tail	phage minor tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
BBF53164.1|1686149_1688027_+|tail	phage tail length tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.5	5.9e-278
BBF53165.1|1688206_1689394_-|transposase	IS91 transposase	transposase	NA	NA	NA	NA
BBF53166.1|1689393_1689759_-|transposase	IS91 transposase	transposase	NA	NA	NA	NA
BBF53167.1|1689777_1691220_+|tail	phage tail length tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.3	5.1e-229
BBF53168.1|1691212_1691554_+|tail	phage minor tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
BBF53169.1|1691553_1692252_+|tail	phage minor tail protein	tail	A0A0P0ZBE3	Stx2-converting_phage	97.0	7.6e-130
BBF53170.1|1692257_1693001_+|tail	phage tail assembly protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.2	1.1e-147
BBF53171.1|1692997_1693579_+|tail	phage tail assembly protein	tail	H6WZM5	Escherichia_phage	97.4	7.5e-91
BBF53172.1|1693921_1697395_+	phage host specificity protein	NA	A0A0P0ZBW1	Stx2-converting_phage	90.1	0.0e+00
BBF53173.1|1697462_1698062_+	outer membrane precursor Lom	NA	Q9EV15	Enterobacteria_phage	97.0	4.1e-108
BBF53174.1|1698213_1699518_+|tail	phage tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	95.4	1.2e-72
BBF53175.1|1699519_1699789_+	hypothetical protein	NA	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
BBF53176.1|1700266_1700659_-|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	88.9	8.2e-57
BBF53177.1|1701132_1702044_+	T3SS secreted effector NleH	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
BBF53178.1|1702109_1702469_+	T3SS secreted effector NleF	NA	NA	NA	NA	NA
1702548:1702607	attL	CTGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCAT	NA	NA	NA	NA
BBF53179.1|1702590_1703478_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF53180.1|1703477_1703804_-|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF53181.1|1703996_1704344_-	hypothetical protein	NA	A0A218MNI5	uncultured_virus	51.5	2.1e-11
BBF53182.1|1704795_1705065_+	hypothetical protein	NA	NA	NA	NA	NA
BBF53183.1|1705819_1706467_-	T3SS secreted effector NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
BBF53184.1|1706650_1707241_+	T3SS secreted effector EspM	NA	NA	NA	NA	NA
BBF53185.1|1708747_1709398_+	T3SS secreted effector NleG	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
BBF53186.1|1709746_1710100_-	phage recombinase	NA	NA	NA	NA	NA
BBF53187.1|1710154_1710910_+	periplasmic protein TonB	NA	NA	NA	NA	NA
BBF53188.1|1710949_1711348_-	acyl-CoA esterase	NA	NA	NA	NA	NA
BBF53189.1|1711452_1711992_-	intracellular septation protein A	NA	NA	NA	NA	NA
BBF53190.1|1712021_1712765_-	inner membrane protein	NA	NA	NA	NA	NA
BBF53191.1|1713121_1713760_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
BBF53192.1|1713805_1714936_-|integrase	integrase	integrase	O21940	Phage_21	51.4	3.4e-103
BBF53193.1|1715226_1717698_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.7	5.5e-58
BBF53194.1|1717793_1717982_-	hypothetical protein	NA	NA	NA	NA	NA
BBF53195.1|1717978_1718167_-	cell division inhibition protein	NA	NA	NA	NA	NA
BBF53196.1|1718727_1718961_+	hypothetical protein	NA	NA	NA	NA	NA
BBF53197.1|1718938_1719346_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
BBF53198.1|1719368_1719587_-	hypothetical protein	NA	NA	NA	NA	NA
BBF53199.1|1719659_1720016_-	hypothetical protein	NA	NA	NA	NA	NA
BBF53200.1|1720223_1720631_-	regulator for DicB	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
BBF53201.1|1720917_1721469_+	hypothetical protein	NA	NA	NA	NA	NA
BBF53202.1|1721440_1722481_+	phage replication protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
BBF53203.1|1722512_1722935_+	phage replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
BBF53204.1|1722968_1723703_+	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	84.3	2.9e-108
BBF53205.1|1723699_1723864_+	hypothetical protein	NA	NA	NA	NA	NA
BBF53206.1|1724562_1725321_+	porcine attaching-effacing associated protein Paa/adherence factor AdfO	NA	NA	NA	NA	NA
BBF53207.1|1725599_1725812_+	phage maintenance protein	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
BBF53208.1|1726032_1726290_+	putative phage protein	NA	NA	NA	NA	NA
BBF53209.1|1726359_1726638_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.8e-11
BBF53210.1|1726639_1727695_+	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
BBF53211.1|1727695_1728061_+	phage endonuclease RUS	NA	V5URS4	Shigella_phage	67.5	1.6e-38
BBF53212.1|1728057_1728747_+	phage late gene regulator Q	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
BBF53213.1|1729649_1729796_+	TciA/TerB-like protein	NA	H6WZJ6	Escherichia_phage	97.9	1.4e-17
BBF53214.1|1729792_1729960_+	hypothetical protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
BBF53215.1|1730274_1732044_+	hypothetical protein	NA	H6WZJ9	Escherichia_phage	96.8	0.0e+00
BBF53216.1|1732095_1732422_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF53217.1|1732421_1733309_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF53218.1|1733398_1733668_+	hypothetical protein	NA	Q687E5	Enterobacteria_phage	100.0	6.4e-45
BBF53219.1|1733808_1734684_+	T3SS secreted effector OspB	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
1733293:1734604	attR	ATGATCTGGCAGCCTGAGTTCACAGATAAAACACTCTCCAGGAAACCCGGGGCGGTTCAGGGGCTGAATGAAGTGGGCAGTGATACAGGCAGAACAGGAGAATGACATGAATATACTAAAAAAACTTATGCAGCGTCTGTGTGGTTGCGGAAAGCATGATGGCCGTGAACACGTGCAGTCGCTTACAGCACAACTGCGACTGGGGCCGGCAGACATCCTGGAGTCCGATGAGAATGGTATTATTCCGGAGCAGGACAGGGTAATCACGCAGGTGGTGATACTGGATGCGGATAAAAAGCAGATACAGTGCGTGGTAAGACCGCTGCAAATTCTGCGTGCTGACGGGAGGTGGGAAAATATTGGCGGAATGAAATAGCCGACAGCTTCACAAAAACCGGAGTCCGGCTCCGGTTTTTGTTGTCATGTCCGGTGGATGTTTGTTAGGAATGTTCAGACAGGTTTATTTTGAATTTACACAGAATCCTAAACAGGTTCGAAAATTAAGAAAGAGGTTGTATGTTTAGCATAAGAACCCTACTACCTATTAGCGCCAGCGTATCAGTTCCGACAAAACAATCTCAATCCATCCCAATAACTTTAGCAGGGAGAACAATCGAAAAAGCGCAAGAGAAAGAAGGATTACTTGTTTTTTTAGGAATGAAATCCGTTAATGACTATACTCTTAATATTCTTGGCCAAAATGTTTCAAGAGTCACAACGGGGAAAAAACCGTATGATTTATTATTCCTGAATGATGCTACAAAACAAGATTTTGATAAAAGGAAAATGGAGTTTACATATCCTGGAGCAAATAAAAGCCATCTACAATCAAGTAATAGCGATGTTGTTGCTGCTGCAGCTATAAGTATTACAGCGACAGAGATGAAAACCATCCTGCCAGATGATTTAACACTAGGAAAATACAACAAAATTTATCTGTCTGGGCATGGTTCTGCTGGTCTACCTCTTCTTAAGTGCGGAGATGAATTTTTATCACCGTCAGATATTGTCGACCGCATTGTTCAGCATAATCTTCATGAAATAGATGATATCAGATTAACATCCTGTAACTCAGCCAACATAATAAAAAACAAAGACTTCTCTCCTGATGAAATAGAAAAATCCGCAAATATGAATAACGGCTGGTTGGCCAGGGCATTATTTGGTCAAAAGAGGTCTTTAGCAGAACACGTCTATGCCGAGTTTGAACGTCGCGGAATTAACGTTTCTATATCAGGTTACCATGGCACTGGCGTTTTTTATGTACCAGAGCATGGTAAACCAACAACGCATCTACGCTCCACAACTGTGC	NA	NA	NA	NA
BBF53220.1|1734908_1735622_-	T3SS secreted effector NleG	NA	B6ETE1	Enterobacteria_phage	99.1	1.3e-121
BBF53221.1|1736154_1736469_-	DNA damage-inducible protein	NA	Q687E4	Enterobacteria_phage	81.9	1.3e-25
BBF53222.1|1736528_1737812_+	transport protein	NA	NA	NA	NA	NA
BBF53223.1|1737900_1739361_+	NAD-dependent D-mannonate oxidoreductase	NA	G8DCZ3	Micromonas_pusilla_virus	30.3	5.6e-42
BBF53224.1|1739396_1739600_-	selenoprotein	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 10
AP018802	Escherichia coli E2863 DNA, complete genome	5357442	1937709	1987686	5357442	transposase,protease,terminase,portal,tail,head,integrase,holin	Stx2-converting_phage(39.58%)	60	1958854:1958870	1995202:1995218
BBF53401.1|1937709_1938843_+	outer membrane pore protein	NA	Q1MVN1	Enterobacteria_phage	58.3	1.2e-116
BBF53402.1|1938983_1939418_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
BBF53403.1|1939998_1940640_-	T3SS secreted effector NleG	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
BBF53404.1|1940721_1941351_-	T3SS secreted effector NleG	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
BBF53405.1|1941423_1941999_-	T3SS secreted effector NleG	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
BBF53406.1|1942111_1942381_-	hypothetical protein	NA	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
BBF53407.1|1942382_1943696_-|tail	phage tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.9	7.9e-80
BBF53408.1|1943760_1944360_-	outer membrane precursor Lom	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
BBF53409.1|1944430_1947928_-	phage host specificity protein	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.3	0.0e+00
BBF53410.1|1948061_1948589_+	copper/zinc-superoxide dismutase	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
BBF53411.1|1948779_1949361_-|tail	phage tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	89.6	3.3e-86
BBF53412.1|1949357_1950101_-|tail	phage tail assembly protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
BBF53413.1|1950111_1950810_-|tail	phage minor tail protein	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
BBF53414.1|1950809_1951151_-|tail	phage minor tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
BBF53415.1|1951143_1954386_-|tail	phage tail length tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	99.0	0.0e+00
BBF53416.1|1954437_1954647_-|tail	phage minor tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
BBF53417.1|1954742_1955117_-|tail	phage tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
BBF53418.1|1955122_1955839_-|tail	phage major tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.9	1.4e-126
BBF53419.1|1955907_1956252_-|tail	phage minor tail protein	tail	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
BBF53420.1|1956248_1956695_-|tail	phage minor tail protein	tail	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
BBF53421.1|1956691_1957042_-|head,tail	phage head-tail adaptor	head,tail	H6WZL5	Escherichia_phage	100.0	2.0e-59
BBF53422.1|1957051_1957378_-	phage DNA packaging protein	NA	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
BBF53423.1|1957374_1958436_-|portal	phage portal protein	portal	A0A0P0ZCZ4	Stx2-converting_phage	84.8	1.6e-99
BBF53424.1|1958432_1959797_-|portal	phage portal protein	portal	A0A0P0ZCX8	Stx2-converting_phage	97.4	2.5e-254
1958854:1958870	attL	TGCTGCTCCAGCGCCTC	NA	NA	NA	NA
BBF53425.1|1959742_1959964_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
BBF53426.1|1960008_1961946_-|head,protease	phage prohead protease	head,protease	H6WZL0	Escherichia_phage	99.7	0.0e+00
BBF53427.1|1962009_1963671_-|terminase	phage terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.9	0.0e+00
BBF53428.1|1963667_1964231_-|terminase	phage terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	3.8e-79
BBF53429.1|1964520_1964886_-	DNase	NA	B6DZ96	Enterobacteria_phage	96.7	2.9e-64
BBF53430.1|1964927_1965155_+	hypothetical protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
BBF53431.1|1965523_1965748_-	hypothetical protein	NA	NA	NA	NA	NA
BBF53432.1|1965744_1966239_-	endopeptidase	NA	Q9ZXB6	Enterobacteria_phage	93.8	4.0e-77
BBF53433.1|1966536_1967070_-	phage endolysin	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
BBF53434.1|1967120_1967465_-	hypothetical protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
BBF53435.1|1967469_1967676_-|holin	phage holine protein	holin	O48430	Enterobacteria_phage	100.0	1.8e-31
BBF53436.1|1968121_1969972_-	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
BBF53437.1|1970419_1970551_-	hypothetical protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
BBF53438.1|1970810_1971137_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF53439.1|1971136_1972024_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF53440.1|1971830_1972727_-	replication protein	NA	Q9EYF6	Enterobacteria_phage	98.7	8.2e-44
BBF53441.1|1972707_1973229_-	phage regulatory protein CII	NA	NA	NA	NA	NA
BBF53442.1|1973212_1973440_-	phage antirepressor protein Cro	NA	NA	NA	NA	NA
BBF53443.1|1973517_1973925_+	phage repressor CI	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
BBF53444.1|1974117_1974270_+	hypothetical protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
BBF53445.1|1974281_1974647_+	hypothetical protein	NA	NA	NA	NA	NA
BBF53446.1|1974615_1974816_-	hypothetical protein	NA	NA	NA	NA	NA
BBF53447.1|1975318_1975507_+	cell division inhibition protein	NA	NA	NA	NA	NA
BBF53448.1|1975503_1975695_+	hypothetical protein	NA	NA	NA	NA	NA
BBF53449.1|1975788_1978260_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	3.2e-58
BBF53450.1|1978347_1978584_+	phage excisionase	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
BBF53451.1|1978618_1979899_+|integrase	integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	1.9e-155
BBF53452.1|1979918_1980029_-	hypothetical protein	NA	NA	NA	NA	NA
BBF53453.1|1980086_1981106_-	Zn-dependent NAD(P)-binding oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
BBF53454.1|1981117_1982332_-	bifunctional D-altronate/D-mannonate dehydratase	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
BBF53455.1|1982537_1982864_-	inner membrane protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
BBF53456.1|1982998_1983340_+	periplasmic protein	NA	NA	NA	NA	NA
BBF53457.1|1983374_1983935_+	spermidine N(1)-acetyltransferase	NA	NA	NA	NA	NA
BBF53458.1|1983937_1984684_-	lipoprotein	NA	NA	NA	NA	NA
BBF53459.1|1984755_1985061_+	hypothetical protein	NA	NA	NA	NA	NA
BBF53460.1|1985259_1987686_+	anaerobic dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	2.0e-214
1995202:1995218	attR	TGCTGCTCCAGCGCCTC	NA	NA	NA	NA
>prophage 11
AP018802	Escherichia coli E2863 DNA, complete genome	5357442	2119812	2161535	5357442	transposase,terminase,tRNA,portal,tail,plate,integrase,capsid,holin	Enterobacteria_phage(81.08%)	48	2122215:2122239	2154176:2154200
BBF53584.1|2119812_2120562_-	vitamin B12 ABC transporter ATPase	NA	A0A2R8FG22	Brazilian_cedratvirus	28.3	1.6e-08
BBF53585.1|2120561_2121113_-	glutathione peroxidase	NA	NA	NA	NA	NA
BBF53586.1|2121175_2122156_-	vitamin B12 ABC transporter permease	NA	NA	NA	NA	NA
2122215:2122239	attL	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
BBF53587.1|2122345_2122741_-	hypothetical protein	NA	NA	NA	NA	NA
BBF53588.1|2122751_2123453_-|integrase	integrase	integrase	Q83VS6	Escherichia_phage	47.0	4.1e-59
BBF53589.1|2123740_2124019_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	78.3	1.5e-33
BBF53590.1|2124030_2124273_+	hypothetical protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
BBF53591.1|2124337_2125219_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	92.6	1.9e-114
BBF53592.1|2125404_2126715_+	replication protein	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	6.4e-247
BBF53593.1|2126791_2127751_+	plasmid partition protein	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	7.1e-179
BBF53594.1|2127755_2128067_+	plasmid partition protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.5	2.2e-41
BBF53595.1|2128431_2128701_+	hypothetical protein	NA	NA	NA	NA	NA
BBF53596.1|2129263_2129788_+	hypothetical protein	NA	NA	NA	NA	NA
BBF53597.1|2129802_2130849_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.1	1.9e-201
BBF53598.1|2130848_2132600_-|terminase	phage terminase large subunit	terminase	A0A0A7NV54	Enterobacteria_phage	97.3	0.0e+00
BBF53599.1|2132754_2133591_+	phage scaffolding protein	NA	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
BBF53600.1|2133614_2134667_+|capsid	phage major capsid protein	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
BBF53601.1|2134712_2135513_+|terminase	phage terminase small subunit	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
BBF53602.1|2135615_2136110_+|capsid	phage capsid completion protein	capsid	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
BBF53603.1|2136109_2136310_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
BBF53604.1|2136312_2136636_+|holin	phage holin protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
BBF53605.1|2136632_2137025_+	phage endolysin	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
BBF53606.1|2137021_2137429_+	hypothetical protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	4.5e-66
BBF53607.1|2137566_2138034_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	1.0e-85
BBF53608.1|2138017_2138662_+|tail	phage tail completion protein	tail	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
BBF53609.1|2138658_2139240_+|plate	phage baseplate assembly protein	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	1.0e-100
BBF53610.1|2139236_2139587_+|plate	phage baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
BBF53611.1|2139590_2140487_+|plate	phage baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	1.1e-154
BBF53612.1|2140479_2141010_+|tail	phage tail protein	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
BBF53613.1|2141012_2143145_+|tail	phage side tail fiber protein	tail	U5N099	Enterobacteria_phage	66.7	4.2e-131
BBF53614.1|2143144_2143723_+|tail	phage tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	1.7e-95
BBF53615.1|2143766_2144339_-	hypothetical protein	NA	NA	NA	NA	NA
BBF53616.1|2144495_2144984_-|tail	phage tail assembly protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	3.0e-85
BBF53617.1|2144996_2147804_-|tail	phage tail protein	tail	A0A0A7NRZ9	Enterobacteria_phage	94.9	0.0e+00
BBF53618.1|2147954_2148329_-|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	6.9e-37
BBF53619.1|2148384_2148897_-|tail	phage tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	98.2	7.8e-92
BBF53620.1|2148896_2150081_-|tail	phage tail sheath protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	8.1e-225
BBF53621.1|2150238_2151348_+	phage late gene regulator	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	9.6e-204
BBF53622.1|2151573_2153076_+	hypothetical protein	NA	NA	NA	NA	NA
BBF53623.1|2153319_2153580_+	phage regulatory protein	NA	NA	NA	NA	NA
BBF53624.1|2153770_2153911_+	hypothetical protein	NA	A0A0A7NPZ4	Enterobacteria_phage	95.7	4.5e-18
BBF53625.1|2154217_2154517_-	integration host factor DNA-binding protein alpha subunit	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
2154176:2154200	attR	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
BBF53626.1|2154521_2156909_-|tRNA	phenylalanine tRNA synthetase beta subunit	tRNA	NA	NA	NA	NA
BBF53627.1|2156923_2157907_-|tRNA	phenylalanine tRNA synthetase alpha subunit	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
BBF53628.1|2158357_2158714_-	50S ribosomal subunit protein L20	NA	NA	NA	NA	NA
BBF53629.1|2158766_2158964_-	50S ribosomal subunit protein L35	NA	NA	NA	NA	NA
BBF53630.1|2159060_2159495_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.8	6.1e-13
BBF53631.1|2159606_2161535_-|tRNA	threonyl-tRNA synthetase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
>prophage 12
AP018802	Escherichia coli E2863 DNA, complete genome	5357442	2229272	2282091	5357442	transposase,tRNA,protease	Escherichia_phage(25.0%)	54	NA	NA
BBF53700.1|2229272_2229599_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF53701.1|2229598_2230486_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF53702.1|2230761_2231910_-|transposase	IS609 transposase	transposase	A0A1W6JP07	Morganella_phage	96.9	4.5e-204
BBF53703.1|2232424_2232613_-	hypothetical protein	NA	NA	NA	NA	NA
BBF53704.1|2232616_2232976_-	hypothetical protein	NA	NA	NA	NA	NA
BBF53705.1|2233148_2233787_-	leucine efflux protein	NA	NA	NA	NA	NA
BBF53706.1|2233913_2234837_-	transcriptional activator of dmlA	NA	NA	NA	NA	NA
BBF53707.1|2234939_2236025_+	D-malate oxidase	NA	NA	NA	NA	NA
BBF53708.1|2236275_2237886_+	transporter	NA	NA	NA	NA	NA
BBF53709.1|2237917_2239042_+	dioxygenase alpha subunit	NA	NA	NA	NA	NA
BBF53710.1|2239097_2240063_+	putative dioxygenase beta subunit	NA	NA	NA	NA	NA
BBF53711.1|2240116_2241232_-	ribonuclease D	NA	NA	NA	NA	NA
BBF53712.1|2241313_2243065_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	3.6e-35
BBF53713.1|2243203_2243785_-	outer membrane lipoprotein	NA	NA	NA	NA	NA
BBF53714.1|2243824_2244520_-|tRNA	tRNA(ANN) t(6)A37 threonylcarbamoyladenosine modification protein	tRNA	NA	NA	NA	NA
BBF53715.1|2244577_2246488_-	ATP-dependent helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
BBF53716.1|2246616_2246964_+	reactive intermediate deaminase	NA	NA	NA	NA	NA
BBF53717.1|2247386_2247686_+	hypothetical protein	NA	NA	NA	NA	NA
BBF53718.1|2247805_2247985_-	hypothetical protein	NA	NA	NA	NA	NA
BBF53719.1|2248058_2249420_+	aminodeoxychorismate synthase subunit I	NA	S4VT78	Pandoravirus	33.4	3.4e-41
BBF53720.1|2249423_2250002_+	coenzyme A pyrophosphatase	NA	NA	NA	NA	NA
BBF53721.1|2250185_2251550_+	L-serine dehydratase 3	NA	NA	NA	NA	NA
BBF53722.1|2251680_2253279_+	membrane-anchored cyclic-di-GMP phosphodiesterase	NA	NA	NA	NA	NA
BBF53723.1|2253282_2254839_-	membrane protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
BBF53724.1|2254826_2255036_-	hypothetical protein	NA	NA	NA	NA	NA
BBF53725.1|2255301_2256273_+	PTS system mannose-specific IIAB component	NA	NA	NA	NA	NA
BBF53726.1|2256335_2257136_+	mannose-specific enzyme IIC component of PTS	NA	NA	NA	NA	NA
BBF53727.1|2257148_2258000_+	mannose-specific enzyme IID component of PTS	NA	NA	NA	NA	NA
BBF53728.1|2258054_2258513_+	inner membrane protein	NA	NA	NA	NA	NA
BBF53729.1|2258941_2259508_+	Mn(2+) efflux pump	NA	NA	NA	NA	NA
BBF53730.1|2259504_2260314_-	23S rRNA m(1)G745 methyltransferase	NA	NA	NA	NA	NA
BBF53731.1|2260479_2260689_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
BBF53732.1|2261513_2261801_-	inner membrane protein	NA	NA	NA	NA	NA
BBF53733.1|2262177_2262417_+	hypothetical protein	NA	NA	NA	NA	NA
BBF53734.1|2262559_2263351_-	KDG regulon transcriptional repressor	NA	NA	NA	NA	NA
BBF53735.1|2263527_2264901_+	transporter	NA	NA	NA	NA	NA
BBF53736.1|2264946_2265828_-	endopeptidase	NA	NA	NA	NA	NA
BBF53737.1|2266019_2268068_-|protease	carboxy-terminal protease for penicillin-binding protein 3	protease	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
BBF53738.1|2268087_2268786_-	ProP effector	NA	NA	NA	NA	NA
BBF53739.1|2268882_2269434_-	free methionine-(R)-sulfoxide reductase	NA	NA	NA	NA	NA
BBF53740.1|2269509_2270793_+	inner membrane PqiA domain protein	NA	NA	NA	NA	NA
BBF53741.1|2270761_2273395_+	hypothetical protein	NA	NA	NA	NA	NA
BBF53742.1|2273468_2274914_+	16S rRNA m(5)C1407 methyltransferase	NA	NA	NA	NA	NA
BBF53743.1|2275031_2275268_+	hypothetical protein	NA	NA	NA	NA	NA
BBF53744.1|2275288_2275564_+	hypothetical protein	NA	NA	NA	NA	NA
BBF53745.1|2275564_2276221_-	serine/threonine-specific protein phosphatase 1	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
BBF53746.1|2276616_2276958_-	hypothetical protein	NA	NA	NA	NA	NA
BBF53747.1|2276970_2277843_-	inner membrane protein	NA	NA	NA	NA	NA
BBF53748.1|2277846_2278221_-	hypothetical protein	NA	NA	NA	NA	NA
BBF53749.1|2278359_2278590_+	DNA polymerase III theta subunit HolE	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
BBF53750.1|2278691_2279348_+	hypothetical protein	NA	NA	NA	NA	NA
BBF53751.1|2279371_2280034_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
BBF53752.1|2280030_2280753_-|protease	protease II	protease	NA	NA	NA	NA
BBF53753.1|2280792_2282091_-|protease	protease II	protease	NA	NA	NA	NA
>prophage 13
AP018802	Escherichia coli E2863 DNA, complete genome	5357442	2380990	2469058	5357442	transposase,protease,terminase,portal,tail,head,integrase,holin	Enterobacteria_phage(33.33%)	107	2443294:2443353	2474660:2475972
BBF53851.1|2380990_2382139_-|transposase	IS609 transposase	transposase	A0A1W6JP07	Morganella_phage	97.4	1.3e-206
BBF53852.1|2382206_2382494_+|transposase	IS609 transposase	transposase	A0A1S5RHE3	Helicobacter_phage	66.7	3.1e-29
BBF53853.1|2383590_2384388_-	transcriptional regulator	NA	NA	NA	NA	NA
BBF53854.1|2384397_2384949_-	hypothetical protein	NA	NA	NA	NA	NA
BBF53855.1|2385117_2385450_-	multidrug resistance protein	NA	NA	NA	NA	NA
BBF53856.1|2385783_2386098_-	flagellar basal-body component	NA	NA	NA	NA	NA
BBF53857.1|2386311_2387970_+	flagellar basal-body MS-ring and collar protein	NA	NA	NA	NA	NA
BBF53858.1|2387962_2388958_+	flagellar motor switching and energizing component	NA	NA	NA	NA	NA
BBF53859.1|2388950_2389637_+	negative regulator of FliI ATPase activity	NA	NA	NA	NA	NA
BBF53860.1|2389636_2391010_+	flagellum-specific ATP synthase	NA	NA	NA	NA	NA
BBF53861.1|2391028_2391472_+	flagellar protein	NA	NA	NA	NA	NA
BBF53862.1|2391468_2392596_+	flagellar hook-length control protein	NA	NA	NA	NA	NA
BBF53863.1|2392700_2393165_+	flagellar biosynthesis protein	NA	NA	NA	NA	NA
BBF53864.1|2393169_2394174_+	flagellar motor switching and energizing component	NA	NA	NA	NA	NA
BBF53865.1|2394170_2394584_+	flagellar motor switching and energizing component	NA	NA	NA	NA	NA
BBF53866.1|2394586_2394952_+	flagellar biosynthesis protein	NA	NA	NA	NA	NA
BBF53867.1|2394951_2395485_+	flagellar biosynthesis protein	NA	NA	NA	NA	NA
BBF53868.1|2395698_2395968_+	flagellar biosynthesis protein	NA	NA	NA	NA	NA
BBF53869.1|2395975_2396761_+	flagellar export pore protein	NA	NA	NA	NA	NA
BBF53870.1|2397050_2397674_+	transcriptional regulator	NA	NA	NA	NA	NA
BBF53871.1|2397717_2397906_-	hypothetical protein	NA	NA	NA	NA	NA
BBF53872.1|2398068_2398296_+	hypothetical protein	NA	NA	NA	NA	NA
BBF53873.1|2398593_2399409_+	mannosyl-3-phosphoglycerate phosphatase	NA	NA	NA	NA	NA
BBF53874.1|2399405_2401100_-	membrane-anchored diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
BBF53875.1|2401270_2401453_-	hypothetical protein	NA	NA	NA	NA	NA
BBF53876.1|2401531_2402449_-	inner membrane protein	NA	NA	NA	NA	NA
BBF53877.1|2402621_2403542_+	amino acid exporter for phenylalanine	NA	NA	NA	NA	NA
BBF53878.1|2403530_2404001_-	DNA mismatch endonuclease of very short patch repair	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
BBF53879.1|2403981_2405400_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
BBF53880.1|2405466_2406162_-	HD superfamily phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.1e-07
BBF53881.1|2406201_2406504_-	inner membrane protein	NA	NA	NA	NA	NA
BBF53882.1|2407133_2408297_+	outer membrane pore protein	NA	Q1MVN1	Enterobacteria_phage	56.0	6.1e-108
BBF53883.1|2408887_2409739_+	heat shock protein Hsp31	NA	NA	NA	NA	NA
BBF53884.1|2409846_2411205_-	two-component system sensor histidine kinase YedV	NA	NA	NA	NA	NA
BBF53885.1|2411204_2411987_-	response regulator	NA	W8CYM9	Bacillus_phage	35.2	4.8e-32
BBF53886.1|2412008_2412422_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
BBF53887.1|2412530_2413535_+	reductase	NA	NA	NA	NA	NA
BBF53888.1|2413535_2414171_+	inner membrane heme subunit for periplasmic YedYZ reductase	NA	NA	NA	NA	NA
BBF53889.1|2414406_2415078_+	zinc and cadmium binding protein	NA	NA	NA	NA	NA
BBF53890.1|2415420_2415951_+	cytochrome	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
BBF53891.1|2417185_2418172_-	T3SS secreted effector NleC	NA	NA	NA	NA	NA
BBF53892.1|2418604_2418874_-	hypothetical protein	NA	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
BBF53893.1|2418875_2420189_-|tail	phage tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.0	3.7e-77
BBF53894.1|2420253_2420853_-	outer membrane precursor Lom	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
BBF53895.1|2420920_2424397_-	phage host specificity protein	NA	Q687E8	Enterobacteria_phage	96.6	0.0e+00
BBF53896.1|2424642_2425221_-|tail	phage tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	98.4	3.2e-94
BBF53897.1|2425217_2425961_-|tail	phage tail assembly protein	tail	Q9EYE4	Enterobacteria_phage	98.0	1.7e-148
BBF53898.1|2425971_2426670_-|tail	phage minor tail protein	tail	Q687F1	Enterobacteria_phage	98.3	1.4e-131
BBF53899.1|2426669_2426999_-|tail	phage minor tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
BBF53900.1|2426995_2427562_-|tail	phage tail length tape measure protein	tail	Q687F3	Enterobacteria_phage	99.5	5.2e-97
BBF53901.1|2427546_2429607_-|tail	phage tail length tape measure protein	tail	Q687F3	Enterobacteria_phage	87.9	3.2e-277
BBF53902.1|2429587_2430001_-|tail	phage minor tail protein	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
BBF53903.1|2430027_2430450_-|tail	phage minor tail protein	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
BBF53904.1|2430463_2431216_-|tail	phage major tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
BBF53905.1|2431223_2431619_-|tail	phage minor tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
BBF53906.1|2431615_2432149_-|tail	phage minor tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
BBF53907.1|2432164_2432518_-|head,tail	phage head-tail adaptor protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
BBF53908.1|2432510_2432894_-	phage DNA packaging protein	NA	NA	NA	NA	NA
BBF53909.1|2432945_2433974_-|head	phage head protein	head	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
BBF53910.1|2434031_2434379_-|head	phage head-DNA stabilization protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
BBF53911.1|2434415_2435921_-|head,protease	phage prohead protease	head,protease	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
BBF53912.1|2435910_2437503_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	7.1e-184
BBF53913.1|2437499_2437706_-|head,tail	phage head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
BBF53914.1|2437689_2439618_-|terminase	phage terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	3.6e-262
BBF53915.1|2439589_2440201_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	47.3	8.9e-34
BBF53916.1|2440828_2441143_-	PchABC family transcriptional regulator	NA	NA	NA	NA	NA
BBF53917.1|2441608_2442076_-	phage endopeptidase	NA	Q7AYI6	Enterobacteria_phage	89.0	5.5e-68
BBF53918.1|2442373_2442907_-	phage endolysin	NA	Q6H9V6	Enterobacteria_phage	96.0	1.9e-101
BBF53919.1|2442949_2443372_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	83.5	8.5e-52
2443294:2443353	attL	ATTGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCA	NA	NA	NA	NA
BBF53920.1|2443337_2444225_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF53921.1|2444224_2444551_-|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF53922.1|2444629_2444779_-	hypothetical protein	NA	NA	NA	NA	NA
BBF53923.1|2444782_2444998_-|holin	phage holine protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	7.7e-33
BBF53924.1|2445074_2445347_-	hypothetical protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
BBF53925.1|2445387_2445567_-	hypothetical protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
BBF53926.1|2445704_2447642_-	hypothetical protein	NA	Q6H9W1	Enterobacteria_phage	96.4	0.0e+00
BBF53927.1|2447956_2448124_-	hypothetical protein	NA	H6WZJ7	Escherichia_phage	70.6	5.4e-10
BBF53928.1|2448120_2448552_-	TciA/TerB-like protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
BBF53929.1|2448639_2449065_+|transposase	ISEc23 transposase	transposase	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
BBF53930.1|2449061_2449412_+|transposase	ISEc23 transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
BBF53931.1|2449442_2451056_+|transposase	ISEc23 transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	64.0	4.4e-181
BBF53932.1|2451541_2452129_-	phage regulatory protein	NA	NA	NA	NA	NA
BBF53933.1|2452389_2452587_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	6.8e-28
BBF53934.1|2452810_2453365_-	phage antiterminator	NA	A0A0U2S606	Escherichia_phage	67.4	8.0e-66
BBF53935.1|2453373_2453733_-	phage endonuclease RUS	NA	V5URS4	Shigella_phage	63.5	5.0e-37
BBF53936.1|2453745_2454795_-	hypothetical protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
BBF53937.1|2454796_2455069_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
BBF53938.1|2455190_2455535_-	hypothetical protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
BBF53939.1|2455654_2455867_-	regulatory protein MokC for HokC	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
BBF53940.1|2456100_2456658_-	putative phage protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
BBF53941.1|2457005_2457317_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.3	1.6e-55
BBF53942.1|2457309_2457537_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
BBF53943.1|2457533_2457815_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
BBF53944.1|2457847_2458564_-	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
BBF53945.1|2458585_2459332_-	phage DNA replication protein	NA	A0A088CBP4	Shigella_phage	83.2	3.6e-114
BBF53946.1|2459338_2460409_-	phage replication protein	NA	A0A088CD36	Shigella_phage	65.7	1.7e-64
BBF53947.1|2460480_2460906_-	hypothetical protein	NA	NA	NA	NA	NA
BBF53948.1|2460889_2461171_-	phage antirepressor protein Cro	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
BBF53949.1|2461270_2461690_+	phage repressor protein CI	NA	K7PK07	Enterobacteria_phage	65.1	4.0e-25
BBF53950.1|2461874_2462108_+	hypothetical protein	NA	M4QQ57	Salicola_phage	53.2	2.7e-07
BBF53951.1|2462119_2462758_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
BBF53952.1|2462758_2462968_-	hypothetical protein	NA	NA	NA	NA	NA
BBF53953.1|2463538_2463727_+	cell division inhibition protein	NA	NA	NA	NA	NA
BBF53954.1|2463723_2463915_+	hypothetical protein	NA	NA	NA	NA	NA
BBF53955.1|2464007_2466395_+	exonuclease	NA	A0A192Y7M7	Salmonella_phage	63.8	5.9e-81
BBF53956.1|2466630_2467428_+	anti-repressor for DgsA	NA	NA	NA	NA	NA
BBF53957.1|2467783_2469058_+|integrase	integrase	integrase	B7SYF8	Stenotrophomonas_phage	40.9	1.4e-76
2474660:2475972	attR	TGATCTGGCAGCCTGAGTTCACAGATAAAACACTCTCCAGGAAACCCGGGGCGGTTCAATTATTATAACAATCCACTAATACCCTGGCTTTATCTTCCCCTTTTGGTCCATGAACGATCACTATTGGTATATCTGTTTCACTTTGAATTTTTGCTATTAGATTTTCTGCAATCGATAATGAAAATGTACGTTCCTGCGAGCTACCTTCTAAATTAAGCGCAATGTAAGATCCTAACGATCGCATTTCCTCGCGCACCTCATCGAGTACATCCTCACTTAGTGGCAATTCATATATTGGCCTGACTGCTGGAAAACCCGCCTCACGCATCATAAATGCCCATGTCATGGGTACGGGAGCCCGGAGATTCTGATCCATCCGGGACGCGTTCTTGCACAAAGGGGAGTAGCACTTCATGGTTAAATCAACAACCTGAAAATTCGTTTTTGCTTTCAACTGACTGATAAATATCATCGTTTTCAGGTTCTTTTTACGCATCGCCTCTATACAAAGATCCGGCGTACCGTATTGCTGTGTTATGTTCTTTGCTAAATCTTTTATTTCTTTTAATGTTGCGTGATCCTGCATAGTCATTGTGACTAATGTTAATTTAGTCTTTTCAAGTTTAAGTGCATTAAACACTTCTAAATTAATTGTCGACGTAACAATTAAAAGATGCTTAATTTTATGCAATTCAAGCGCCCGAATAACAGGAAAGATGGCCATAGCATCGCCAATCTGGTCGGGAATATGGATGACAACAAAGTCTGTTTTTTCAATATTGAAATTATAAGCTTTATAATCGTAGTAACTAAATGCAATACGTCTCAACAATGATGCTAAAAACATACCTAACCTCGCCTCCCTACTGGTTATAATACAATGCAGTCTATCAGACTCATCAGGGTGCCATTTTGTGCATATGCGGACTTTTATGTTTCATATCTCTAACCTGTGGGTCCTCTGCTTAATCCTTAAACAACACCAGCAACTCCTGCGCTTTCATCTTCCATCGAATTTTTCATGTTGCCGCTAATCAGCCATAAAAACATTTGCAGATGCGCTCTGTCGAGGTAGTCTCATAAGGTTCGTTTATAGATCGACGGCAATGTGAGTTACCTTTTCCATACTAATTATAAAAAGACAGTACAAACAGGATCATTATGGACTCCACGCTCATCTCCACTCGTCCCGATGAAGGGACGCTTTCGTTAAGTCGCGCCCGACGAGCTGCGTTAGGCAGCTTCGCTGGTGCCGTCGTCGACTGGTATGATTTTTTACTCTATGGCATCACCGCCGCACTGGTGTTTAATCG	NA	NA	NA	NA
>prophage 14
AP018802	Escherichia coli E2863 DNA, complete genome	5357442	2473461	2542198	5357442	transposase,terminase,portal,head,integrase,capsid,holin	Enterobacteria_phage(43.84%)	100	2475384:2475398	2544159:2544173
BBF53962.1|2473461_2473788_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF53963.1|2473787_2474675_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF53964.1|2474714_2475506_-	hypothetical protein	NA	NA	NA	NA	NA
2475384:2475398	attL	AGCATCGCCAATCTG	NA	NA	NA	NA
BBF53965.1|2475820_2476552_+	shikimate transporter	NA	NA	NA	NA	NA
BBF53966.1|2476587_2477109_+	shikimate transporter	NA	NA	NA	NA	NA
BBF53967.1|2477210_2478665_+	AMP nucleosidase	NA	NA	NA	NA	NA
BBF53968.1|2479007_2479724_+	hypothetical protein	NA	NA	NA	NA	NA
BBF53969.1|2480351_2480720_-	MATE efflux family protein	NA	NA	NA	NA	NA
BBF53970.1|2480685_2481807_-	MATE efflux family protein	NA	NA	NA	NA	NA
BBF53971.1|2482113_2483064_-	ssuEADCB/tauABCD operon transcriptional activator	NA	NA	NA	NA	NA
BBF53972.1|2483165_2484083_-	nitrogen assimilation regulon transcriptional regulator	NA	NA	NA	NA	NA
BBF53973.1|2484540_2485476_-	L,D-transpeptidase linking Lpp to murein	NA	NA	NA	NA	NA
BBF53974.1|2485537_2486617_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
BBF53975.1|2486628_2487372_-	cobalamin synthase	NA	NA	NA	NA	NA
BBF53976.1|2487368_2487911_-	cobinamide kinase and cobinamide phosphate guanylyltransferase	NA	NA	NA	NA	NA
BBF53977.1|2489585_2489804_+	hypothetical protein	NA	NA	NA	NA	NA
BBF53978.1|2489843_2490134_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C035	Escherichia_phage	97.8	1.2e-44
BBF53979.1|2490313_2490973_+	phospholipase	NA	NA	NA	NA	NA
BBF53980.1|2491108_2491792_+	hypothetical protein	NA	NA	NA	NA	NA
BBF53981.1|2491807_2492218_+	hypothetical protein	NA	NA	NA	NA	NA
BBF53982.1|2492438_2493260_+	hypothetical protein	NA	A0A2C9CX26	Yersinia_phage	38.1	1.0e-45
BBF53983.1|2493341_2493821_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	8.9e-13
BBF53984.1|2493836_2494313_+	DNA repair protein	NA	NA	NA	NA	NA
BBF53985.1|2494381_2494603_+	hypothetical protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
BBF53986.1|2494676_2495045_+	antitoxin of toxin-antitoxin system	NA	NA	NA	NA	NA
BBF53987.1|2495133_2495397_+	toxin of the YeeV-YeeU toxin-antitoxin system	NA	NA	NA	NA	NA
BBF53988.1|2495503_2495698_+	hypothetical protein	NA	NA	NA	NA	NA
BBF53989.1|2496595_2496925_-	hypothetical protein	NA	NA	NA	NA	NA
BBF53990.1|2497096_2497519_-	inner membrane protein	NA	NA	NA	NA	NA
BBF53991.1|2497460_2498156_-	inner membrane protein	NA	NA	NA	NA	NA
BBF53992.1|2498353_2498827_-	DNA gyrase inhibitor	NA	NA	NA	NA	NA
BBF53993.1|2498941_2500108_-	D-alanyl-D-alanine carboxypeptidase, penicillin-binding protein 6b	NA	B6DZZ7	Stx2-converting_phage	98.5	7.2e-226
BBF53994.1|2500803_2501091_+	acyltransferase	NA	NA	NA	NA	NA
BBF53995.1|2501108_2501870_+	acyltransferase	NA	NA	NA	NA	NA
BBF53996.1|2501910_2503848_-	endo-alpha-sialidase	NA	A0A140G5Z9	Enterobacteria_phage	88.9	1.9e-271
BBF53997.1|2503969_2504230_+	transcriptional repressor	NA	A0A088CPT2	Enterobacteria_phage	95.3	6.9e-36
BBF53998.1|2504319_2506713_-	DNA injection protein	NA	Q716G2	Shigella_phage	96.6	0.0e+00
BBF53999.1|2506713_2508051_-	DNA injection protein	NA	A0A2D1GLX5	Escherichia_phage	86.5	2.5e-190
BBF54000.1|2508060_2508735_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	69.9	8.5e-54
BBF54001.1|2508709_2509189_-	hypothetical protein	NA	Q2A0B3	Sodalis_phage	74.0	1.7e-64
BBF54002.1|2509188_2510037_-|head	phage head DNA stabilization protein	head	Q716G6	Shigella_phage	98.2	2.1e-102
BBF54003.1|2510029_2510563_-	hypothetical protein	NA	A0A1V0E5R7	Salmonella_phage	48.3	1.1e-35
BBF54004.1|2510584_2512003_-|head	phage head DNA stabilization protein	head	A0A088CQ70	Enterobacteria_phage	91.5	5.3e-255
BBF54005.1|2512131_2513019_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF54006.1|2513018_2513345_-|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF54007.1|2513370_2513787_-|head	phage head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	6.4e-68
BBF54008.1|2513767_2513956_-	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	98.4	3.2e-27
BBF54009.1|2513997_2515251_-|capsid	phage capsid protein	capsid	A5VW72	Enterobacteria_phage	98.8	1.2e-234
BBF54010.1|2515269_2516163_-	phage scaffold protein	NA	A0A088CPT0	Enterobacteria_phage	98.7	3.7e-129
BBF54011.1|2516253_2518452_-|portal	phage portal protein	portal	A0A088CQ69	Enterobacteria_phage	99.3	0.0e+00
BBF54012.1|2518453_2519869_-|terminase	phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.8	1.2e-278
BBF54013.1|2519865_2520288_-|terminase	phage terminase small subunit	terminase	Q716H4	Shigella_phage	100.0	7.2e-75
BBF54014.1|2520311_2520491_-	hypothetical protein	NA	A0A088CPS9	Enterobacteria_phage	93.2	2.1e-23
BBF54015.1|2520500_2520788_-	hypothetical protein	NA	I1TQD4	Pseudomonas_phage	33.3	1.6e-06
BBF54016.1|2520791_2521034_-	hypothetical protein	NA	A5VW77	Enterobacteria_phage	100.0	3.7e-36
BBF54017.1|2521137_2521518_-	hypothetical protein	NA	Q716B1	Shigella_phage	96.8	6.7e-64
BBF54018.1|2521749_2522274_-	hypothetical protein	NA	G8C7W4	Escherichia_phage	94.2	4.5e-87
BBF54019.1|2522474_2522912_-	phage murein endopeptidase	NA	K7P710	Enterobacteria_phage	95.9	2.1e-69
BBF54020.1|2522908_2523385_-	phage endolysin	NA	A5VW81	Enterobacteria_phage	98.7	4.9e-88
BBF54021.1|2523368_2523692_-|holin	phage holin protein	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
BBF54022.1|2524153_2524672_-	phage antiterminator	NA	Q716B8	Shigella_phage	97.7	5.0e-94
BBF54023.1|2524662_2525334_-	serine/threonine-specific protein phosphatase 1	NA	K7P7K6	Enterobacteria_phage	98.2	2.1e-129
BBF54024.1|2525311_2525518_-	hypothetical protein	NA	Q716C0	Shigella_phage	100.0	7.3e-33
BBF54025.1|2525514_2526117_-	recombination endonuclease	NA	A0A1U9AJF8	Stx1_converting_phage	96.6	9.8e-94
BBF54026.1|2526091_2526658_-	hypothetical protein	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
BBF54027.1|2526996_2527524_-	DNA methylase	NA	K7PJZ4	Enterobacterial_phage	99.4	3.6e-100
BBF54028.1|2527520_2527967_-	recombination protein	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
BBF54029.1|2527923_2528160_-	hypothetical protein	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
BBF54030.1|2528170_2528386_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
BBF54031.1|2528518_2528797_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
BBF54032.1|2528866_2529136_-	hypothetical protein	NA	Q687G4	Enterobacteria_phage	100.0	8.4e-45
BBF54033.1|2529135_2530572_-	replication protein	NA	Q8VNP7	Enterobacteria_phage	99.8	1.4e-274
BBF54034.1|2530561_2531461_-	replication protein	NA	A0A0N7C1Z7	Escherichia_phage	98.7	8.7e-163
BBF54035.1|2531453_2531600_-	hypothetical protein	NA	Q687G5	Enterobacteria_phage	97.9	9.5e-19
BBF54036.1|2531634_2531913_-	phage regulatory protein CII	NA	Q8VNP9	Enterobacteria_phage	98.9	1.1e-42
BBF54037.1|2532021_2532216_-	phage repressor Cro	NA	K7PLQ6	Enterobacteria_phage	100.0	1.8e-28
BBF54038.1|2532322_2533039_+	phage repressor protein CI	NA	K7PGR7	Enterobacteria_phage	100.0	9.2e-123
BBF54039.1|2533056_2533425_+	hypothetical protein	NA	K7PJJ3	Enterobacteria_phage	100.0	1.3e-56
BBF54040.1|2533792_2534065_+	phage antitermination protein N	NA	K7P7A1	Enterobacteria_phage	94.4	1.1e-23
BBF54041.1|2534123_2534594_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
BBF54042.1|2534744_2535113_+	single stranded DNA-binding protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
BBF54043.1|2535185_2535350_+	phage regulatory protein CIII	NA	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
BBF54044.1|2535318_2535462_+	phage kil protein	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
BBF54045.1|2535537_2535834_+	phage host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
BBF54046.1|2535839_2536625_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
BBF54047.1|2536621_2537302_+	exonuclease	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
BBF54048.1|2537298_2537481_+	hypothetical protein	NA	Q6H9Z1	Enterobacteria_phage	98.3	3.7e-28
BBF54049.1|2537453_2537645_+	hypothetical protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
BBF54050.1|2537721_2537937_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	98.6	3.8e-32
BBF54051.1|2538035_2538257_+	conjugal transfer protein	NA	A0A0N7C211	Escherichia_phage	100.0	3.8e-35
BBF54052.1|2538253_2539027_+	hypothetical protein	NA	Q08J58	Stx2-converting_phage	100.0	1.0e-143
BBF54053.1|2539026_2539203_+	hypothetical protein	NA	A0A0F6TJP6	Escherichia_coli_O157_typing_phage	96.6	4.5e-23
BBF54054.1|2539199_2539388_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	95.2	1.2e-29
BBF54055.1|2539389_2539599_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	94.2	8.8e-34
BBF54056.1|2539595_2539931_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	76.4	8.0e-29
BBF54057.1|2539881_2540400_+	hypothetical protein	NA	Q9G077	Enterobacteria_phage	98.8	8.0e-44
BBF54058.1|2540392_2540677_+	RNA-binding protein	NA	A0A2D1GLL3	Escherichia_phage	98.9	9.1e-50
BBF54059.1|2540748_2541048_+	hypothetical protein	NA	Q9G076	Enterobacteria_phage	97.0	3.0e-51
BBF54060.1|2541129_2541321_+	phage excisionase	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
BBF54061.1|2541301_2542198_-|integrase	integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	100.0	4.9e-174
2544159:2544173	attR	AGCATCGCCAATCTG	NA	NA	NA	NA
>prophage 15
AP018802	Escherichia coli E2863 DNA, complete genome	5357442	2572456	2579476	5357442	transposase	Shigella_phage(50.0%)	8	NA	NA
BBF54092.1|2572456_2573575_-	GDP-D-mannose dehydratase	NA	M1IBC3	Acanthocystis_turfacea_Chlorella_virus	65.7	5.6e-135
BBF54093.1|2573625_2574699_-	glycosyl transferase	NA	NA	NA	NA	NA
BBF54094.1|2575284_2576178_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	40.3	4.3e-45
BBF54095.1|2576283_2577189_-|transposase	IS2 transposase	transposase	Q9ZXG3	Shigella_phage	99.0	4.1e-176
BBF54096.1|2577146_2577512_-|transposase	IS2 transposase	transposase	Q76S41	Shigella_phage	99.2	1.1e-58
BBF54097.1|2577600_2578521_-|transposase	IS30 transposase	transposase	NA	NA	NA	NA
BBF54098.1|2578477_2578846_-|transposase	IS911 transposase	transposase	Q716C1	Shigella_phage	97.7	6.1e-38
BBF54099.1|2578915_2579476_-	GDP-D-mannose dehydratase	NA	M1IBC3	Acanthocystis_turfacea_Chlorella_virus	75.0	5.6e-75
>prophage 16
AP018802	Escherichia coli E2863 DNA, complete genome	5357442	2658494	2667933	5357442		Enterobacteria_phage(87.5%)	11	NA	NA
BBF54166.1|2658494_2659631_+	VMA domain YehL ATPase stimulator	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
BBF54167.1|2659627_2661427_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
BBF54168.1|2661389_2661626_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.2	2.1e-36
BBF54169.1|2661750_2662212_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	7.1e-76
BBF54170.1|2662251_2662722_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.0e-81
BBF54171.1|2662768_2663488_-	two-component regulatory system response regulator YehT	NA	NA	NA	NA	NA
BBF54172.1|2663484_2665170_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
BBF54173.1|2665391_2666123_+	transcriptional activator of csgD and csgBA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
BBF54174.1|2666182_2666290_+	membrane protein	NA	NA	NA	NA	NA
BBF54175.1|2666270_2667002_-	ABC transporter permease	NA	NA	NA	NA	NA
BBF54176.1|2667006_2667933_-	transporter subunit: ATP-binding component of ABC superfamily protein	NA	G9BWD6	Planktothrix_phage	34.6	1.3e-23
>prophage 17
AP018802	Escherichia coli E2863 DNA, complete genome	5357442	2736921	2802021	5357442	transposase,protease,terminase,head,integrase,holin	Escherichia_phage(20.0%)	68	2774862:2774897	2808043:2808078
BBF54238.1|2736921_2738163_+|integrase	integrase	integrase	A0A1V0E8G8	Vibrio_phage	43.1	1.6e-98
BBF54239.1|2738659_2738866_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
BBF54240.1|2739248_2739422_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	51.2	1.4e-05
BBF54241.1|2739926_2740232_-	hypothetical protein	NA	NA	NA	NA	NA
BBF54242.1|2740428_2740629_+	hypothetical protein	NA	NA	NA	NA	NA
BBF54243.1|2740625_2741063_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	49.1	2.5e-06
BBF54244.1|2741007_2741289_+	hypothetical protein	NA	NA	NA	NA	NA
BBF54245.1|2741281_2741515_+	hypothetical protein	NA	NA	NA	NA	NA
BBF54246.1|2741520_2741820_+	hypothetical protein	NA	NA	NA	NA	NA
BBF54247.1|2741816_2743217_+	DNA primase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.1	1.6e-115
BBF54248.1|2743233_2743422_+	hypothetical protein	NA	NA	NA	NA	NA
BBF54249.1|2743418_2743664_+	hypothetical protein	NA	NA	NA	NA	NA
BBF54250.1|2743794_2743989_+	hypothetical protein	NA	NA	NA	NA	NA
BBF54251.1|2743992_2744154_+	hypothetical protein	NA	NA	NA	NA	NA
BBF54252.1|2744281_2744770_+|terminase	phage terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	41.7	3.9e-24
BBF54253.1|2744781_2744943_+	hypothetical protein	NA	NA	NA	NA	NA
BBF54254.1|2744929_2745856_+|head,protease	phage head protease	head,protease	A0A0R6PHC6	Moraxella_phage	24.9	1.2e-13
BBF54255.1|2746591_2748913_-	autotransporter outer membrane protein	NA	NA	NA	NA	NA
BBF54256.1|2749232_2749880_+	two-component regulatory system response regulator NarP	NA	NA	NA	NA	NA
BBF54257.1|2749914_2750967_-	heme lyase subunit CcmH	NA	NA	NA	NA	NA
BBF54258.1|2750963_2751521_-	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
BBF54259.1|2751517_2753461_-	heme lyase subunit CcmF	NA	NA	NA	NA	NA
BBF54260.1|2753457_2753937_-	cytochrome c-type biogenesis protein CcmE	NA	NA	NA	NA	NA
BBF54261.1|2753933_2754143_-	cytochrome c biogenesis protein	NA	NA	NA	NA	NA
BBF54262.1|2754139_2754877_-	heme export ABC transporter permease	NA	NA	NA	NA	NA
BBF54263.1|2754918_2755581_-	heme export ABC transporter permease	NA	NA	NA	NA	NA
BBF54264.1|2755577_2756195_-	heme export ABC transporter ATPase	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
BBF54265.1|2756213_2756816_-	quinol dehydrogenase	NA	NA	NA	NA	NA
BBF54266.1|2756825_2757275_-	cytochrome c-type protein NapB	NA	NA	NA	NA	NA
BBF54267.1|2757271_2758135_-	ferredoxin-type protein	NA	NA	NA	NA	NA
BBF54268.1|2758121_2758817_-	ferredoxin-type protein	NA	NA	NA	NA	NA
BBF54269.1|2758823_2761310_-	periplasmic nitrate reductase NapA	NA	NA	NA	NA	NA
BBF54270.1|2761306_2761570_-	nitrate reductase	NA	NA	NA	NA	NA
BBF54271.1|2761559_2762054_-	ferredoxin-type protein	NA	NA	NA	NA	NA
BBF54272.1|2762162_2762327_+	hypothetical protein	NA	NA	NA	NA	NA
BBF54273.1|2762462_2762951_+	ecotin	NA	NA	NA	NA	NA
BBF54274.1|2763099_2764746_-	malate dehydrogenase	NA	NA	NA	NA	NA
BBF54275.1|2764963_2766607_-	microcin J25 efflux ABC transporter permease/ATPase	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
BBF54276.1|2766682_2767333_-	oxidative demethylase of N1-methyladenine or N3-methylcytosine DNA lesions	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
BBF54277.1|2767332_2768397_-	bifunctional transcriptional activator/DNA repair enzyme Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
BBF54278.1|2768470_2769526_-	thiamine-synthetic flavin transferase lipoprotein	NA	NA	NA	NA	NA
BBF54279.1|2769637_2770729_-	outer membrane porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.8	3.6e-118
BBF54280.1|2771467_2774140_+	phosphotransfer intermediate protein in two-component regulatory system with RcsBC	NA	NA	NA	NA	NA
BBF54281.1|2774156_2774807_+	two-component regulatory system response regulator RcsB	NA	NA	NA	NA	NA
2774862:2774897	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTACG	NA	NA	NA	NA
BBF54282.1|2775006_2777856_-	hybrid sensory kinase in two-component regulatory system with RcsB and YojN	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
BBF54283.1|2778130_2778907_-	hypothetical protein	NA	NA	NA	NA	NA
BBF54284.1|2778911_2780561_-	hypothetical protein	NA	NA	NA	NA	NA
BBF54285.1|2780561_2785166_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
BBF54286.1|2785757_2787080_+	T3SS secreted effector NleA	NA	H6WZN2	Escherichia_phage	85.5	9.7e-227
BBF54287.1|2787318_2788206_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF54288.1|2788205_2788532_-|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF54289.1|2789086_2789620_-	T3SS secreted effector NleG	NA	B6DZC0	Enterobacteria_phage	42.0	6.4e-28
BBF54290.1|2789762_2790089_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF54291.1|2790088_2790976_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	99.7	8.1e-169
BBF54292.1|2791015_2791540_-	hypothetical protein	NA	A0A0N7CEE8	Salmonella_phage	89.7	1.2e-84
BBF54293.1|2791689_2792127_-	phage murein endopeptidase	NA	A0A0P0ZBQ9	Stx2-converting_phage	97.9	5.0e-71
BBF54294.1|2792123_2792621_-	phage lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	1.9e-90
BBF54295.1|2792620_2792836_-|holin	phage holine protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
BBF54296.1|2793898_2794456_-	membrane protein	NA	NA	NA	NA	NA
BBF54297.1|2794708_2795332_-	phage antitermination protein Q	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
BBF54298.1|2795328_2795994_-	serine/threonine-specific protein phosphatase 1	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
BBF54299.1|2795990_2796593_-	recombination endonuclease	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
BBF54300.1|2796567_2797134_-	hypothetical protein	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
BBF54301.1|2797126_2797243_-	hypothetical protein	NA	NA	NA	NA	NA
BBF54302.1|2797627_2798596_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	6.3e-151
BBF54303.1|2798634_2799462_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.6	1.6e-150
BBF54304.1|2800304_2800649_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
BBF54305.1|2800950_2802021_+|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
2808043:2808078	attR	CGTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCA	NA	NA	NA	NA
>prophage 18
AP018802	Escherichia coli E2863 DNA, complete genome	5357442	2895778	2988243	5357442	terminase,tRNA,portal,tail,lysis,integrase,capsid	Escherichia_phage(78.38%)	102	2927330:2927353	2988439:2988462
BBF54392.1|2895778_2896591_-|tRNA	tRNA pseudouridine(38-40) synthase	tRNA	NA	NA	NA	NA
BBF54393.1|2896590_2897604_-	semialdehyde dehydrogenase	NA	NA	NA	NA	NA
BBF54394.1|2897669_2898806_-	erythronate-4-phosphate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
BBF54395.1|2898904_2899900_+	flagella assembly protein	NA	NA	NA	NA	NA
BBF54396.1|2899896_2901075_-	arabinose efflux transporter	NA	NA	NA	NA	NA
BBF54397.1|2901358_2902579_-	3-oxoacyl-[acyl-carrier-protein] synthase I	NA	NA	NA	NA	NA
BBF54398.1|2902737_2904744_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
BBF54399.1|2904864_2905143_-	hypothetical protein	NA	NA	NA	NA	NA
BBF54400.1|2905176_2905725_-	elongation factor	NA	NA	NA	NA	NA
BBF54401.1|2905724_2906534_-	TauE/TSUP family inner membrane protein	NA	NA	NA	NA	NA
BBF54402.1|2906533_2907358_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
BBF54403.1|2907361_2908447_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
BBF54404.1|2908481_2909414_-	adenine-specific methylase	NA	NA	NA	NA	NA
BBF54405.1|2909579_2910131_+	DNA endonuclease	NA	NA	NA	NA	NA
BBF54406.1|2910203_2911055_-	outer membrane protein	NA	NA	NA	NA	NA
BBF54407.1|2911056_2911596_-	fimbrial-like adhesin protein	NA	NA	NA	NA	NA
BBF54408.1|2911592_2912081_-	fimbrial-like adhesin protein	NA	NA	NA	NA	NA
BBF54409.1|2912077_2912587_-	fimbrial-like adhesin protein	NA	NA	NA	NA	NA
BBF54410.1|2912602_2913355_-	periplasmic pilin chaperone	NA	NA	NA	NA	NA
BBF54411.1|2913374_2916020_-	outer membrane usher protein	NA	NA	NA	NA	NA
BBF54412.1|2916101_2916665_-	fimbrial-like adhesin protein	NA	NA	NA	NA	NA
BBF54413.1|2917348_2917834_-	phosphohistidine phosphatase	NA	NA	NA	NA	NA
BBF54414.1|2918036_2920181_-	fatty acid oxidation complex subunit alpha	NA	NA	NA	NA	NA
BBF54415.1|2920180_2921491_-	beta-ketoacyl-CoA thiolase	NA	NA	NA	NA	NA
BBF54416.1|2921670_2921955_-	hypothetical protein	NA	NA	NA	NA	NA
BBF54417.1|2922326_2923667_+	long-chain fatty acid outer membrane transporter	NA	NA	NA	NA	NA
BBF54418.1|2924032_2925091_+	hypothetical protein	NA	NA	NA	NA	NA
BBF54419.1|2925272_2926028_-	phospholipid-binding lipoprotein	NA	NA	NA	NA	NA
BBF54420.1|2926321_2927254_+	inner membrane protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
2927330:2927353	attL	GTCCTCTTAGTTAAATGGATATAA	NA	NA	NA	NA
BBF54421.1|2927475_2928690_-	hypothetical protein	NA	G3CFQ0	Escherichia_phage	99.8	1.0e-230
BBF54422.1|2928686_2935829_-	hypothetical protein	NA	Q08J70	Stx2-converting_phage	94.7	0.0e+00
BBF54423.1|2935898_2937164_-	hypothetical protein	NA	A0A088CBK4	Shigella_phage	97.1	3.4e-221
BBF54424.1|2937174_2937426_-	hypothetical protein	NA	A0A2R2Z351	Escherichia_phage	92.3	1.5e-11
BBF54425.1|2937435_2937882_-	hypothetical protein	NA	V5UT82	Shigella_phage	100.0	1.1e-76
BBF54426.1|2937884_2938541_-	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
BBF54427.1|2938634_2939036_-	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
BBF54428.1|2939092_2939233_-	hypothetical protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
BBF54429.1|2939465_2940200_-	outer membrane precursor protein Lom	NA	A0A0N7C1B9	Escherichia_phage	99.6	2.2e-135
BBF54430.1|2940290_2940908_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
BBF54431.1|2940913_2941192_-	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
BBF54432.1|2941206_2942475_-|tail	phage tail fiber protein	tail	A0A0N7C124	Escherichia_phage	98.1	2.1e-218
BBF54433.1|2942471_2944097_-	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	99.8	0.0e+00
BBF54434.1|2944391_2944580_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
BBF54435.1|2944719_2944989_-	hypothetical protein	NA	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
BBF54436.1|2944990_2946928_-|tail	phage tail fiber protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
BBF54437.1|2946924_2947575_-	hypothetical protein	NA	A0A2R2X2B3	Escherichia_phage	100.0	7.8e-121
BBF54438.1|2947574_2948138_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
BBF54439.1|2948121_2948583_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	99.3	3.0e-74
BBF54440.1|2948632_2949022_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
BBF54441.1|2949077_2950292_-|capsid	phage major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
BBF54442.1|2950315_2951323_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
BBF54443.1|2951480_2953625_-|portal	phage portal protein	portal	A0A2R2Z346	Escherichia_phage	99.7	0.0e+00
BBF54444.1|2953624_2955331_-|terminase	phage terminase large subunit	terminase	G9L6K0	Escherichia_phage	100.0	0.0e+00
BBF54445.1|2955311_2956118_-|terminase	phage terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
BBF54446.1|2956526_2956820_+	Bor protein precursor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
BBF54447.1|2956851_2957316_-	endopeptidase	NA	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
BBF54448.1|2957323_2957458_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	100.0	4.2e-13
BBF54449.1|2957472_2958042_-	phage antirepressor	NA	A0A2R2Z339	Escherichia_phage	98.9	3.4e-104
BBF54450.1|2958312_2958846_-	phage endolysin	NA	A0A1I9LJR4	Stx_converting_phage	98.9	3.9e-102
BBF54451.1|2958850_2959066_-|lysis	phage lysis protein	lysis	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
BBF54452.1|2959142_2959388_-	hypothetical protein	NA	S5MW40	Escherichia_phage	90.1	2.2e-15
BBF54453.1|2959744_2961682_-	hypothetical protein	NA	A0A0P0ZGE0	Escherichia_phage	99.2	0.0e+00
BBF54454.1|2962905_2963340_-	antiterminator	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
BBF54455.1|2963332_2963527_-	hypothetical protein	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
BBF54456.1|2963523_2964087_-	recombination endonuclease	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
BBF54457.1|2964094_2964544_-	hypothetical protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
BBF54458.1|2964543_2965515_-	DNA primase	NA	A0A2R2Z336	Escherichia_phage	100.0	1.4e-195
BBF54459.1|2965504_2967025_-	helicase	NA	A0A2R2Z335	Escherichia_phage	100.0	6.4e-307
BBF54460.1|2967018_2967396_-	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
BBF54461.1|2967919_2968159_-	hypothetical protein	NA	NA	NA	NA	NA
BBF54462.1|2968264_2968984_+	phage repressor protein CI	NA	A0A2R2X2B0	Escherichia_phage	68.6	3.1e-86
BBF54463.1|2969079_2970549_+	modification methyltransferase	NA	A0A2R2Z316	Escherichia_phage	97.1	2.7e-278
BBF54464.1|2970545_2971499_+	type II site-specific deoxyribonuclease	NA	A0A0P0ZG22	Escherichia_phage	97.8	3.6e-183
BBF54465.1|2971679_2972150_+	hypothetical protein	NA	D0UIM3	Aggregatibacter_phage	41.6	5.4e-23
BBF54466.1|2972149_2972530_+	hypothetical protein	NA	NA	NA	NA	NA
BBF54467.1|2973285_2973933_+	hypothetical protein	NA	A0A0P0ZGC2	Escherichia_phage	94.4	3.5e-113
BBF54468.1|2974202_2974841_+	antirepressor	NA	A0A0P0ZG08	Escherichia_phage	87.3	7.0e-106
BBF54469.1|2974911_2975124_+	phage cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
BBF54470.1|2975135_2975417_+	AbrB family transcriptional regulator	NA	A0A0P0ZGC3	Escherichia_phage	98.9	8.7e-45
BBF54471.1|2975437_2975719_+	hypothetical protein	NA	A0A0P0ZFG3	Escherichia_phage	98.9	1.4e-47
BBF54472.1|2975736_2976687_+	phage DNA recombination protein Bet	NA	A0A0P0ZFY9	Escherichia_phage	99.7	5.4e-179
BBF54473.1|2976683_2977373_+	exonuclease	NA	A0A0P0ZFI7	Escherichia_phage	98.7	2.5e-133
BBF54474.1|2977372_2977960_+	hypothetical protein	NA	A0A2R2Z318	Escherichia_phage	99.0	5.8e-107
BBF54475.1|2978034_2978382_+	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	100.0	5.9e-59
BBF54476.1|2978445_2979267_+	hypothetical protein	NA	A0A2R2Z323	Escherichia_phage	99.3	7.2e-148
BBF54477.1|2979343_2979820_+	hypothetical protein	NA	A0A2L1IV82	Escherichia_phage	96.8	3.4e-81
BBF54478.1|2979927_2980806_+	hypothetical protein	NA	A0A2R2Z314	Escherichia_phage	99.3	5.5e-178
BBF54479.1|2980802_2981006_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	100.0	4.7e-32
BBF54480.1|2980998_2981238_+	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	97.5	6.7e-38
BBF54481.1|2981234_2981867_+	hypothetical protein	NA	A0A2D1GLY5	Escherichia_phage	77.6	7.2e-79
BBF54482.1|2981868_2982078_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	92.8	2.0e-33
BBF54483.1|2982074_2982986_+	hypothetical protein	NA	A0A0H4IU61	Shigella_phage	92.6	5.2e-163
BBF54484.1|2983339_2983627_+	phage antirepressor	NA	V5URG2	Shigella_phage	97.9	1.7e-48
BBF54485.1|2983876_2984506_+	antirepressor	NA	G9L6G1	Escherichia_phage	100.0	2.3e-117
BBF54486.1|2984561_2984993_+	regulatory protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
BBF54487.1|2984989_2985616_+	adenine methylase	NA	G9L6F9	Escherichia_phage	100.0	1.8e-122
BBF54488.1|2985575_2985788_+	hypothetical protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
BBF54489.1|2985823_2986231_+	hypothetical protein	NA	A0A0P0ZH73	Escherichia_phage	81.5	2.0e-50
BBF54490.1|2986374_2986608_+	hypothetical protein	NA	G3CFG9	Escherichia_phage	100.0	2.3e-35
BBF54491.1|2986595_2986847_+	hypothetical protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
BBF54492.1|2986907_2987090_+	phage excisionase	NA	A0A1U9AJ41	Stx1_converting_phage	100.0	4.1e-27
BBF54493.1|2987073_2988243_-|integrase	integrase	integrase	G3CFG6	Escherichia_phage	100.0	7.5e-231
2988439:2988462	attR	GTCCTCTTAGTTAAATGGATATAA	NA	NA	NA	NA
>prophage 19
AP018802	Escherichia coli E2863 DNA, complete genome	5357442	3219122	3305360	5357442	transposase,protease,terminase,tRNA,portal,tail,integrase	Enterobacteria_phage(67.74%)	94	3289116:3289131	3312038:3312053
BBF54704.1|3219122_3219860_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
BBF54705.1|3219991_3221326_+	ATP-dependent RNA helicase	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
BBF54706.1|3221535_3222417_-	transcriptional regulator	NA	NA	NA	NA	NA
BBF54707.1|3222520_3223108_+	cysteine and O-acetylserine exporter	NA	NA	NA	NA	NA
BBF54708.1|3223163_3223547_-	autonomous glycyl radical cofactor	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
BBF54709.1|3223850_3224540_+	uracil-DNA-glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
BBF54710.1|3224587_3225625_-	methyltransferase	NA	NA	NA	NA	NA
BBF54711.1|3225831_3226251_+	thioredoxin 2	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
BBF54712.1|3226319_3227018_+	hypothetical protein	NA	NA	NA	NA	NA
BBF54713.1|3227049_3229710_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
BBF54714.1|3229823_3231179_+	phosphatidylserine synthase	NA	NA	NA	NA	NA
BBF54715.1|3231275_3231548_+	lipoprotein	NA	NA	NA	NA	NA
BBF54716.1|3231544_3232843_-	alpha-ketoglutarate transporter	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
BBF54717.1|3238695_3241269_-	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
BBF54718.1|3241398_3242130_-	hypothetical protein	NA	NA	NA	NA	NA
BBF54719.1|3242126_3243107_-	ribosomal large subunit pseudouridine synthase D	NA	NA	NA	NA	NA
BBF54720.1|3243241_3243979_+	BamABCDE complex OM biogenesis lipoprotein	NA	NA	NA	NA	NA
BBF54721.1|3244249_3244591_+	translation inhibitor protein RaiA	NA	NA	NA	NA	NA
BBF54722.1|3244839_3246000_+	chorismate mutase and prephenate dehydratase	NA	NA	NA	NA	NA
BBF54723.1|3246042_3247164_-	chorismate mutase-T and prephenate dehydrogenase	NA	NA	NA	NA	NA
BBF54724.1|3247174_3248245_-	3-deoxy-D-arabino-heptulosonate-7-phosphate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
BBF54725.1|3248457_3248820_+	lipoprotein	NA	NA	NA	NA	NA
BBF54726.1|3248969_3249488_+	periplasmic inhibitor of YfiN activity	NA	NA	NA	NA	NA
BBF54727.1|3249477_3250704_+	membrane-anchored diguanylate cyclase	NA	NA	NA	NA	NA
BBF54728.1|3250719_3251202_+	OM lipoprotein positive effector of YfiN activity	NA	NA	NA	NA	NA
BBF54729.1|3251278_3251626_-	50S ribosomal subunit protein L19	NA	NA	NA	NA	NA
BBF54730.1|3251667_3252435_-|tRNA	tRNA m(1)G37 methyltransferase	tRNA	NA	NA	NA	NA
BBF54731.1|3252465_3253014_-	ribosome maturation factor	NA	NA	NA	NA	NA
BBF54732.1|3253032_3253281_-	30S ribosomal subunit protein S16	NA	NA	NA	NA	NA
BBF54733.1|3253529_3254891_-	signal recognition particle protein	NA	NA	NA	NA	NA
BBF54734.1|3254982_3255849_+	cytochrome c assembly protein family inner membrane protein	NA	NA	NA	NA	NA
BBF54735.1|3255914_3257156_+	inner membrane protein	NA	NA	NA	NA	NA
BBF54736.1|3257210_3257804_-	co-chaperone GrpE	NA	NA	NA	NA	NA
BBF54737.1|3257926_3258805_+	NAD kinase	NA	NA	NA	NA	NA
BBF54738.1|3258890_3260552_+	recombination and repair protein RecN	NA	NA	NA	NA	NA
BBF54739.1|3260700_3261042_+	lipoprotein component of BamABCDE OM biogenesis complex	NA	NA	NA	NA	NA
BBF54740.1|3261103_3261394_-	hypothetical protein	NA	NA	NA	NA	NA
BBF54741.1|3261383_3261860_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
BBF54742.1|3261991_3262474_+	tmRNA-binding trans-translation protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
BBF54743.1|3262649_3262775_+	hypothetical protein	NA	NA	NA	NA	NA
BBF54744.1|3263322_3263571_+	DNA-damage-inducible protein DinI	NA	Q687E4	Enterobacteria_phage	100.0	2.4e-38
BBF54745.1|3263938_3264208_-	hypothetical protein	NA	Q687E5	Enterobacteria_phage	100.0	6.4e-45
BBF54746.1|3264209_3265532_-|tail	phage tail fiber protein	tail	Q687E6	Enterobacteria_phage	99.1	3.7e-77
BBF54747.1|3265596_3266196_-	outer membrane precursor Lom	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
BBF54748.1|3266263_3269740_-	phage host specificity protein	NA	Q687E8	Enterobacteria_phage	96.6	0.0e+00
BBF54749.1|3269985_3270564_-|tail	phage tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	98.4	3.2e-94
BBF54750.1|3270560_3271304_-|tail	phage tail assembly protein	tail	Q9EYE4	Enterobacteria_phage	98.0	1.7e-148
BBF54751.1|3271314_3272013_-|tail	phage minor tail protein	tail	Q687F1	Enterobacteria_phage	98.3	1.4e-131
BBF54752.1|3272012_3272342_-|tail	phage minor tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
BBF54753.1|3272338_3274984_-|tail	phage tail length tape measure protein	tail	Q687F3	Enterobacteria_phage	95.8	0.0e+00
BBF54754.1|3275027_3275336_-|tail	phage minor tail protein	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
BBF54755.1|3275362_3275785_-|tail	phage minor tail protein	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
BBF54756.1|3275798_3276551_-|tail	phage major tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
BBF54757.1|3276558_3276714_-|tail	phage minor tail protein	tail	Q687F7	Enterobacteria_phage	100.0	1.1e-22
BBF54758.1|3276902_3277229_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF54759.1|3277228_3278116_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF54760.1|3278118_3278265_-|tail	phage minor tail protein	tail	Q687G0	Enterobacteria_phage	100.0	3.5e-21
BBF54761.1|3278277_3278901_-|tail	phage minor tail protein	tail	Q8VNN3	Enterobacteria_phage	100.0	8.9e-106
BBF54762.1|3278903_3279185_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	100.0	2.1e-46
BBF54763.1|3279177_3279504_-	membrane protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
BBF54764.1|3279591_3281616_-|protease	phage protease/scaffold protein	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
BBF54765.1|3281560_3283063_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
BBF54766.1|3283062_3283275_-	hypothetical protein	NA	Q687G1	Enterobacteria_phage	98.6	2.3e-29
BBF54767.1|3283271_3285395_-|terminase	phage terminase large subunit	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
BBF54768.1|3285391_3285868_-|terminase	phage terminase small subunit	terminase	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
BBF54769.1|3286280_3286748_-	phage endopeptidase	NA	Q7AYI6	Enterobacteria_phage	100.0	7.7e-78
BBF54770.1|3287531_3287801_-	Shiga toxin 1 subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
BBF54771.1|3287810_3288758_-	Shiga toxin 1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
3289116:3289131	attL	TTTTTAAGATTTTGTT	NA	NA	NA	NA
BBF54772.1|3289264_3289747_-	antiterminator	NA	Q8VNP1	Enterobacteria_phage	99.4	2.4e-90
BBF54773.1|3289691_3289886_-	hypothetical protein	NA	G9L694	Escherichia_phage	100.0	1.9e-30
BBF54774.1|3289882_3290488_-	recombination endonuclease	NA	Q8VNP2	Enterobacteria_phage	100.0	1.9e-97
BBF54775.1|3290487_3290967_-	hypothetical protein	NA	A0A0P0ZCB2	Stx2-converting_phage	99.4	1.9e-84
BBF54776.1|3291049_3291211_-	hypothetical protein	NA	Q8VNP4	Enterobacteria_phage	100.0	5.6e-20
BBF54777.1|3291285_3291990_-	phage antirepressor protein	NA	Q8VNP5	Enterobacteria_phage	100.0	9.6e-133
BBF54778.1|3292443_3292971_-	DNA methylase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
BBF54779.1|3292967_3293414_-	recombination protein	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
BBF54780.1|3293370_3293607_-	hypothetical protein	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
BBF54781.1|3293617_3293833_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
BBF54782.1|3293965_3294244_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
BBF54783.1|3294313_3294583_-	hypothetical protein	NA	Q687G4	Enterobacteria_phage	100.0	8.4e-45
BBF54784.1|3294582_3296019_-	replication protein	NA	Q8VNP7	Enterobacteria_phage	100.0	6.1e-275
BBF54785.1|3296008_3296908_-	replication protein	NA	Q8VNP8	Enterobacteria_phage	100.0	1.6e-164
BBF54786.1|3296900_3297047_-	hypothetical protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
BBF54787.1|3297081_3297360_-	phage regulatory protein CII	NA	Q8VNP9	Enterobacteria_phage	100.0	3.6e-43
BBF54788.1|3297452_3297779_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF54789.1|3297778_3298327_+|transposase	IS629 transposase OrfB	transposase	Q687G6	Enterobacteria_phage	100.0	7.6e-101
BBF54790.1|3298460_3298859_+	recombination protein	NA	Q8VNQ0	Enterobacteria_phage	99.2	1.8e-72
BBF54791.1|3298859_3299123_+	single-stranded DNA-binding protein	NA	Q8VNQ1	Enterobacteria_phage	100.0	1.8e-36
BBF54792.1|3299125_3300013_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF54793.1|3300012_3300339_-|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF54794.1|3300731_3301238_+|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	2.3e-91
BBF54795.1|3301276_3301693_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
BBF54796.1|3301765_3303514_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
BBF54797.1|3303515_3305360_-	histidine kinase-like protein	NA	A0A1B5FPD5	Escherichia_phage	99.7	5.9e-307
3312038:3312053	attR	TTTTTAAGATTTTGTT	NA	NA	NA	NA
>prophage 20
AP018802	Escherichia coli E2863 DNA, complete genome	5357442	3376762	3383902	5357442		Escherichia_phage(83.33%)	6	NA	NA
BBF54871.1|3376762_3379324_+	methyl-directed mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
BBF54872.1|3379429_3380086_+	serine/threonine-specific protein phosphatase 2	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
BBF54873.1|3380136_3380904_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
BBF54874.1|3381099_3382008_+	dehydrogenase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
BBF54875.1|3382004_3383267_+	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	61.4	3.7e-135
BBF54876.1|3383263_3383902_+	class II aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 21
AP018802	Escherichia coli E2863 DNA, complete genome	5357442	3619701	3664013	5357442	integrase,transposase,tRNA,protease	Escherichia_phage(40.0%)	45	3653220:3653235	3671257:3671272
BBF55099.1|3619701_3620460_+|protease	metalloprotease	protease	NA	NA	NA	NA
BBF55100.1|3620515_3621259_-	4-hydroxy-2-ketovalerate aldolase	NA	NA	NA	NA	NA
BBF55101.1|3621245_3622355_-	transferase	NA	NA	NA	NA	NA
BBF55102.1|3622358_3623216_-	PTS fructose transporter subunit IID	NA	NA	NA	NA	NA
BBF55103.1|3623215_3623965_-	enzyme IIC component of PTS	NA	NA	NA	NA	NA
BBF55104.1|3623990_3624476_-	enzyme IIB component of PTS	NA	NA	NA	NA	NA
BBF55105.1|3624486_3624915_-	enzyme IIB component of PTS	NA	NA	NA	NA	NA
BBF55106.1|3625033_3627874_-	transcriptional regulator	NA	NA	NA	NA	NA
BBF55107.1|3628090_3629011_-	agmatinase	NA	NA	NA	NA	NA
BBF55108.1|3629146_3629878_-	lipoprotein	NA	NA	NA	NA	NA
BBF55109.1|3630023_3632000_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
BBF55110.1|3632487_3632739_-	inner membrane protein	NA	NA	NA	NA	NA
BBF55111.1|3632794_3633949_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
BBF55112.1|3634384_3635779_+	D-galactose transporter	NA	NA	NA	NA	NA
BBF55113.1|3635897_3636353_+	hypothetical protein	NA	NA	NA	NA	NA
BBF55114.1|3636447_3637155_+	DNA-specific endonuclease I	NA	NA	NA	NA	NA
BBF55115.1|3637234_3637966_+	16S rRNA m(3)U1498 methyltransferase	NA	NA	NA	NA	NA
BBF55116.1|3637978_3638929_+	glutathione synthetase	NA	NA	NA	NA	NA
BBF55117.1|3638965_3639601_+	hypothetical protein	NA	NA	NA	NA	NA
BBF55118.1|3639600_3640017_+	holliday junction resolvase	NA	NA	NA	NA	NA
BBF55119.1|3640192_3641173_-	twitching motility protein PilT	NA	NA	NA	NA	NA
BBF55120.1|3641190_3641895_+	hypothetical protein	NA	NA	NA	NA	NA
BBF55121.1|3641912_3642479_+	hypothetical protein	NA	NA	NA	NA	NA
BBF55122.1|3642475_3642766_+	hypothetical protein	NA	NA	NA	NA	NA
BBF55123.1|3642773_3643367_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
BBF55124.1|3643359_3644496_+	oxidoreductase	NA	NA	NA	NA	NA
BBF55125.1|3644809_3645796_+	C4-dicarboxylate-binding periplasmic protein	NA	NA	NA	NA	NA
BBF55126.1|3645840_3646344_+	C4-dicarboxylate ABC transporter permease	NA	NA	NA	NA	NA
BBF55127.1|3646343_3647645_+	C4-dicarboxylate transport system large permease component	NA	NA	NA	NA	NA
BBF55128.1|3647700_3648708_-	hypothetical protein	NA	NA	NA	NA	NA
BBF55129.1|3648824_3649871_-	periplasmic L-asparaginase 2	NA	NA	NA	NA	NA
BBF55130.1|3650046_3650766_-	hypothetical protein	NA	NA	NA	NA	NA
BBF55131.1|3650949_3651276_-	hypothetical protein	NA	NA	NA	NA	NA
BBF55132.1|3651275_3651995_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
BBF55133.1|3652155_3653208_+	adenine DNA glycosylase	NA	NA	NA	NA	NA
3653220:3653235	attL	ATAAAGAGGATGATTT	NA	NA	NA	NA
BBF55134.1|3653235_3653511_+	oxidative damage protective factor for iron-sulfur proteins	NA	NA	NA	NA	NA
BBF55135.1|3653575_3654655_+	membrane-bound lytic murein transglycosylase C	NA	NA	NA	NA	NA
BBF55136.1|3654856_3656113_+	nucleoside transporter	NA	NA	NA	NA	NA
BBF55137.1|3656162_3658298_-	ornithine decarboxylase isozyme	NA	NA	NA	NA	NA
BBF55138.1|3658695_3659403_+	inner membrane protein	NA	NA	NA	NA	NA
BBF55139.1|3659781_3661041_+|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	8.4e-79
BBF55140.1|3661157_3661409_-|transposase	ISEc8 transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.8	2.8e-42
BBF55141.1|3661480_3661807_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF55142.1|3661806_3662694_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF55143.1|3663053_3664013_+|transposase	transposase	transposase	NA	NA	NA	NA
3671257:3671272	attR	AAATCATCCTCTTTAT	NA	NA	NA	NA
>prophage 22
AP018802	Escherichia coli E2863 DNA, complete genome	5357442	3669137	3712193	5357442	transposase	Shigella_phage(42.86%)	51	NA	NA
BBF55147.1|3669137_3669368_+|transposase	IS630 transposase	transposase	NA	NA	NA	NA
BBF55148.1|3669431_3669992_+|transposase	IS630 transposase	transposase	NA	NA	NA	NA
BBF55149.1|3670619_3671393_-	hypothetical protein	NA	NA	NA	NA	NA
BBF55150.1|3671565_3672711_-	T3SS secreted effector EspG	NA	NA	NA	NA	NA
BBF55151.1|3673197_3674064_-|transposase	IS3 transposase OrfB	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.9e-51
BBF55152.1|3674060_3674360_-|transposase	IS3 transposase OrfA	transposase	NA	NA	NA	NA
BBF55153.1|3674873_3675524_-	T3SS secreted effector EspF	NA	NA	NA	NA	NA
BBF55154.1|3675719_3675998_-	T3SS component EscG	NA	NA	NA	NA	NA
BBF55155.1|3676003_3676225_-	T3SS structure protein EscF	NA	NA	NA	NA	NA
BBF55156.1|3676259_3676667_-	T3SS chaperone CesD2	NA	NA	NA	NA	NA
BBF55157.1|3676673_3677636_-	T3SS translocator EspB	NA	NA	NA	NA	NA
BBF55158.1|3677656_3678799_-	T3SS translocator EspD	NA	NA	NA	NA	NA
BBF55159.1|3678811_3679390_-	T3SS translocator EspA	NA	NA	NA	NA	NA
BBF55160.1|3679448_3680504_-	T3SS secretion switching protein SepL	NA	NA	NA	NA	NA
BBF55161.1|3680685_3681867_+	T3SS structure protein EscD	NA	NA	NA	NA	NA
BBF55162.1|3682155_3684963_-	intimin	NA	NA	NA	NA	NA
BBF55163.1|3685020_3685491_-	T3SS chaperone CesT	NA	NA	NA	NA	NA
BBF55164.1|3685625_3687281_-	T3SS translocated intimin receptor Tir	NA	NA	NA	NA	NA
BBF55165.1|3687603_3688215_-	T3SS secreted effector Map	NA	NA	NA	NA	NA
BBF55166.1|3688479_3688842_+	T3SS chaperone CesF	NA	NA	NA	NA	NA
BBF55167.1|3689020_3689530_-	T3SS secreted effector EspH	NA	NA	NA	NA	NA
BBF55168.1|3689560_3690478_-	T3SS structure protein SepQ	NA	NA	NA	NA	NA
BBF55169.1|3690849_3691170_-	T3SS component	NA	NA	NA	NA	NA
BBF55170.1|3691229_3692570_-	T3SS structure protein EscN	NA	NA	NA	NA	NA
BBF55171.1|3692553_3694581_-	T3SS structure protein EscV	NA	NA	NA	NA	NA
BBF55172.1|3694577_3694931_-	regulator Mpc	NA	NA	NA	NA	NA
BBF55173.1|3695115_3695412_+	T3SS secreted effector EspZ	NA	NA	NA	NA	NA
BBF55174.1|3695443_3695872_+	T3SS component	NA	NA	NA	NA	NA
BBF55175.1|3695874_3696447_+	T3SS structure protein EscJ	NA	NA	NA	NA	NA
BBF55176.1|3696452_3696908_+	T3SS secretion switching protein SepD	NA	NA	NA	NA	NA
BBF55177.1|3696907_3698446_+	T3SS structure protein EscC	NA	D0U184	Enterobacteria_phage	29.3	1.0e-09
BBF55178.1|3698459_3698915_+	T3SS chaperone CesD	NA	NA	NA	NA	NA
BBF55179.1|3699298_3699712_-	positive regulator GrlA	NA	NA	NA	NA	NA
BBF55180.1|3699767_3700139_-	negative regulator GrlR	NA	NA	NA	NA	NA
BBF55181.1|3700334_3700793_+	hypothetical protein	NA	NA	NA	NA	NA
BBF55182.1|3700789_3701827_-	T3SS structure protein EscU	NA	NA	NA	NA	NA
BBF55183.1|3701819_3702596_-	T3SS structure protein EscT	NA	NA	NA	NA	NA
BBF55184.1|3702595_3702865_-	T3SS structure protein EscS	NA	NA	NA	NA	NA
BBF55185.1|3702864_3703518_-	T3SS structure protein EscR	NA	NA	NA	NA	NA
BBF55186.1|3703522_3704176_-	T3SS component	NA	NA	NA	NA	NA
BBF55187.1|3704162_3704762_-	T3SS component	NA	NA	NA	NA	NA
BBF55188.1|3704758_3705073_-	T3SS component	NA	NA	NA	NA	NA
BBF55189.1|3705085_3705304_-	T3SS component	NA	NA	NA	NA	NA
BBF55190.1|3705318_3705690_-	transcription regulator Ler	NA	NA	NA	NA	NA
BBF55191.1|3706545_3707385_-|transposase	IS2 transposase	transposase	Q9ZXG3	Shigella_phage	92.5	1.7e-152
BBF55192.1|3707731_3708058_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF55193.1|3708057_3708945_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF55194.1|3709996_3710098_-	regulatory protein	NA	NA	NA	NA	NA
BBF55195.1|3710288_3710492_-	hypothetical protein	NA	NA	NA	NA	NA
BBF55196.1|3711015_3711327_+|transposase	IS602 transposase	transposase	Q716C1	Shigella_phage	40.8	2.4e-11
BBF55197.1|3711446_3712193_+|transposase	IS602 transposase	transposase	Q716C2	Shigella_phage	59.0	4.3e-83
>prophage 23
AP018802	Escherichia coli E2863 DNA, complete genome	5357442	3935110	3991795	5357442	transposase,protease	Escherichia_phage(15.79%)	59	NA	NA
BBF55403.1|3935110_3935998_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF55404.1|3935997_3936324_-|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF55405.1|3936329_3937394_-	EptAB family phosphoethanolamine transferase	NA	NA	NA	NA	NA
BBF55406.1|3937953_3938286_-	preprotein translocase membrane subunit SecG	NA	NA	NA	NA	NA
BBF55407.1|3938513_3939851_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
BBF55408.1|3939843_3940692_-	7,8-dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
BBF55409.1|3940781_3942725_-|protease	ATP-dependent zinc-metallo protease	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.4e-118
BBF55410.1|3942815_3943445_-	23S rRNA U2552 2'-O-ribose methyltransferase	NA	NA	NA	NA	NA
BBF55411.1|3943570_3943864_+	RNA binding protein associated with pre-50S ribosomal subunits	NA	NA	NA	NA	NA
BBF55412.1|3944019_3944496_-	transcript cleavage factor	NA	NA	NA	NA	NA
BBF55413.1|3944743_3946177_+	D-alanyl-D-alanine carboxypeptidase, penicillin-binding protein 4	NA	NA	NA	NA	NA
BBF55414.1|3946216_3947389_-	GTPase involved in cell partitioning and DNA repair	NA	NA	NA	NA	NA
BBF55415.1|3947404_3948370_-	inner membrane transporter	NA	NA	NA	NA	NA
BBF55416.1|3948496_3948754_-	50S ribosomal subunit protein L27	NA	NA	NA	NA	NA
BBF55417.1|3948774_3949086_-	50S ribosomal subunit protein L21	NA	NA	NA	NA	NA
BBF55418.1|3949344_3950316_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
BBF55419.1|3950542_3950821_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
BBF55420.1|3950868_3952128_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
BBF55421.1|3952182_3952452_-	acid stress protein	NA	NA	NA	NA	NA
BBF55422.1|3952596_3952890_-	phospholipid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
BBF55423.1|3952889_3953525_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
BBF55424.1|3953543_3954095_-	ABC-type organic solvent transporter	NA	NA	NA	NA	NA
BBF55425.1|3954099_3954882_-	ABC transporter permease	NA	NA	NA	NA	NA
BBF55426.1|3954889_3955699_-	organic solvent ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
BBF55427.1|3955908_3956886_+	calcium/sodium:proton antiporter	NA	NA	NA	NA	NA
BBF55428.1|3956899_3957886_+	D-arabinose 5-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
BBF55429.1|3957906_3958473_+	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
BBF55430.1|3958469_3959045_+	periplasmic membrane-anchored LPS-binding protein	NA	NA	NA	NA	NA
BBF55431.1|3959013_3959571_+	lipopolysaccharide export system protein LptA	NA	NA	NA	NA	NA
BBF55432.1|3959577_3960303_+	lipopolysaccharide export ABC transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
BBF55433.1|3960350_3961784_+	RNA polymerase sigma 54 factor RpoN	NA	NA	NA	NA	NA
BBF55434.1|3961806_3962094_+	ribosome hibernation promoting factor HPF	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
BBF55435.1|3962211_3962703_+	sugar-specific enzyme IIA component of PTS	NA	NA	NA	NA	NA
BBF55436.1|3962748_3963603_+	nucleotide-binding protein	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
BBF55437.1|3963599_3963872_+	phosphohistidinoprotein-hexose phosphotransferase component of N-regulated PTS system	NA	NA	NA	NA	NA
BBF55438.1|3964085_3964718_+	Mg(2+)-starvation-stimulated protein	NA	NA	NA	NA	NA
BBF55439.1|3964714_3965443_-	biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
BBF55440.1|3965439_3966093_-	isoprenoid biosynthesis protein with amidotransferase-like domain	NA	NA	NA	NA	NA
BBF55441.1|3966322_3968659_-	aerobic respiration control sensor histidine protein kinase	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
BBF55442.1|3968754_3969684_-	Fe-S oxidoreductase	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
BBF55443.1|3970265_3974819_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
BBF55444.1|3974831_3976250_+	glutamate synthase small subunit	NA	NA	NA	NA	NA
BBF55445.1|3976433_3976805_+	hypothetical protein	NA	NA	NA	NA	NA
BBF55446.1|3976932_3977481_+	hypothetical protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	2.3e-73
BBF55447.1|3977540_3978005_-	hypothetical protein	NA	NA	NA	NA	NA
BBF55448.1|3978001_3978877_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
BBF55449.1|3978873_3979563_-	N-acetylmannosamine-6-P epimerase	NA	NA	NA	NA	NA
BBF55450.1|3979610_3981101_-	sialic acid transporter	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
BBF55451.1|3981210_3982104_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
BBF55452.1|3982225_3983017_-	sialic acid-inducible nan operon repressor	NA	NA	NA	NA	NA
BBF55453.1|3983396_3984764_+	transporter	NA	NA	NA	NA	NA
BBF55454.1|3984806_3985304_-|protease	ClpXP protease specificity enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
BBF55455.1|3985309_3985948_-	stringent starvation protein A	NA	NA	NA	NA	NA
BBF55456.1|3986342_3986735_-	30S ribosomal subunit protein S9	NA	NA	NA	NA	NA
BBF55457.1|3986750_3987179_-	50S ribosomal subunit protein L13	NA	NA	NA	NA	NA
BBF55458.1|3987397_3988525_-	cell division protein ZapE	NA	NA	NA	NA	NA
BBF55459.1|3988718_3989117_+	inner membrane-anchored protein	NA	NA	NA	NA	NA
BBF55460.1|3989270_3990638_+|protease	serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	3.9e-21
BBF55461.1|3990727_3991795_+|protease	serine endoprotease	protease	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 24
AP018802	Escherichia coli E2863 DNA, complete genome	5357442	4904297	4942421	5357442	transposase,protease,terminase,tRNA,portal,tail,head,integrase,holin	Enterobacteria_phage(41.03%)	43	4919767:4919780	4945170:4945183
BBF56290.1|4904297_4904831_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
BBF56291.1|4905027_4905201_+	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
BBF56292.1|4905248_4905530_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
BBF56293.1|4906022_4906754_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	2.8e-135
BBF56294.1|4906831_4907419_+	hypothetical protein	NA	A5LH76	Enterobacteria_phage	99.0	1.0e-111
BBF56295.1|4907432_4908185_+	phage antitermination protein Q	NA	K7PGU5	Enterobacteria_phage	99.2	5.3e-137
BBF56296.1|4909464_4911315_+	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	96.9	0.0e+00
BBF56297.1|4911763_4911970_+|holin	phage holine protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
BBF56298.1|4911969_4912467_+	phage lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
BBF56299.1|4912463_4912931_+	phage murein endopeptidase	NA	Q7AYI6	Enterobacteria_phage	80.1	4.0e-58
BBF56300.1|4913396_4913711_+	PchABC family transcriptional regulator	NA	NA	NA	NA	NA
BBF56301.1|4913758_4913923_-	hypothetical protein	NA	A0A0P0ZCA1	Stx2-converting_phage	96.8	6.5e-08
BBF56302.1|4913964_4914495_+	DNase	NA	H6WZK7	Escherichia_phage	93.2	1.2e-90
BBF56303.1|4914610_4915174_+|terminase	phage terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.1	7.3e-83
BBF56304.1|4915170_4916832_+|terminase	phage terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	98.7	0.0e+00
BBF56305.1|4916895_4918833_+|head,protease	phage prohead protease	head,protease	H6WZL0	Escherichia_phage	98.4	0.0e+00
BBF56306.1|4918877_4919099_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
BBF56307.1|4919044_4920409_+|portal	phage portal protein	portal	B6DZX6	Stx2-converting_phage	96.9	2.5e-254
4919767:4919780	attL	CAACTGGGACAGCG	NA	NA	NA	NA
BBF56308.1|4920405_4921383_+|portal	phage portal protein	portal	B6DZX7	Stx2-converting_phage	79.2	9.2e-57
BBF56309.1|4921462_4921789_+	phage DNA packaging protein	NA	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
BBF56310.1|4921798_4922149_+|head,tail	phage head-tail adaptor	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
BBF56311.1|4922145_4922592_+|tail	phage minor tail protein	tail	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
BBF56312.1|4922588_4922933_+|tail	phage minor tail protein	tail	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
BBF56313.1|4922999_4923716_+|tail	phage major tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.3	2.1e-127
BBF56314.1|4923721_4924096_+|tail	phage tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
BBF56315.1|4924191_4924401_+|tail	phage minor tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
BBF56316.1|4924452_4927695_+|tail	phage tail length tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.2	0.0e+00
BBF56317.1|4927687_4928029_+|tail	phage minor tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
BBF56318.1|4928028_4928727_+|tail	phage minor tail protein	tail	H6WZM3	Escherichia_phage	98.3	3.1e-131
BBF56319.1|4928737_4929481_+|tail	phage tail assembly protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
BBF56320.1|4929477_4930059_+|tail	phage tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	89.6	8.6e-87
BBF56321.1|4930294_4933771_+	phage host specificity protein	NA	Q6H9T2	Enterobacteria_phage	96.1	0.0e+00
BBF56322.1|4933839_4934463_+	outer membrane protein Lom	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
BBF56323.1|4934527_4935841_+|tail	phage tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
BBF56324.1|4935842_4936112_+	hypothetical protein	NA	B6DZB8	Enterobacteria_phage	98.9	2.4e-44
BBF56325.1|4936287_4936695_+	T3SS secreted effector NleG	NA	B6DZB9	Enterobacteria_phage	96.2	5.7e-69
BBF56326.1|4936824_4937883_-	T3SS secreted effector EspW	NA	NA	NA	NA	NA
BBF56327.1|4938429_4938612_-	T3SS secreted effector NleG	NA	B6ETE1	Enterobacteria_phage	52.6	2.9e-09
BBF56328.1|4938794_4939385_+	T3SS secreted effector EspM	NA	NA	NA	NA	NA
BBF56329.1|4939886_4940135_-	DNA-damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
BBF56330.1|4940196_4940526_-|integrase	integrase	integrase	S5MDN5	Escherichia_phage	99.1	1.7e-55
BBF56331.1|4940530_4941295_-|integrase	integrase	integrase	S5MDN5	Escherichia_phage	99.6	3.1e-145
BBF56332.1|4941383_4942421_+|tRNA	tRNA-dihydrouridine synthase A	tRNA	NA	NA	NA	NA
4945170:4945183	attR	CGCTGTCCCAGTTG	NA	NA	NA	NA
>prophage 25
AP018802	Escherichia coli E2863 DNA, complete genome	5357442	5025235	5120920	5357442	integrase,transposase,tRNA,protease	Escherichia_phage(19.23%)	92	5098796:5098825	5124287:5124316
BBF56411.1|5025235_5025925_-|tRNA	lysine tRNA synthetase	tRNA	A0A1V0SAC0	Catovirus	39.5	1.2e-39
BBF56412.1|5026009_5026336_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF56413.1|5026335_5027223_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF56414.1|5027029_5027425_-	outer membrane usher protein FimD	NA	A0A0N7C1Y0	Escherichia_phage	94.0	1.6e-44
BBF56415.1|5027596_5037268_-	adherence factor Efa1	NA	NA	NA	NA	NA
BBF56416.1|5037918_5038707_-	endonuclease	NA	NA	NA	NA	NA
BBF56417.1|5039141_5039816_-	T3SS secreted effector NleE	NA	NA	NA	NA	NA
BBF56418.1|5039864_5040854_-	T3SS secreted effector NleB	NA	Q8HAB2	Salmonella_phage	58.5	1.1e-97
BBF56419.1|5041462_5041921_-	T3SS secreted effector EspL	NA	NA	NA	NA	NA
BBF56420.1|5042026_5043112_-	T3SS secreted effector EspL	NA	NA	NA	NA	NA
BBF56421.1|5043939_5044812_-|transposase	IS609 transposase	transposase	A0A1W6JP07	Morganella_phage	97.4	1.1e-146
BBF56422.1|5044942_5045494_+|transposase	IS609 transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.7	6.6e-36
BBF56423.1|5045933_5046728_+	hypothetical protein	NA	NA	NA	NA	NA
BBF56424.1|5046798_5047248_-	50S ribosomal subunit protein L9	NA	NA	NA	NA	NA
BBF56425.1|5047289_5047517_-	30S ribosomal subunit protein S18	NA	NA	NA	NA	NA
BBF56426.1|5047521_5047836_-	primosomal protein N	NA	NA	NA	NA	NA
BBF56427.1|5047842_5048238_-	30S ribosomal subunit protein S6	NA	NA	NA	NA	NA
BBF56428.1|5048564_5048840_+	hypothetical protein	NA	NA	NA	NA	NA
BBF56429.1|5048968_5049655_-	L-ribulose 5-phosphate 4-epimerase	NA	NA	NA	NA	NA
BBF56430.1|5049654_5050509_-	L-xylulose 5-phosphate 3-epimerase	NA	NA	NA	NA	NA
BBF56431.1|5050518_5051169_-	3-keto-L-gulonate 6-phosphate decarboxylase	NA	NA	NA	NA	NA
BBF56432.1|5051182_5051647_-	L-ascorbate-specific enzyme IIA component of PTS	NA	NA	NA	NA	NA
BBF56433.1|5051656_5051962_-	L-ascorbate-specific enzyme IIB component of PTS	NA	NA	NA	NA	NA
BBF56434.1|5051977_5053375_-	L-ascorbate-specific enzyme IIC permease component of PTS	NA	NA	NA	NA	NA
BBF56435.1|5053729_5054794_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
BBF56436.1|5054901_5055657_+	transcriptional repressor	NA	NA	NA	NA	NA
BBF56437.1|5055653_5056403_-	acyl CoA esterase	NA	NA	NA	NA	NA
BBF56438.1|5056584_5056914_+	biofilm peroxide resistance protein	NA	NA	NA	NA	NA
BBF56439.1|5057062_5057338_+	hypothetical protein	NA	NA	NA	NA	NA
BBF56440.1|5057454_5059080_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
BBF56441.1|5059163_5060327_-	ATP-Grasp family ATPase	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
BBF56442.1|5060329_5060968_-	hypothetical protein	NA	NA	NA	NA	NA
BBF56443.1|5060977_5061376_-	inner membrane protein	NA	NA	NA	NA	NA
BBF56444.1|5061393_5062053_-	hypothetical protein	NA	NA	NA	NA	NA
BBF56445.1|5062103_5062802_-	hypothetical protein	NA	NA	NA	NA	NA
BBF56446.1|5062820_5063222_-	hypothetical protein	NA	NA	NA	NA	NA
BBF56447.1|5063348_5064080_-	23S rRNA mG2251 2'-O-ribose methyltransferase	NA	NA	NA	NA	NA
BBF56448.1|5064259_5066620_-	exoribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.2e-67
BBF56449.1|5066658_5067084_-	nitric oxide-sensitive repressor for NO regulon	NA	NA	NA	NA	NA
BBF56450.1|5067288_5068587_-	adenylosuccinate synthetase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
BBF56451.1|5068690_5068888_-	transcriptional regulator	NA	NA	NA	NA	NA
BBF56452.1|5068969_5069974_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
BBF56453.1|5069976_5071236_-|protease	modulator for HflB protease specific for phage lambda cII repressor	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
BBF56454.1|5071321_5072602_-	GTP-binding protein HflX	NA	NA	NA	NA	NA
BBF56455.1|5072678_5072987_-	RNA-binding protein Hfq	NA	NA	NA	NA	NA
BBF56456.1|5073072_5074023_-|tRNA	delta(2)-isopentenylpyrophosphate tRNA-adenosine transferase	tRNA	NA	NA	NA	NA
BBF56457.1|5074015_5075863_-	methyl-directed mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
BBF56458.1|5075872_5077210_-	N-acetylmuramoyl-l-alanine amidase II	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
BBF56459.1|5077228_5077690_-|tRNA	tRNA(ANN) t(6)A37 threonylcarbamoyladenosine modification protein	tRNA	NA	NA	NA	NA
BBF56460.1|5077661_5079194_-	carbohydrate kinase	NA	NA	NA	NA	NA
BBF56461.1|5079207_5080347_+	epoxyqueuosine reductase	NA	NA	NA	NA	NA
BBF56462.1|5081241_5081787_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
BBF56463.1|5081881_5082934_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
BBF56464.1|5083030_5083999_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
BBF56465.1|5084020_5087344_+	mechanosensitive channel protein	NA	NA	NA	NA	NA
BBF56466.1|5087372_5087675_-	inner membrane protein	NA	NA	NA	NA	NA
BBF56467.1|5087683_5087998_-	hypothetical protein	NA	NA	NA	NA	NA
BBF56468.1|5088049_5089507_-	transporter	NA	NA	NA	NA	NA
BBF56469.1|5089770_5090748_-	elongation factor	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
BBF56470.1|5091072_5092881_+	anaerobic fumarate reductase catalytic and NAD/flavoprotein subunit	NA	NA	NA	NA	NA
BBF56471.1|5092873_5093608_+	fumarate reductase Fe-S subunit	NA	NA	NA	NA	NA
BBF56472.1|5093618_5094014_+	fumarate reductase membrane anchor subunit	NA	NA	NA	NA	NA
BBF56473.1|5094024_5094384_+	fumarate reductase membrane anchor subunit	NA	NA	NA	NA	NA
BBF56474.1|5094446_5095580_+	beta-lactamase	NA	NA	NA	NA	NA
BBF56475.1|5095668_5096202_+	outer membrane lipoprotein Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
BBF56476.1|5096198_5096516_-	multidrug efflux system protein	NA	NA	NA	NA	NA
BBF56477.1|5096697_5096844_-	entericidin B membrane lipoprotein	NA	NA	NA	NA	NA
BBF56478.1|5096954_5097080_-	entericidin A	NA	NA	NA	NA	NA
BBF56479.1|5097131_5097698_-	polyproline-specific translation elongation factor EF-P	NA	NA	NA	NA	NA
BBF56480.1|5097739_5098768_+	EF-P-Lys34 lysylation protein	NA	NA	NA	NA	NA
5098796:5098825	attL	GCCTGATGCGCTACGCTTATCAGGCCTACA	NA	NA	NA	NA
BBF56481.1|5099157_5100027_+	hypothetical protein	NA	NA	NA	NA	NA
BBF56482.1|5100230_5100584_-	hypothetical protein	NA	NA	NA	NA	NA
BBF56483.1|5100721_5102368_-	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
BBF56484.1|5102411_5102705_-	co-chaperonin GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
BBF56485.1|5102980_5104237_+	transporter	NA	NA	NA	NA	NA
BBF56486.1|5104252_5104729_-	exclusion suppressor FxsA	NA	NA	NA	NA	NA
BBF56487.1|5105065_5106502_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
BBF56488.1|5106619_5107921_+	C4-dicarboxylate antiporter	NA	NA	NA	NA	NA
BBF56489.1|5108036_5108375_+	divalent-cation tolerance protein	NA	NA	NA	NA	NA
BBF56490.1|5108350_5110048_+	thiol:disulfide interchange protein and activator of DsbC	NA	NA	NA	NA	NA
BBF56491.1|5110084_5110660_+	transcriptional regulator	NA	NA	NA	NA	NA
BBF56492.1|5111039_5112305_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
BBF56493.1|5112421_5113207_-	hypothetical protein	NA	A0A0P0ZBS5	Stx2-converting_phage	99.0	2.3e-114
BBF56494.1|5113295_5113625_+|transposase	ISSfl3 transposase	transposase	NA	NA	NA	NA
BBF56495.1|5113751_5113970_+|transposase	ISSfl3 transposase	transposase	NA	NA	NA	NA
BBF56496.1|5113966_5114314_+|transposase	ISSfl3 transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	72.0	1.0e-42
BBF56497.1|5114333_5115782_+|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	55.6	3.5e-137
BBF56498.1|5116635_5117169_-	PagC-like membrane protein	NA	Q9LA63	Enterobacterial_phage	32.4	1.2e-15
BBF56499.1|5118485_5119283_+|transposase	transposase	transposase	NA	NA	NA	NA
BBF56500.1|5119322_5120210_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF56501.1|5120209_5120536_-|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF56502.1|5120629_5120920_+|transposase	IS609 transposase	transposase	A0A1W6JP07	Morganella_phage	99.0	7.2e-42
5124287:5124316	attR	GCCTGATGCGCTACGCTTATCAGGCCTACA	NA	NA	NA	NA
>prophage 26
AP018802	Escherichia coli E2863 DNA, complete genome	5357442	5185140	5245567	5357442	integrase,transposase,protease	Escherichia_phage(58.33%)	54	5177899:5177919	5221248:5221268
5177899:5177919	attL	GGGAGAGGGTTAGGGTGAGGG	NA	NA	NA	NA
BBF56560.1|5185140_5185851_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	42.7	1.8e-41
BBF56561.1|5185854_5186517_+	hypothetical protein	NA	NA	NA	NA	NA
BBF56562.1|5187030_5187948_-	hypothetical protein	NA	NA	NA	NA	NA
BBF56563.1|5187940_5188714_-	hypothetical protein	NA	NA	NA	NA	NA
BBF56564.1|5189293_5190643_-	hypothetical protein	NA	NA	NA	NA	NA
BBF56565.1|5190761_5192846_-|protease	ATP-dependent Lon protease	protease	NA	NA	NA	NA
BBF56566.1|5192856_5195454_-	alkaline phosphatase	NA	NA	NA	NA	NA
BBF56567.1|5195630_5199305_-	hypothetical protein	NA	NA	NA	NA	NA
BBF56568.1|5199350_5202992_-	ATPase-like protein	NA	NA	NA	NA	NA
BBF56569.1|5203003_5203606_-	hypothetical protein	NA	NA	NA	NA	NA
BBF56570.1|5203602_5204208_-	membrane protein	NA	NA	NA	NA	NA
BBF56571.1|5204501_5205188_+	hypothetical protein	NA	NA	NA	NA	NA
BBF56572.1|5205315_5205498_+	hypothetical protein	NA	NA	NA	NA	NA
BBF56573.1|5205608_5206481_-	restriction endonuclease	NA	NA	NA	NA	NA
BBF56574.1|5206692_5207673_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	55.9	9.4e-102
BBF56575.1|5207737_5208844_-	N-acetylneuraminic acid mutarotase	NA	NA	NA	NA	NA
BBF56576.1|5208863_5209580_-	N-acetylneuraminic acid outer membrane channel protein	NA	NA	NA	NA	NA
BBF56577.1|5211035_5211638_+	type 1 fimbriae regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	51.8	1.5e-54
BBF56578.1|5212115_5212712_+	type 1 fimbriae regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
BBF56579.1|5213192_5213741_+	major type 1 subunit fimbrin	NA	NA	NA	NA	NA
BBF56580.1|5213898_5214345_+	fimbrial protein involved in type 1 pilus biosynthesis	NA	NA	NA	NA	NA
BBF56581.1|5214381_5215107_+	periplasmic chaperone	NA	NA	NA	NA	NA
BBF56582.1|5215173_5217927_+	outer membrane usher protein FimD	NA	A0A0N7C1Y0	Escherichia_phage	100.0	2.5e-43
BBF56583.1|5217733_5218621_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF56584.1|5218620_5218947_-|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF56585.1|5219133_5219664_+	minor component of type 1 fimbriae	NA	NA	NA	NA	NA
BBF56586.1|5219676_5220180_+	minor component of type 1 fimbriae	NA	NA	NA	NA	NA
BBF56587.1|5220199_5221102_+	minor component of type 1 fimbriae	NA	NA	NA	NA	NA
BBF56588.1|5221123_5221447_+	hypothetical protein	NA	NA	NA	NA	NA
5221248:5221268	attR	CCCTCACCCTAACCCTCTCCC	NA	NA	NA	NA
BBF56589.1|5221351_5222695_-	fructuronate transporter	NA	NA	NA	NA	NA
BBF56590.1|5223034_5224219_+	mannonate hydrolase	NA	NA	NA	NA	NA
BBF56591.1|5224299_5225760_+	NAD-dependent D-mannonate oxidoreductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	7.3e-50
BBF56592.1|5225781_5225976_-	hypothetical protein	NA	NA	NA	NA	NA
BBF56593.1|5226022_5226748_+	fructuronate-inducible hexuronate regulon transcriptional repressor	NA	NA	NA	NA	NA
BBF56594.1|5226888_5227719_-	hypothetical protein	NA	NA	NA	NA	NA
BBF56595.1|5228390_5228783_+	DNA replication protein IraD	NA	NA	NA	NA	NA
BBF56596.1|5228775_5229687_-	hypochlorite-responsive transcription factor	NA	NA	NA	NA	NA
BBF56597.1|5229751_5230924_-	isoaspartyl dipeptidase	NA	NA	NA	NA	NA
BBF56598.1|5230936_5231398_-	SpmB family inner membrane protein	NA	NA	NA	NA	NA
BBF56599.1|5231394_5232078_-	nucleoside recognition pore and gate family inner membrane transporter	NA	NA	NA	NA	NA
BBF56600.1|5232327_5232882_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
BBF56601.1|5232894_5234073_-	transport protein	NA	NA	NA	NA	NA
BBF56602.1|5234140_5235112_-	hypothetical protein	NA	NA	NA	NA	NA
BBF56603.1|5235065_5235323_-	hypothetical protein	NA	NA	NA	NA	NA
BBF56604.1|5235319_5236087_-	activator of (R)-hydroxyglutaryl-CoA dehydratase	NA	NA	NA	NA	NA
BBF56605.1|5236096_5237248_-	2-hydroxyglutaryl-CoA dehydratase	NA	NA	NA	NA	NA
BBF56606.1|5237363_5238644_-	zinc-type alcohol dehydrogenase-like protein	NA	NA	NA	NA	NA
BBF56607.1|5238684_5239917_-	multidrug efflux system protein	NA	NA	NA	NA	NA
BBF56608.1|5240383_5241340_+	hypothetical protein	NA	Q2A0A7	Sodalis_phage	51.2	1.7e-60
BBF56609.1|5241584_5242997_-	transcriptional regulator/aminotransferase	NA	NA	NA	NA	NA
BBF56610.1|5243173_5243338_+	hypothetical protein	NA	NA	NA	NA	NA
BBF56611.1|5243689_5244328_+	penicillin G acylase precursor	NA	NA	NA	NA	NA
BBF56612.1|5244353_5244680_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF56613.1|5244679_5245567_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
>prophage 27
AP018802	Escherichia coli E2863 DNA, complete genome	5357442	5280635	5329457	5357442	protease,terminase,portal,tail,lysis,integrase	Enterobacteria_phage(39.66%)	62	5275239:5275253	5304394:5304408
5275239:5275253	attL	TGTCGCGGATCTCAT	NA	NA	NA	NA
BBF56648.1|5280635_5281859_+|integrase	integrase	integrase	A0A291AWU1	Escherichia_phage	97.8	1.5e-234
BBF56649.1|5282230_5283457_-	deoxyguanosine triphosphate triphosphohydrolase	NA	NA	NA	NA	NA
BBF56650.1|5283687_5283903_-	hypothetical protein	NA	A5LH59	Enterobacteria_phage	98.4	1.1e-31
BBF56651.1|5283902_5284265_-	putative phage protein	NA	Q9EY98	Enterobacteria_phage	96.7	1.9e-68
BBF56652.1|5284261_5284633_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.2	8.0e-46
BBF56653.1|5284629_5285145_-	hypothetical protein	NA	G9L6B3	Escherichia_phage	100.0	2.4e-101
BBF56654.1|5285146_5285335_-	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	98.4	1.4e-30
BBF56655.1|5285331_5285508_-	hypothetical protein	NA	A0A0F6TJP6	Escherichia_coli_O157_typing_phage	84.5	3.9e-19
BBF56656.1|5285507_5285870_-	putative phage protein	NA	A0A1B0V865	Salmonella_phage	97.4	8.9e-58
BBF56657.1|5285866_5286076_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	92.8	2.0e-33
BBF56658.1|5286077_5286710_-	hypothetical protein	NA	A0A2D1GLY5	Escherichia_phage	77.1	2.7e-78
BBF56659.1|5286706_5287441_-	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	55.2	1.7e-39
BBF56660.1|5287437_5287728_-	hypothetical protein	NA	A0A2I6TCB0	Escherichia_phage	82.3	1.2e-36
BBF56661.1|5287724_5288075_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	95.7	2.8e-56
BBF56662.1|5288065_5288602_-	hypothetical protein	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
BBF56663.1|5288729_5289554_-	hypothetical protein	NA	Q8SBF9	Shigella_phage	100.0	3.5e-150
BBF56664.1|5289619_5289982_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
BBF56665.1|5290396_5290765_-	hypothetical protein	NA	NA	NA	NA	NA
BBF56666.1|5290942_5291569_-	phage repressor protein CI	NA	K7PM82	Enterobacteria_phage	48.8	3.2e-47
BBF56667.1|5291666_5291867_+	phage antirepressor protein Cro	NA	NA	NA	NA	NA
BBF56668.1|5291904_5292489_+	transcriptional regulator	NA	A0A1C9II13	Salmonella_phage	60.9	5.5e-57
BBF56669.1|5292485_5292824_+	hypothetical protein	NA	U5P0J9	Shigella_phage	97.3	5.0e-55
BBF56670.1|5292833_5293826_+	replication protein	NA	U5P0A0	Shigella_phage	95.8	4.0e-92
BBF56671.1|5293920_5294574_+	DNA adenine methylase	NA	A0A0P0ZCC0	Stx2-converting_phage	99.5	3.3e-127
BBF56672.1|5294570_5294897_+	repressor	NA	A0A291AWY9	Escherichia_phage	99.1	2.0e-53
BBF56673.1|5294893_5295289_+	phage holliday junction resolvase	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
BBF56674.1|5295440_5296256_+	hypothetical protein	NA	U5P4K5	Shigella_phage	99.6	2.9e-149
BBF56675.1|5296263_5297253_+	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	99.1	1.1e-193
BBF56676.1|5297266_5298019_+	phage antitermination protein Q	NA	Q8SBE4	Shigella_phage	98.4	2.6e-136
BBF56677.1|5298308_5298725_+	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	99.3	8.6e-73
BBF56678.1|5299420_5301367_+	hypothetical protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	99.2	0.0e+00
BBF56679.1|5301504_5301684_+	hypothetical protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
BBF56680.1|5301724_5301970_+	hypothetical protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
BBF56681.1|5302047_5302263_+|lysis	phage lysis protein	lysis	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
BBF56682.1|5302267_5302801_+	phage endolysin	NA	A0A1I9LJR4	Stx_converting_phage	98.9	2.5e-101
BBF56683.1|5303098_5303566_+	phage endopeptidase	NA	Q7AYI6	Enterobacteria_phage	96.1	1.8e-74
BBF56684.1|5303978_5304455_+|terminase	phage terminase small subunit	terminase	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
5304394:5304408	attR	ATGAGATCCGCGACA	NA	NA	NA	NA
BBF56685.1|5304451_5306575_+|terminase	phage terminase large subunit	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
BBF56686.1|5306571_5306784_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
BBF56687.1|5306783_5308286_+|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	100.0	1.8e-290
BBF56688.1|5308230_5310255_+|protease	phage protease/scaffold protein	protease	Q8VNN5	Enterobacteria_phage	99.9	0.0e+00
BBF56689.1|5310342_5310669_+	membrane protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
BBF56690.1|5310661_5310943_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
BBF56691.1|5310945_5311569_+|tail	phage minor tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
BBF56692.1|5311581_5311980_+|tail	phage minor tail protein	tail	Q9EYD7	Enterobacteria_phage	99.2	1.0e-70
BBF56693.1|5311987_5312740_+|tail	phage major tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
BBF56694.1|5312753_5313176_+|tail	phage minor tail protein	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
BBF56695.1|5313202_5313511_+|tail	phage minor tail protein	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
BBF56696.1|5313554_5316200_+|tail	phage tail length tape measure protein	tail	Q687F3	Enterobacteria_phage	95.8	0.0e+00
BBF56697.1|5316196_5316526_+|tail	phage minor tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
BBF56698.1|5316525_5317224_+|tail	phage minor tail protein	tail	Q687F1	Enterobacteria_phage	98.3	1.4e-131
BBF56699.1|5317234_5317978_+|tail	phage tail assembly protein	tail	Q9EYE4	Enterobacteria_phage	98.0	1.7e-148
BBF56700.1|5317974_5318553_+|tail	phage tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	98.4	3.2e-94
BBF56701.1|5318793_5322273_+	phage host specificity protein	NA	B6DZB5	Enterobacteria_phage	97.2	0.0e+00
BBF56702.1|5322340_5322940_+	outer membrane precursor Lom	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	7.5e-110
BBF56703.1|5323004_5324318_+|tail	phage tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.4	1.7e-77
BBF56704.1|5324319_5324589_+	hypothetical protein	NA	Q6H9S8	Enterobacteria_phage	98.9	1.9e-44
BBF56705.1|5324873_5325524_-	T3SS secreted effector NleG	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
BBF56706.1|5326116_5326365_-	DNA-damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
BBF56707.1|5326584_5328171_+	peptide chain release factor RF-3	NA	D0R0F5	Streptococcus_phage	24.9	1.2e-29
BBF56708.1|5328563_5329169_+	salt-inducible ABC transporter periplasmic binding protein	NA	NA	NA	NA	NA
BBF56709.1|5329295_5329457_+	hypothetical protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 1
AP018803	Escherichia coli E2863 plasmid pE2863-1 DNA, complete genome	124261	2053	34060	124261	transposase	Escherichia_phage(38.46%)	38	NA	NA
BBF56738.1|2053_2341_+	toxin of the RelE-RelB toxin-antitoxin system	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	49.5	1.7e-19
BBF56739.1|2350_2896_+	hypothetical protein	NA	NA	NA	NA	NA
BBF56740.1|3138_3384_+	hypothetical protein	NA	NA	NA	NA	NA
BBF56741.1|3306_3492_-	hypothetical protein	NA	NA	NA	NA	NA
BBF56742.1|3547_4150_-	hypothetical protein	NA	NA	NA	NA	NA
BBF56743.1|4503_4809_+	hypothetical protein	NA	NA	NA	NA	NA
BBF56744.1|4777_7366_-|transposase	transposase	transposase	A0A1B0V7H9	Salmonella_phage	75.4	0.0e+00
BBF56745.1|7498_8203_-|transposase	IS26 transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
BBF56746.1|8800_9661_-	TEM-1 beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
BBF56747.1|9843_10176_-	DNA-invertase	NA	Q1MVP4	Enterobacteria_phage	100.0	3.0e-52
BBF56748.1|10245_10950_+|transposase	IS26 transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
BBF56749.1|11011_11719_+	plasmid replication protein A	NA	NA	NA	NA	NA
BBF56750.1|11705_12557_+	plasmid replication protein C	NA	NA	NA	NA	NA
BBF56751.1|12864_13680_+	sulfonamide-resistant dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
BBF56752.1|13740_14544_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
BBF56753.1|14543_15311_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
BBF56754.1|15339_15615_+|transposase	transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
BBF56755.1|15659_16037_+|transposase	IS1 transposase InsB	transposase	Q71TF0	Escherichia_phage	100.0	1.3e-67
BBF56756.1|16205_17021_+	aminoglycoside 3'-phosphotransferase	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
BBF56757.1|17210_17915_-|transposase	IS26 transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
BBF56758.1|17961_19230_-|transposase	transposase	transposase	NA	NA	NA	NA
BBF56759.1|19304_20012_-	hypothetical protein	NA	NA	NA	NA	NA
BBF56760.1|20008_20245_-	mercury resistance protein MerE	NA	NA	NA	NA	NA
BBF56761.1|20241_20604_-	mercuric resistance operon coregulator MerD	NA	NA	NA	NA	NA
BBF56762.1|20621_22316_-	mercuric reductase MerA	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
BBF56763.1|22367_22790_-	mercury transport protein MerC	NA	NA	NA	NA	NA
BBF56764.1|23154_24342_-|transposase	IS91 transposase	transposase	NA	NA	NA	NA
BBF56765.1|24341_24707_-|transposase	IS91 transposase	transposase	NA	NA	NA	NA
BBF56766.1|24982_26170_-|transposase	IS91 transposase	transposase	NA	NA	NA	NA
BBF56767.1|26169_26535_-|transposase	IS91 transposase	transposase	NA	NA	NA	NA
BBF56768.1|26616_26757_-	mercuric transport protein periplasmic component precursor MerP	NA	NA	NA	NA	NA
BBF56769.1|26770_27121_-	mercuric ion transport protein MerT	NA	NA	NA	NA	NA
BBF56770.1|27192_27627_+	mercuric resistance operon regulatory protein MerR	NA	NA	NA	NA	NA
BBF56771.1|28629_28872_+|transposase	transposase	transposase	NA	NA	NA	NA
BBF56772.1|28903_29581_-	tetracycline repressor protein TetR	NA	NA	NA	NA	NA
BBF56773.1|29659_30859_+	tetracycline resistance structural protein TetA	NA	NA	NA	NA	NA
BBF56774.1|30890_31775_-	transporter permease protein	NA	NA	NA	NA	NA
BBF56775.1|32263_34060_+|transposase	transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
>prophage 1
AP018804	Escherichia coli E2863 plasmid pE2863-2 DNA, complete genome	92925	2308	92152	92925	tail,tRNA	Escherichia_phage(89.72%)	111	NA	NA
BBF56876.1|2308_2884_+	hypothetical protein	NA	A0A222YWJ0	Escherichia_phage	100.0	3.1e-105
BBF56877.1|2883_3276_+	hypothetical protein	NA	A0A222YWH1	Escherichia_phage	100.0	2.9e-70
BBF56878.1|3384_3777_+	hypothetical protein	NA	NA	NA	NA	NA
BBF56879.1|3773_5138_+	hypothetical protein	NA	NA	NA	NA	NA
BBF56880.1|5137_6646_+	phage DNA packaging protein	NA	Q5QBP2	Enterobacteria_phage	57.0	4.3e-162
BBF56881.1|6673_7711_-	hypothetical protein	NA	Q5QBE5	Escherichia_phage	96.4	7.8e-06
BBF56882.1|8105_9134_+	recombinase	NA	Q5QBN6	Enterobacteria_phage	41.6	8.7e-58
BBF56883.1|9207_9552_+	hypothetical protein	NA	A0A222YYS6	Escherichia_phage	97.4	3.6e-56
BBF56884.1|9548_10025_+	hypothetical protein	NA	NA	NA	NA	NA
BBF56885.1|10021_10516_+	deoxyuridinetriphosphatase	NA	A0A222YYP1	Escherichia_phage	97.5	4.6e-89
BBF56886.1|10530_11181_+	hypothetical protein	NA	A0A1B0VBT1	Salmonella_phage	58.7	9.4e-66
BBF56887.1|11187_11955_+	hypothetical protein	NA	A0A222YXM9	Escherichia_phage	97.2	4.7e-133
BBF56888.1|11944_13039_+	phage DNA packaging protein	NA	Q71T61	Escherichia_phage	33.1	2.7e-41
BBF56889.1|13074_13455_-	death on curing protein	NA	Q71T66	Escherichia_phage	91.9	2.1e-57
BBF56890.1|13454_13676_-	hypothetical protein	NA	A0A222YXU1	Escherichia_phage	98.6	1.5e-31
BBF56891.1|13748_14138_-	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	100.0	8.3e-70
BBF56892.1|14225_14510_-	hypothetical protein	NA	NA	NA	NA	NA
BBF56893.1|14493_15243_-	hypothetical protein	NA	A0A1B0VDS6	Salmonella_phage	55.1	3.7e-74
BBF56894.1|15473_15767_-	hypothetical protein	NA	A0A077SK23	Escherichia_phage	95.9	2.0e-47
BBF56895.1|15790_16072_-	RNA-binding protein	NA	A5VWB6	Enterobacteria_phage	94.6	1.2e-46
BBF56896.1|16064_16691_-	putative phage protein	NA	A0A0P0ZD75	Stx2-converting_phage	90.1	4.3e-76
BBF56897.1|16687_16897_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	92.8	2.0e-33
BBF56898.1|17083_17260_-	hypothetical protein	NA	A0A077SK22	Escherichia_phage	100.0	5.3e-24
BBF56899.1|17432_17912_-	hypothetical protein	NA	A0A222YWN7	Escherichia_phage	69.0	1.0e-64
BBF56900.1|17908_18787_-	hypothetical protein	NA	A0A2R2Z314	Escherichia_phage	94.5	6.5e-171
BBF56901.1|18790_19471_-	morphogenetic protein	NA	Q71T76	Escherichia_phage	68.0	1.0e-83
BBF56902.1|19487_20483_-	hypothetical protein	NA	A0A222YWL6	Escherichia_phage	94.9	1.4e-190
BBF56903.1|20581_21274_-	serine/threonine-specific protein phosphatase 1	NA	A0A222YWF0	Escherichia_phage	97.0	8.6e-134
BBF56904.1|21270_21582_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	97.1	2.6e-58
BBF56905.1|21578_21803_-	hypothetical protein	NA	A0A222YYR6	Escherichia_phage	93.2	5.5e-34
BBF56906.1|21799_22075_-	hypothetical protein	NA	A0A222YWQ2	Escherichia_phage	83.5	1.6e-35
BBF56907.1|22071_22320_-	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	87.3	3.1e-30
BBF56908.1|22316_22976_-	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	96.6	6.2e-41
BBF56909.1|22984_23395_-	hypothetical protein	NA	A0A076G6X8	Escherichia_phage	77.2	3.0e-33
BBF56910.1|23391_23895_-	hypothetical protein	NA	A0A0U2QW67	Escherichia_phage	65.8	9.5e-42
BBF56911.1|23884_24202_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	92.4	1.3e-49
BBF56912.1|24198_24810_-	hypothetical protein	NA	A0A222YYT7	Escherichia_phage	98.5	7.6e-110
BBF56913.1|24809_24962_-	hypothetical protein	NA	A0A222YXL5	Escherichia_phage	100.0	6.4e-18
BBF56914.1|25082_25661_+	hypothetical protein	NA	A0A222YXV2	Escherichia_phage	94.3	3.0e-71
BBF56915.1|25992_26160_+	hypothetical protein	NA	A0A222YWH9	Escherichia_phage	98.2	1.9e-23
BBF56916.1|26472_26688_+	hypothetical protein	NA	A0A222YWG3	Escherichia_phage	95.7	6.3e-35
BBF56917.1|26687_27629_+	DNA-binding protein	NA	A0A222YWG0	Escherichia_phage	80.2	9.8e-141
BBF56918.1|27688_27973_+	hypothetical protein	NA	A0A222YY28	Escherichia_phage	97.9	2.8e-43
BBF56919.1|28118_28469_+	hypothetical protein	NA	A0A222YZD3	Escherichia_phage	100.0	9.2e-60
BBF56920.1|28509_29394_-	hypothetical protein	NA	A0A222YYN1	Escherichia_phage	90.9	8.9e-152
BBF56921.1|29677_30331_+	hypothetical protein	NA	A0A222YZ79	Escherichia_phage	99.5	4.9e-115
BBF56922.1|30331_30466_-	hypothetical protein	NA	A0A222YWM1	Escherichia_phage	95.5	4.3e-10
BBF56923.1|30659_30989_+	hypothetical protein	NA	A0A222YYR0	Escherichia_phage	100.0	3.6e-58
BBF56924.1|30981_32175_+	hypothetical protein	NA	A0A222YXT1	Escherichia_phage	99.5	5.7e-202
BBF56925.1|32208_32937_-	hypothetical protein	NA	A0A222YY57	Escherichia_phage	57.5	1.4e-70
BBF56926.1|32958_33159_-	transcription regulator	NA	A0A222YXG1	Escherichia_phage	90.8	8.1e-29
BBF56927.1|33215_33554_-	transcriptional regulator	NA	A0A222YWD7	Escherichia_phage	100.0	1.3e-55
BBF56928.1|33624_33927_-	toxin-plasmid maintenance system killer protein	NA	A0A222YWE2	Escherichia_phage	100.0	5.9e-55
BBF56929.1|34089_34881_+	hypothetical protein	NA	A0A222YXU3	Escherichia_phage	98.9	7.5e-150
BBF56930.1|34877_35645_+	hypothetical protein	NA	A0A222YWF4	Escherichia_phage	100.0	4.4e-139
BBF56931.1|35648_36629_+	hypothetical protein	NA	A0A222YXZ0	Escherichia_phage	100.0	2.5e-187
BBF56932.1|36625_37279_+	hypothetical protein	NA	A0A222YWF1	Escherichia_phage	97.7	1.5e-100
BBF56933.1|37338_38244_+	recombination-associated protein rdgC	NA	A0A222YY21	Escherichia_phage	89.7	1.3e-150
BBF56934.1|38227_40516_+	DNA adenine methyltransferase	NA	A0A077SL51	Escherichia_phage	58.8	0.0e+00
BBF56935.1|40564_42226_-|tRNA	glutamyl-tRNA synthetase	tRNA	A0A222YZ70	Escherichia_phage	99.5	0.0e+00
BBF56936.1|42494_42782_-	hypothetical protein	NA	A0A222YZA7	Escherichia_phage	100.0	8.1e-46
BBF56937.1|42774_43416_-	partitioning protein ParA	NA	A0A222YXS3	Escherichia_phage	99.5	6.3e-115
BBF56938.1|43703_44042_-	plasmid stable inheritance protein StbB	NA	A0A222YWJ6	Escherichia_phage	99.1	2.6e-51
BBF56939.1|44055_45012_-	plasmid partition protein	NA	A0A222YXF2	Escherichia_phage	99.4	6.4e-180
BBF56940.1|45278_45563_+	hypothetical protein	NA	A0A222YXW1	Escherichia_phage	83.0	4.0e-37
BBF56941.1|45562_46366_+	hypothetical protein	NA	A0A222YXK1	Escherichia_phage	97.8	2.3e-114
BBF56942.1|46405_46897_+	hypothetical protein	NA	A0A222YWG1	Escherichia_phage	100.0	1.2e-62
BBF56943.1|47050_47509_-	hypothetical protein	NA	A0A222YWJ4	Escherichia_phage	100.0	2.1e-88
BBF56944.1|47525_47918_-	hypothetical protein	NA	A0A222YXX4	Escherichia_phage	99.2	1.5e-66
BBF56945.1|48076_49774_+	hypothetical protein	NA	A0A222YWC7	Escherichia_phage	100.0	0.0e+00
BBF56946.1|49921_50200_+	hypothetical protein	NA	A0A222YWH8	Escherichia_phage	98.9	9.0e-42
BBF56947.1|50267_51926_+	hypothetical protein	NA	A0A222YWC8	Escherichia_phage	97.8	1.7e-305
BBF56948.1|51970_52705_+	hypothetical protein	NA	A0A222YXT7	Escherichia_phage	100.0	5.9e-125
BBF56949.1|52796_53345_+	hypothetical protein	NA	A0A222YY02	Escherichia_phage	99.5	2.1e-95
BBF56950.1|53353_53845_+	hypothetical protein	NA	A0A222YWE4	Escherichia_phage	100.0	3.5e-89
BBF56951.1|53899_54451_+	hypothetical protein	NA	A0A222YWE3	Escherichia_phage	99.5	4.6e-98
BBF56952.1|54466_55174_+	hypothetical protein	NA	A0A222YY05	Escherichia_phage	99.6	1.4e-126
BBF56953.1|55408_56269_-	replication protein RepFIB	NA	Q71TL8	Escherichia_phage	84.1	2.8e-134
BBF56954.1|56623_57445_+	hypothetical protein	NA	A0A222YZ63	Escherichia_phage	98.9	5.0e-157
BBF56955.1|57591_61242_+	hypothetical protein	NA	A0A222YXR4	Escherichia_phage	98.0	0.0e+00
BBF56956.1|61247_61445_+	hypothetical protein	NA	A0A222YXD0	Escherichia_phage	97.9	8.0e-21
BBF56957.1|61396_61621_+	hypothetical protein	NA	A0A222YXD0	Escherichia_phage	98.6	4.2e-34
BBF56958.1|61617_63048_+	hypothetical protein	NA	A0A222YWB2	Escherichia_phage	99.6	2.4e-271
BBF56959.1|63058_63904_+	hypothetical protein	NA	A0A222YWB7	Escherichia_phage	99.6	1.7e-160
BBF56960.1|63998_64445_+	hypothetical protein	NA	A0A222YXS1	Escherichia_phage	99.3	1.5e-78
BBF56961.1|64447_66817_+|tail	phage tail protein	tail	A0A222YWB9	Escherichia_phage	76.4	0.0e+00
BBF56962.1|66786_67446_+|tail	phage tail protein	tail	A0A0A7NPY7	Enterobacteria_phage	98.6	5.7e-127
BBF56963.1|67448_67982_+|tail	phage tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	99.4	1.9e-96
BBF56964.1|68009_68537_-|tail	phage tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.1	2.9e-89
BBF56965.1|68538_70122_-|tail	phage tail fiber	tail	Q71TD5	Escherichia_phage	76.9	9.2e-232
BBF56966.1|70169_70730_-	DNA-invertase	NA	A0A222YWP5	Escherichia_phage	98.9	4.7e-98
BBF56967.1|70835_71162_+	hypothetical protein	NA	A0A222YZ46	Escherichia_phage	100.0	3.3e-51
BBF56968.1|71161_71608_+	hypothetical protein	NA	A0A222YXP5	Escherichia_phage	100.0	9.2e-81
BBF56969.1|71597_72218_+	hypothetical protein	NA	A0A222YXB2	Escherichia_phage	99.5	1.1e-79
BBF56970.1|72210_74136_+	hypothetical protein	NA	A0A222YWA3	Escherichia_phage	94.4	1.5e-308
BBF56971.1|74135_74504_+	hypothetical protein	NA	A0A222YWB0	Escherichia_phage	84.7	8.0e-38
BBF56972.1|74598_75984_+	hypothetical protein	NA	A0A222YY44	Escherichia_phage	95.8	2.4e-236
BBF56973.1|76048_77731_+	hypothetical protein	NA	A0A222YXQ7	Escherichia_phage	99.6	0.0e+00
BBF56974.1|77744_78743_+	hypothetical protein	NA	A0A222YWA7	Escherichia_phage	99.1	2.1e-181
BBF56975.1|78943_79906_+	hypothetical protein	NA	A0A222YXV1	Escherichia_phage	97.2	5.8e-173
BBF56976.1|80319_80544_+	hypothetical protein	NA	A0A222YWB3	Escherichia_phage	98.6	3.3e-39
BBF56977.1|80543_81251_+	DNA-binding protein	NA	A0A222YXY0	Escherichia_phage	87.2	6.7e-110
BBF56978.1|81250_81448_+	hypothetical protein	NA	A0A222YWF5	Escherichia_phage	100.0	3.1e-33
BBF56979.1|81480_81966_-	hypothetical protein	NA	A0A222YWL8	Escherichia_phage	99.4	9.7e-92
BBF56980.1|82117_88954_+	hypothetical protein	NA	A0A222YYH3	Escherichia_phage	98.2	0.0e+00
BBF56981.1|88990_89425_+	hypothetical protein	NA	A0A222YZ35	Escherichia_phage	100.0	2.9e-79
BBF56982.1|89427_89688_+	hypothetical protein	NA	A0A222YXI8	Escherichia_phage	97.7	4.0e-44
BBF56983.1|90094_90319_+	hypothetical protein	NA	A0A222YXP1	Escherichia_phage	100.0	6.3e-38
BBF56984.1|90333_90534_+	hypothetical protein	NA	A0A222YWF9	Escherichia_phage	98.5	3.3e-30
BBF56985.1|90530_90830_+	hypothetical protein	NA	A0A222YW96	Escherichia_phage	98.0	4.2e-45
BBF56986.1|90943_92152_+	chromosome partition protein Smc	NA	A0A222YW83	Escherichia_phage	99.3	1.7e-230
>prophage 1
AP018805	Escherichia coli E2863 plasmid pE2863-3 DNA, complete genome	78434	3563	58461	78434	transposase,protease	Escherichia_phage(28.57%)	57	NA	NA
BBF56989.1|3563_5684_+	hemolysin B	NA	W8CYL7	Bacillus_phage	30.2	1.6e-45
BBF56990.1|5687_7127_+	hemolysin D	NA	NA	NA	NA	NA
BBF56991.1|7253_7871_-|transposase	transposase	transposase	Q9ZXG3	Shigella_phage	67.5	8.0e-75
BBF56992.1|7945_9484_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	3.8e-299
BBF56993.1|9533_9767_-|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	3.8e-38
BBF56994.1|9878_10259_-	hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
BBF56995.1|10408_10969_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
BBF56996.1|11071_11932_-	hypothetical protein	NA	A2RQC8	Archaeal_BJ1_virus	23.5	9.7e-10
BBF56997.1|11990_12737_-	conjugal transfer protein TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	7.1e-09
BBF56998.1|12756_17652_-	conjugal transfer protein TraI	NA	NA	NA	NA	NA
BBF56999.1|17651_18026_-	oriT nicking and unwinding protein	NA	NA	NA	NA	NA
BBF57000.1|18025_20179_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
BBF57001.1|20431_21163_-	complement resistance protein precursor TraT	NA	NA	NA	NA	NA
BBF57002.1|21176_21686_-	surface exclusion protein TraS	NA	NA	NA	NA	NA
BBF57003.1|21682_24508_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
BBF57004.1|24504_25188_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
BBF57005.1|25193_25784_-	conjugal transfer protein TraP	NA	NA	NA	NA	NA
BBF57006.1|25975_26302_+|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF57007.1|26301_27189_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF57008.1|27191_28514_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
BBF57009.1|28513_29242_-	conjugal transfer protein TraK	NA	NA	NA	NA	NA
BBF57010.1|29228_29795_-	conjugal transfer protein TraE	NA	NA	NA	NA	NA
BBF57011.1|29816_30128_-	conjugal transfer protein TraL	NA	NA	NA	NA	NA
BBF57012.1|30142_30502_-	conjugal transfer protein TraA	NA	NA	NA	NA	NA
BBF57013.1|30534_30930_-	conjugal transfer protein Y TraY	NA	NA	NA	NA	NA
BBF57014.1|31028_31718_-	conjugal transfer protein TraJ	NA	NA	NA	NA	NA
BBF57015.1|31904_32288_-	conjugal transfer protein TraM	NA	NA	NA	NA	NA
BBF57016.1|32701_32950_+	hypothetical protein	NA	NA	NA	NA	NA
BBF57017.1|32971_33211_+	hypothetical protein	NA	NA	NA	NA	NA
BBF57018.1|33507_34329_-	hypothetical protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	4.4e-44
BBF57019.1|34448_34736_-	hypothetical protein	NA	NA	NA	NA	NA
BBF57020.1|35659_35872_-	modulator of Hok protein	NA	NA	NA	NA	NA
BBF57021.1|36093_36813_-	plasmid SOS inhibition protein PsiA	NA	NA	NA	NA	NA
BBF57022.1|36809_37244_-	plasmid SOS inhibition protein PsiB	NA	NA	NA	NA	NA
BBF57023.1|37298_39257_-	partitioning protein ParB	NA	G8DH78	Emiliania_huxleyi_virus	29.9	6.6e-22
BBF57024.1|39315_39549_-	hypothetical protein	NA	A0A096XUX0	Cronobacter_phage	51.1	3.9e-06
BBF57025.1|39604_40132_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	54.1	4.6e-47
BBF57026.1|41138_41585_-	hypothetical protein	NA	A0A2I7RQ20	Vibrio_phage	43.6	5.5e-17
BBF57027.1|41630_42992_-	hydrolase	NA	NA	NA	NA	NA
BBF57028.1|43043_43274_-	hypothetical protein	NA	NA	NA	NA	NA
BBF57029.1|44311_44503_-	hypothetical protein	NA	NA	NA	NA	NA
BBF57030.1|44499_44922_-	hypothetical protein	NA	NA	NA	NA	NA
BBF57031.1|44968_45394_-	antirestriction protein	NA	NA	NA	NA	NA
BBF57032.1|45643_46009_+|transposase	transposase	transposase	NA	NA	NA	NA
BBF57033.1|46008_47196_+|transposase	IS91 transposase	transposase	NA	NA	NA	NA
BBF57034.1|47302_47674_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	33.9	1.4e-10
BBF57035.1|48058_48985_-	hypothetical protein	NA	NA	NA	NA	NA
BBF57036.1|49233_50193_+	plasmid partition protein	NA	A0A222YXF2	Escherichia_phage	40.6	6.0e-61
BBF57037.1|50192_50588_+	plasmid stable inheritance protein StbB	NA	NA	NA	NA	NA
BBF57038.1|50652_50877_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	91.4	2.7e-28
BBF57039.1|50965_51109_-	hypothetical protein	NA	NA	NA	NA	NA
BBF57040.1|51108_51348_-|transposase	transposase	transposase	A0A0N7C1Z2	Escherichia_phage	95.8	7.2e-32
BBF57041.1|51547_51937_-	hypothetical protein	NA	NA	NA	NA	NA
BBF57042.1|51980_52865_-	catalase-peroxidase HPI	NA	NA	NA	NA	NA
BBF57043.1|52962_53289_+|transposase	transposase	transposase	Q6H9S4	Enterobacteria_phage	97.2	4.1e-54
BBF57044.1|53288_54176_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C035	Escherichia_phage	100.0	1.6e-169
BBF57045.1|54495_58461_+|protease	serine protease EspP	protease	Q9LA58	Enterobacterial_phage	39.9	1.1e-230
