The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
AP018488	Escherichia coli O157:H7 pv15-279 DNA, complete genome	5598155	304362	345406	5598155	capsid,transposase	Enterobacteria_phage(33.33%)	40	NA	NA
BBC48674.1|304362_305250_-|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBC48675.1|305249_305576_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBC48676.1|305706_306015_+	hypothetical protein	NA	NA	NA	NA	NA
BBC48677.1|305983_306601_+	hypothetical protein	NA	NA	NA	NA	NA
BBC48678.1|306600_307059_+	hypothetical protein	NA	NA	NA	NA	NA
BBC48679.1|309279_309552_-	transcription activator	NA	NA	NA	NA	NA
BBC48680.1|309557_310109_-	phage polarity suppression protein	NA	NA	NA	NA	NA
BBC48681.1|310105_310858_-|capsid	phage capsid size determining protein	capsid	NA	NA	NA	NA
BBC48682.1|311776_312037_+	transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
BBC48683.1|312033_312591_+	phage repressor protein	NA	Q7M2A7	Enterobacteria_phage	64.0	1.0e-28
BBC48684.1|312587_312809_+	hypothetical protein	NA	NA	NA	NA	NA
BBC48685.1|312808_313132_+	hypothetical protein	NA	NA	NA	NA	NA
BBC48686.1|313145_315479_+	phage DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
BBC48687.1|315611_316568_-	hypothetical protein	NA	NA	NA	NA	NA
BBC48688.1|317243_318143_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
BBC48689.1|318241_318964_+	oxidoreductase	NA	NA	NA	NA	NA
BBC48690.1|319129_319408_+	putative membrane protein	NA	NA	NA	NA	NA
BBC48691.1|320110_321013_-	transcriptional regulator	NA	NA	NA	NA	NA
BBC48692.1|321258_322317_+	hypothetical protein	NA	NA	NA	NA	NA
BBC48693.1|322458_323586_+	transport protein	NA	NA	NA	NA	NA
BBC48694.1|323764_324721_-	moco insertion factor for PaoABC aldehyde oxidoreductase	NA	NA	NA	NA	NA
BBC48695.1|324730_326929_-	moco-containing subunit of PaoABC aldehyde oxidoreductase	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.1e-38
BBC48696.1|327864_328554_-	xanthine dehydrogenase	NA	NA	NA	NA	NA
BBC48697.1|328971_329586_+	hypothetical protein	NA	NA	NA	NA	NA
BBC48698.1|330475_331186_-	ECP production pilus chaperone	NA	NA	NA	NA	NA
BBC48699.1|331154_332798_-	polymerized tip adhesin of ECP fibers	NA	NA	NA	NA	NA
BBC48700.1|332787_335313_-	ECP production outer membrane protein	NA	NA	NA	NA	NA
BBC48701.1|335338_336007_-	ECP production pilus chaperone	NA	NA	NA	NA	NA
BBC48702.1|336064_336652_-	ECP pilin	NA	NA	NA	NA	NA
BBC48703.1|336726_337269_-	transcriptional regulator for the ecp operon	NA	NA	NA	NA	NA
BBC48704.1|338092_338284_+	hypothetical protein	NA	NA	NA	NA	NA
BBC48705.1|338353_338494_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
BBC48706.1|338493_338760_-	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
BBC48707.1|339120_339222_-	hypothetical protein	NA	NA	NA	NA	NA
BBC48708.1|339695_340838_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
BBC48709.1|341071_341992_-	hydrolase	NA	NA	NA	NA	NA
BBC48710.1|342148_343060_+	transcriptional regulator	NA	NA	NA	NA	NA
BBC48711.1|343093_344632_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
BBC48712.1|344681_345029_-|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
BBC48713.1|345025_345406_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
>prophage 2
AP018488	Escherichia coli O157:H7 pv15-279 DNA, complete genome	5598155	362341	377545	5598155	holin,transposase	Escherichia_phage(71.43%)	11	NA	NA
BBC48726.1|362341_362668_+|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBC48727.1|362667_363555_+|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBC48728.1|363557_363821_-	hypothetical protein	NA	NA	NA	NA	NA
BBC48729.1|364955_365090_+	hypothetical protein	NA	NA	NA	NA	NA
BBC48730.1|365769_367458_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	9.6e-62
BBC48731.1|367471_368944_-	betaine aldehyde dehydrogenase	NA	NA	NA	NA	NA
BBC48732.1|368957_369545_-	transcriptional repressor	NA	NA	NA	NA	NA
BBC48733.1|369673_371707_+|holin	choline transporter of high affinity	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
BBC48734.1|372279_376263_+	AidA-I family adhesin	NA	A0A2L1IV18	Escherichia_phage	38.4	6.5e-125
BBC48735.1|376331_377219_-|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBC48736.1|377218_377545_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
>prophage 3
AP018488	Escherichia coli O157:H7 pv15-279 DNA, complete genome	5598155	884305	904436	5598155	integrase,tail,holin,transposase,terminase	Enterobacteria_phage(30.43%)	28	884218:884232	905767:905781
884218:884232	attL	GCTTTTTTATACTAA	NA	NA	NA	NA
BBC49159.1|884305_885376_-|integrase	integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	2.5e-201
BBC49160.1|885611_885779_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
BBC49161.1|886469_886619_+	membrane protein	NA	NA	NA	NA	NA
BBC49162.1|887149_887365_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	98.6	2.9e-32
BBC49163.1|887441_887633_-	hypothetical protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
BBC49164.1|887605_887788_-	hypothetical protein	NA	A0A0P0ZD61	Stx2-converting_phage	95.0	5.3e-27
BBC49165.1|887784_888309_-	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	99.4	2.3e-99
BBC49166.1|888443_888770_+|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBC49167.1|888769_889657_+|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBC49168.1|889960_890452_+	phage replication protein	NA	C1JJ53	Enterobacteria_phage	98.8	1.6e-89
BBC49169.1|890448_891150_+	phage replication protein	NA	A0A0P0ZD31	Stx2-converting_phage	100.0	3.4e-130
BBC49170.1|891146_891437_+	phage exclusion protein	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
BBC49171.1|891510_891951_+	recombination protein	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
BBC49172.1|892286_892910_+	recombination endonuclease	NA	Q716C3	Shigella_phage	97.6	4.9e-96
BBC49173.1|892906_893572_+	serine/threonine-specific protein phosphatase 1	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
BBC49174.1|893783_894743_-	systemic factor protein	NA	NA	NA	NA	NA
BBC49175.1|895218_895908_+	phage antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
BBC49176.1|896092_896836_+	membrane protein	NA	NA	NA	NA	NA
BBC49177.1|896774_896900_-	hypothetical protein	NA	NA	NA	NA	NA
BBC49178.1|897701_897917_+|holin	phage holine protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
BBC49179.1|897916_898414_+	phage lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
BBC49180.1|898410_898878_+	phage murein endopeptidase	NA	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
BBC49181.1|898865_899018_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
BBC49182.1|899692_900058_+|terminase	phage terminase small subunit	terminase	A0A291AWV8	Escherichia_phage	81.4	1.1e-44
BBC49183.1|900044_900251_+|tail	phage tail fiber protein	tail	H6WZM9	Escherichia_phage	95.5	1.1e-31
BBC49184.1|900694_901675_+	T3SS secreted effector NleB	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
BBC49185.1|901708_902728_+	T3SS secreted effector NleC	NA	NA	NA	NA	NA
BBC49186.1|903554_904436_+	T3SS secreted effector NleH	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
905767:905781	attR	GCTTTTTTATACTAA	NA	NA	NA	NA
>prophage 4
AP018488	Escherichia coli O157:H7 pv15-279 DNA, complete genome	5598155	1146325	1198786	5598155	portal,transposase,integrase,tail,protease,head,holin,tRNA	Enterobacteria_phage(36.96%)	67	1141013:1141028	1164825:1164840
1141013:1141028	attL	GCGGATTTTTTCCGCC	NA	NA	NA	NA
BBC49402.1|1146325_1146655_-|tRNA	mnm(5)-s(2)U34-tRNA 2-thiolation sulfurtransferase	tRNA	NA	NA	NA	NA
BBC49403.1|1146745_1147405_-	membrane protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
BBC49404.1|1147812_1148829_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	49.4	9.1e-84
BBC49405.1|1148806_1149049_-	phage excisionase	NA	NA	NA	NA	NA
BBC49406.1|1149116_1151588_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
BBC49407.1|1151681_1151873_-	hypothetical protein	NA	NA	NA	NA	NA
BBC49408.1|1151869_1152058_-	cell division inhibition protein	NA	NA	NA	NA	NA
BBC49409.1|1152631_1152817_+	hypothetical protein	NA	NA	NA	NA	NA
BBC49410.1|1153003_1153393_-	hypothetical protein	NA	NA	NA	NA	NA
BBC49411.1|1153404_1153533_-	hypothetical protein	NA	NA	NA	NA	NA
BBC49412.1|1153534_1153690_-	hypothetical protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
BBC49413.1|1153966_1154254_-	plasmid stabilization protein	NA	NA	NA	NA	NA
BBC49414.1|1154253_1154445_-	hypothetical protein	NA	NA	NA	NA	NA
BBC49415.1|1154472_1154874_-	repressor protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
BBC49416.1|1154982_1155255_+	hypothetical protein	NA	H6WRX5	Salmonella_phage	50.0	1.1e-12
BBC49417.1|1155238_1155664_+	hypothetical protein	NA	NA	NA	NA	NA
BBC49418.1|1155870_1156326_-	hypothetical protein	NA	NA	NA	NA	NA
BBC49419.1|1156404_1157496_+	phage replication protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
BBC49420.1|1157502_1158249_+	phage DNA replication protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
BBC49421.1|1158270_1159041_+	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
BBC49422.1|1159056_1159425_+	phage exclusion protein	NA	A0A0U2QQN3	Escherichia_phage	95.1	1.1e-34
BBC49423.1|1159331_1160870_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
BBC49424.1|1160919_1161267_-|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
BBC49425.1|1161263_1161644_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
BBC49426.1|1162271_1163045_-	hypothetical protein	NA	NA	NA	NA	NA
BBC49427.1|1163410_1163548_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
BBC49428.1|1163592_1163805_+	phage maintenance protein	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
BBC49429.1|1164252_1165302_+	hypothetical protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
1164825:1164840	attR	GGCGGAAAAAATCCGC	NA	NA	NA	NA
BBC49430.1|1165314_1165686_+	endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
BBC49431.1|1165675_1166047_+	antiterminator	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
BBC49432.1|1166198_1167017_+|protease	CAAX amino terminal protease family protein	protease	NA	NA	NA	NA
BBC49433.1|1167303_1167543_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
BBC49434.1|1167763_1168351_+	AraC-family transcriptional regulator	NA	NA	NA	NA	NA
BBC49435.1|1169118_1170969_+	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	95.8	0.0e+00
BBC49436.1|1171416_1171623_+|holin	phage holine protein	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
BBC49437.1|1171878_1172115_-	hypothetical protein	NA	NA	NA	NA	NA
BBC49438.1|1172310_1172757_+	phage endolysin	NA	A0A1U9AJ98	Stx1_converting_phage	92.1	1.1e-73
BBC49439.1|1172759_1173278_-|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.4	1.2e-95
BBC49440.1|1173289_1173646_-|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.0	1.0e-53
BBC49441.1|1173645_1173972_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBC49442.1|1174104_1174392_-	hypothetical protein	NA	NA	NA	NA	NA
BBC49443.1|1174583_1175900_+	phage tarminase large subunit	NA	A0A0K2FJ14	Enterobacteria_phage	64.8	8.0e-173
BBC49444.1|1175883_1176090_+|head,tail	phage head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
BBC49445.1|1176086_1176851_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	56.6	2.5e-62
BBC49446.1|1176853_1177678_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	63.2	1.4e-90
BBC49447.1|1177667_1179173_+|head,protease	phage prohead protease	head,protease	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
BBC49448.1|1179209_1179557_+|head	phage head-DNA stabilization protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
BBC49449.1|1179614_1179881_+|head	phage head protein	head	NA	NA	NA	NA
BBC49450.1|1179973_1180603_+|tail	phage major tail protein	tail	Q687F6	Enterobacteria_phage	97.6	1.8e-106
BBC49451.1|1180616_1181048_+|tail	phage minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
BBC49452.1|1181074_1181488_+|tail	phage minor tail protein	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
BBC49453.1|1181468_1184048_+|tail	phage tail length tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.4	0.0e+00
BBC49454.1|1184044_1184374_+|tail	phage minor tail protein	tail	Q687F2	Enterobacteria_phage	94.5	1.2e-53
BBC49455.1|1184373_1185072_+|tail	phage minor tail protein	tail	Q687F1	Enterobacteria_phage	98.7	1.8e-131
BBC49456.1|1185082_1185826_+|tail	phage tail assembly protein	tail	Q9EYE4	Enterobacteria_phage	99.6	2.4e-150
BBC49457.1|1185822_1186401_+|tail	phage tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.0	7.5e-99
BBC49458.1|1186641_1187340_+	phage host specificity protein	NA	A0A0P0ZBW1	Stx2-converting_phage	97.7	1.2e-114
BBC49459.1|1187294_1189901_+	phage host specificity protein	NA	A0A0P0ZCI5	Stx2-converting_phage	96.2	0.0e+00
BBC49460.1|1189903_1190119_+	phage host specificity protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
BBC49461.1|1190186_1190786_+	outer membrane precursor Lom	NA	Q687E7	Enterobacteria_phage	99.0	2.0e-110
BBC49462.1|1190850_1191561_+|tail	phage tail fiber protein	tail	Q687E6	Enterobacteria_phage	100.0	4.2e-59
BBC49463.1|1191593_1192163_+|tail	phage tail fiber protein	tail	A0A2R2Z352	Escherichia_phage	98.7	3.2e-38
BBC49464.1|1192164_1192434_+	hypothetical protein	NA	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
BBC49465.1|1194567_1195686_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
BBC49466.1|1195682_1197476_+	hydrogenase 1 large subunit	NA	NA	NA	NA	NA
BBC49467.1|1197494_1198202_+	hydrogenase 1 b-type cytochrome subunit	NA	NA	NA	NA	NA
BBC49468.1|1198198_1198786_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 5
AP018488	Escherichia coli O157:H7 pv15-279 DNA, complete genome	5598155	1291218	1359733	5598155	transposase,integrase	Escherichia_phage(46.88%)	73	1285388:1285403	1303372:1303387
1285388:1285403	attL	CCAGGTACTGCTGCCG	NA	NA	NA	NA
BBC49544.1|1291218_1292421_+|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
BBC49545.1|1292607_1294425_-	membrane protein	NA	NA	NA	NA	NA
BBC49546.1|1294919_1295357_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.0	5.5e-46
BBC49547.1|1295535_1295832_+	transcriptional regulator	NA	NA	NA	NA	NA
BBC49548.1|1296474_1297908_+	hypothetical protein	NA	NA	NA	NA	NA
BBC49549.1|1298728_1299073_+	hypothetical protein	NA	NA	NA	NA	NA
BBC49550.1|1299075_1299963_-|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBC49551.1|1299962_1300289_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBC49552.1|1300759_1303120_+	IS-excision enhancer IEE	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
BBC49553.1|1303143_1304139_-	hypothetical protein	NA	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.0e-188
1303372:1303387	attR	CGGCAGCAGTACCTGG	NA	NA	NA	NA
BBC49554.1|1304213_1305101_-|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBC49555.1|1305100_1305427_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBC49556.1|1305501_1305849_-|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
BBC49557.1|1305845_1306226_-	hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
BBC49558.1|1306301_1306613_-|transposase	transposase	transposase	NA	NA	NA	NA
BBC49559.1|1306781_1307072_-	restriction endonuclease	NA	NA	NA	NA	NA
BBC49560.1|1307757_1308117_+	diacylglycerol kinase	NA	NA	NA	NA	NA
BBC49561.1|1310268_1310595_+|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBC49562.1|1310594_1311482_+|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBC49563.1|1311667_1312240_+	urease accessory protein	NA	NA	NA	NA	NA
BBC49564.1|1312249_1312552_+	urease subunit gamma	NA	NA	NA	NA	NA
BBC49565.1|1312560_1312881_+	urease subunit beta	NA	NA	NA	NA	NA
BBC49566.1|1312873_1314577_+	urease subunit alpha	NA	NA	NA	NA	NA
BBC49567.1|1314586_1315051_+	urease accessory protein	NA	NA	NA	NA	NA
BBC49568.1|1315051_1315726_+	urease accessory protein	NA	NA	NA	NA	NA
BBC49569.1|1315737_1316355_+	urease accessory protein	NA	NA	NA	NA	NA
BBC49570.1|1316610_1316952_-	hypothetical protein	NA	NA	NA	NA	NA
BBC49571.1|1317013_1317142_-	complement resistance protein precursor TraT	NA	NA	NA	NA	NA
BBC49572.1|1317566_1317830_+	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
BBC49573.1|1318131_1318272_+	hypothetical protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
BBC49574.1|1319142_1319814_-	membrane protein	NA	NA	NA	NA	NA
BBC49575.1|1321346_1321832_-	hypothetical protein	NA	A0A218MNE7	uncultured_virus	42.0	9.5e-31
BBC49576.1|1322151_1322577_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
BBC49577.1|1322573_1322924_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
BBC49578.1|1322954_1324568_+|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.4	1.2e-165
BBC49579.1|1324571_1325429_-	hypopthetical protein	NA	S5VLC8	Leptospira_phage	30.4	6.6e-27
BBC49580.1|1325471_1325852_-	hypothetical protein	NA	NA	NA	NA	NA
BBC49581.1|1325838_1326168_-	hypothetical protein	NA	NA	NA	NA	NA
BBC49582.1|1326428_1326896_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
BBC49583.1|1326913_1328122_-	hypothetical protein	NA	NA	NA	NA	NA
BBC49584.1|1328132_1329089_-	ATP synthase	NA	NA	NA	NA	NA
BBC49585.1|1329088_1330168_-	hypothetical protein	NA	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
BBC49586.1|1330169_1330943_-	hypothetical protein	NA	NA	NA	NA	NA
BBC49587.1|1330935_1332078_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
BBC49588.1|1332087_1333146_-	hypothetical protein	NA	NA	NA	NA	NA
BBC49589.1|1333468_1334050_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
BBC49590.1|1334049_1335207_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
BBC49591.1|1335229_1335685_+	tellurium resistance protein TerB	NA	NA	NA	NA	NA
BBC49592.1|1335707_1336748_+	tellurium resistance protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
BBC49593.1|1336796_1337375_+	tellurium resistance protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
BBC49594.1|1337443_1338019_+	tellurium resistance protein TerE	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
BBC49595.1|1338127_1339324_-|transposase	transposase	transposase	NA	NA	NA	NA
BBC49596.1|1339891_1340278_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
BBC49597.1|1340791_1342882_-	Iha adhesin	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
BBC49598.1|1344332_1344551_+	hypothetical protein	NA	NA	NA	NA	NA
BBC49599.1|1345664_1346183_-|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.4	1.2e-95
BBC49600.1|1346194_1346551_-|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.0	1.0e-53
BBC49601.1|1346550_1346877_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBC49602.1|1347158_1347353_-	hypothetical protein	NA	NA	NA	NA	NA
BBC49603.1|1347404_1347584_-	hypothetical protein	NA	NA	NA	NA	NA
BBC49604.1|1347671_1347944_+	hypothetical protein	NA	NA	NA	NA	NA
BBC49605.1|1348508_1348706_+	regulatory protein	NA	NA	NA	NA	NA
BBC49606.1|1349435_1350560_+	glucosyl-transferase	NA	NA	NA	NA	NA
BBC49607.1|1350978_1351272_-|transposase	IS1 family transposase InsB	transposase	U5P0U6	Shigella_phage	92.8	8.3e-46
BBC49608.1|1351400_1351676_-|transposase	IS1 family transposase InsA	transposase	Q71TE9	Escherichia_phage	91.2	2.8e-43
BBC49609.1|1351913_1352372_-	membrane protein	NA	NA	NA	NA	NA
BBC49610.1|1352829_1353339_+	hypothetical protein	NA	NA	NA	NA	NA
BBC49611.1|1353427_1354051_+	DNA-binding protein	NA	NA	NA	NA	NA
BBC49612.1|1354146_1354380_+	hypothetical protein	NA	NA	NA	NA	NA
BBC49613.1|1354432_1354624_-	hypothetical protein	NA	NA	NA	NA	NA
BBC49614.1|1355298_1356345_+	HecB-like protein	NA	NA	NA	NA	NA
BBC49615.1|1359032_1359407_-|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	96.4	5.6e-55
BBC49616.1|1359406_1359733_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
>prophage 6
AP018488	Escherichia coli O157:H7 pv15-279 DNA, complete genome	5598155	1458008	1488712	5598155	head,capsid,transposase,integrase	Enterobacteria_phage(21.43%)	32	1459424:1459438	1481339:1481353
BBC49718.1|1458008_1459127_-|integrase	integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
BBC49719.1|1459095_1459365_-	phage excisionase	NA	NA	NA	NA	NA
1459424:1459438	attL	ACATTAAAAATCAGC	NA	NA	NA	NA
BBC49720.1|1459426_1460161_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.8	5.6e-59
BBC49721.1|1460787_1461870_+	phage host specificity protein	NA	Q6H9T2	Enterobacteria_phage	93.3	4.0e-186
BBC49722.1|1461936_1462536_+	outer membrane precursor Lom	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
BBC49723.1|1463913_1464183_+	hypothetical protein	NA	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
BBC49724.1|1464289_1464379_+	hypothetical protein	NA	NA	NA	NA	NA
BBC49725.1|1464398_1466747_+	T3SS secreted effector EspX	NA	NA	NA	NA	NA
BBC49726.1|1467337_1470739_+	T3SS secreted effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
BBC49727.1|1470907_1471357_+	outer membrane pore protein	NA	NA	NA	NA	NA
BBC49728.1|1471281_1472187_-|transposase	IS2 transposase	transposase	Q9ZXG3	Shigella_phage	98.7	6.3e-177
BBC49729.1|1472348_1472510_-|transposase	transposase	transposase	Q76S41	Shigella_phage	100.0	3.5e-22
BBC49730.1|1473047_1473323_-	T3SS secreated effector EspO	NA	NA	NA	NA	NA
BBC49731.1|1473383_1474745_-	T3SS secreted effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
BBC49732.1|1475108_1475972_-	spermidine/putrescine ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
BBC49733.1|1475955_1477092_-	spermidine/putrescine ABC transporter ATPase	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
BBC49734.1|1477341_1478568_+	peptidase T	NA	NA	NA	NA	NA
BBC49735.1|1478616_1479738_-	50S ribosomal protein L16 arginine hydroxylase	NA	NA	NA	NA	NA
BBC49736.1|1479986_1481216_+|integrase	integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
BBC49737.1|1481826_1482771_+	hypothetical protein	NA	NA	NA	NA	NA
1481339:1481353	attR	GCTGATTTTTAATGT	NA	NA	NA	NA
BBC49738.1|1482763_1482976_+	hypothetical protein	NA	NA	NA	NA	NA
BBC49739.1|1482965_1483430_+	hypothetical protein	NA	NA	NA	NA	NA
BBC49740.1|1483422_1483656_+	hypothetical protein	NA	NA	NA	NA	NA
BBC49741.1|1483661_1483961_+	hypothetical protein	NA	NA	NA	NA	NA
BBC49742.1|1483957_1485358_+	DNA primase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	5.6e-116
BBC49743.1|1485558_1485810_+	hypothetical protein	NA	NA	NA	NA	NA
BBC49744.1|1485806_1486217_+	single stranded DNA-binding protein	NA	NA	NA	NA	NA
BBC49745.1|1486227_1486500_+	transcriptional regulator PchE	NA	NA	NA	NA	NA
BBC49746.1|1486626_1486851_+	hypothetical protein	NA	NA	NA	NA	NA
BBC49747.1|1487102_1487309_+	hypothetical protein	NA	NA	NA	NA	NA
BBC49748.1|1487308_1488364_+|capsid	phage major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.9	4.3e-68
BBC49749.1|1488376_1488712_+|head	phage head-DNA stabilization protein	head	NA	NA	NA	NA
>prophage 7
AP018488	Escherichia coli O157:H7 pv15-279 DNA, complete genome	5598155	1495375	1536339	5598155	portal,transposase,integrase,capsid,tail,protease,head,holin,tRNA	Enterobacteria_phage(60.0%)	47	1488473:1488488	1511092:1511107
1488473:1488488	attL	ACCCCGCTGATGCTGG	NA	NA	NA	NA
BBC49757.1|1495375_1496482_-|tRNA	tRNA(Gln,Lys,Glu) U34 2-thiouridylase	tRNA	NA	NA	NA	NA
BBC49758.1|1496535_1496997_-	bifunctional thiamine pyrimidine pyrophosphate hydrolase and thiamine pyrophosphate hydrolase	NA	NA	NA	NA	NA
BBC49759.1|1497006_1497660_-	23S rRNA pseudouridine synthase	NA	NA	NA	NA	NA
BBC49760.1|1497831_1499082_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
BBC49761.1|1499195_1500338_-|integrase	integrase	integrase	O21940	Phage_21	100.0	8.1e-206
BBC49762.1|1500327_1500564_-	phage excisionase	NA	NA	NA	NA	NA
BBC49763.1|1500926_1501616_+	phage antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
BBC49764.1|1501937_1502243_+|holin	phage holin protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
BBC49765.1|1502229_1502706_+	phage endolysin	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
BBC49766.1|1502702_1503164_+	phage murein endopeptidase	NA	A0A0K2FJD0	Enterobacteria_phage	98.0	9.2e-76
BBC49767.1|1502922_1503105_+	lipoprotein precursor	NA	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
BBC49768.1|1503195_1503489_-	Bor protein precursor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
BBC49769.1|1503780_1504191_-	hypothetical protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
BBC49770.1|1504476_1504683_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
BBC49771.1|1505430_1505976_+	phage DNA packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
BBC49772.1|1505950_1507876_+	phage tarminase large subunit	NA	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
BBC49773.1|1507872_1508079_+|head,tail	phage head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
BBC49774.1|1508075_1509677_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
BBC49775.1|1509657_1510977_+|head,protease	phage prohead protease	head,protease	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
BBC49776.1|1510986_1511319_+|head	phage head-DNA stabilization protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
1511092:1511107	attR	ACCCCGCTGATGCTGG	NA	NA	NA	NA
BBC49777.1|1511374_1512400_+|capsid	phage major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
BBC49778.1|1512441_1512840_+	phage DNA packaging protein	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
BBC49779.1|1512851_1513205_+|head,tail	phage head-tail adaptor protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
BBC49780.1|1513216_1513795_+|tail	phage minor tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
BBC49781.1|1513791_1514187_+|tail	phage minor tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
BBC49782.1|1514194_1514935_+|tail	phage major tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
BBC49783.1|1514950_1515373_+|tail	phage minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
BBC49784.1|1515354_1515789_+|tail	phage minor tail protein	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
BBC49785.1|1515781_1518331_+|tail	phage tail length tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.2	0.0e+00
BBC49786.1|1518327_1518657_+|tail	phage minor tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
BBC49787.1|1518656_1519355_+|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
BBC49788.1|1519360_1520104_+|tail	phage tail assembly protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
BBC49789.1|1520100_1520673_+|tail	phage tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.9	1.1e-83
BBC49790.1|1520733_1524132_+	phage host specificity protein	NA	K7PKJ2	Enterobacteria_phage	90.8	0.0e+00
BBC49791.1|1524198_1524798_+	outer membrane precursor Lom	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
BBC49792.1|1527777_1528548_+|tail	phage tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.4	3.7e-93
BBC49793.1|1528354_1529242_-|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBC49794.1|1529241_1529568_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBC49795.1|1529791_1530682_-	catalase	NA	NA	NA	NA	NA
BBC49796.1|1530700_1531207_-	hypothetical protein	NA	NA	NA	NA	NA
BBC49797.1|1531243_1531744_-	putative phage protein	NA	NA	NA	NA	NA
BBC49798.1|1531822_1532005_-	hypothetical protein	NA	NA	NA	NA	NA
BBC49799.1|1532501_1533170_-	hypothetical protein	NA	NA	NA	NA	NA
BBC49800.1|1533226_1533532_+|tail	phage tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
BBC49801.1|1533521_1533776_+	hypothetical protein	NA	NA	NA	NA	NA
BBC49802.1|1533714_1535199_-	hydrolase	NA	NA	NA	NA	NA
BBC49803.1|1535385_1536339_-|protease	outer membrane protease VII	protease	NA	NA	NA	NA
>prophage 8
AP018488	Escherichia coli O157:H7 pv15-279 DNA, complete genome	5598155	1651046	1727928	5598155	portal,integrase,tRNA,lysis,protease,tail,transposase,terminase	Enterobacteria_phage(35.85%)	89	1643716:1643730	1661323:1661337
1643716:1643730	attL	CATATCAAGGTTAAC	NA	NA	NA	NA
BBC49908.1|1651046_1652177_-|integrase	integrase	integrase	O21940	Phage_21	51.1	1.7e-102
BBC49909.1|1652154_1652403_-	excisionase	NA	NA	NA	NA	NA
BBC49910.1|1652467_1654912_-	exodeoxyribonuclease VIII	NA	V5UQJ3	Shigella_phage	58.3	8.4e-176
BBC49911.1|1655004_1655193_-	hypothetical protein	NA	NA	NA	NA	NA
BBC49912.1|1655189_1655378_-	cell division inhibition protein	NA	NA	NA	NA	NA
BBC49913.1|1655775_1655940_+	hypothetical protein	NA	NA	NA	NA	NA
BBC49914.1|1655943_1656162_-	hypothetical protein	NA	NA	NA	NA	NA
BBC49915.1|1656191_1656320_-	hypothetical protein	NA	NA	NA	NA	NA
BBC49916.1|1656321_1656477_-	hypothetical protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
BBC49917.1|1656666_1657074_-	phage repressor CI	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
BBC49918.1|1657151_1657379_+	phage antirepressor protein Cro	NA	NA	NA	NA	NA
BBC49919.1|1657362_1657914_+	hypothetical protein	NA	NA	NA	NA	NA
BBC49920.1|1658714_1659380_+	phage replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.4	3.5e-84
BBC49921.1|1659414_1660173_+	hypothetical protein	NA	A0A088CE47	Shigella_phage	68.8	1.9e-81
BBC49922.1|1660765_1661314_+	phage antirepressor	NA	A0A2R2Z302	Escherichia_phage	75.4	1.4e-41
BBC49923.1|1661528_1661741_+	regulatory protein MokC for HokC	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
1661323:1661337	attR	GTTAACCTTGATATG	NA	NA	NA	NA
BBC49924.1|1661843_1662161_-	transcriptional regulator	NA	NA	NA	NA	NA
BBC49925.1|1662153_1662525_-	addiction module toxin RelE	NA	NA	NA	NA	NA
BBC49926.1|1662781_1662976_+	hypothetical protein	NA	NA	NA	NA	NA
BBC49927.1|1663029_1663299_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	52.5	2.7e-11
BBC49928.1|1663300_1664350_+	hypothetical protein	NA	U5P0K4	Shigella_phage	54.3	3.4e-110
BBC49929.1|1664362_1664737_+	phage endonuclease RUS	NA	V5URS4	Shigella_phage	62.7	4.2e-34
BBC49930.1|1664733_1665555_+	phage antitermination protein Q	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
BBC49931.1|1665781_1665979_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	95.4	7.5e-27
BBC49932.1|1666130_1667189_+	DNA methylase	NA	S5MDR0	Escherichia_phage	98.6	2.6e-206
BBC49933.1|1667783_1669730_+	hypothetical protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	97.8	0.0e+00
BBC49934.1|1669865_1670045_+	hypothetical protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
BBC49935.1|1670085_1670358_+	hypothetical protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
BBC49936.1|1670434_1670650_+|lysis	phage lysis protein	lysis	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
BBC49937.1|1670653_1671211_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	80.9	1.5e-48
BBC49938.1|1671247_1671781_+	phage endolysin	NA	G9L6J6	Escherichia_phage	96.6	2.1e-100
BBC49939.1|1671979_1672078_+	hypothetical protein	NA	Q687G2	Enterobacteria_phage	100.0	8.3e-11
BBC49940.1|1672079_1672547_+	phage endopeptidase	NA	Q7AYI6	Enterobacteria_phage	100.0	7.7e-78
BBC49941.1|1672959_1673436_+|terminase	phage terminase small subunit	terminase	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
BBC49942.1|1673432_1675556_+|terminase	phage terminase large subunit	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
BBC49943.1|1675552_1675765_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
BBC49944.1|1675764_1677267_+|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.8	1.2e-289
BBC49945.1|1677211_1679236_+|protease	phage protease/scaffold protein	protease	Q8VNN5	Enterobacteria_phage	97.2	0.0e+00
BBC49946.1|1679323_1679650_+	membrane protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
BBC49947.1|1679642_1679924_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
BBC49948.1|1679926_1680550_+|tail	phage minor tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
BBC49949.1|1680562_1680961_+|tail	phage minor tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
BBC49950.1|1680968_1681721_+|tail	phage major tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
BBC49951.1|1681734_1682157_+|tail	phage minor tail protein	tail	S5MQJ3	Escherichia_phage	97.9	1.3e-71
BBC49952.1|1682183_1682492_+|tail	phage minor tail protein	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
BBC49953.1|1682535_1685181_+|tail	phage tail length tape measure protein	tail	Q687F3	Enterobacteria_phage	95.5	0.0e+00
BBC49954.1|1685177_1685507_+|tail	phage minor tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
BBC49955.1|1685506_1686205_+|tail	phage minor tail protein	tail	Q6H9T5	Enterobacteria_phage	98.3	1.4e-131
BBC49956.1|1686215_1686959_+|tail	phage tail assembly protein	tail	Q9EYE4	Enterobacteria_phage	98.8	2.7e-149
BBC49957.1|1686955_1687534_+|tail	phage tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.3	4.4e-91
BBC49958.1|1687774_1691251_+	phage host specificity protein	NA	Q687E8	Enterobacteria_phage	96.2	0.0e+00
BBC49959.1|1691317_1691917_+	outer membrane precursor Lom	NA	Q687E7	Enterobacteria_phage	98.5	1.7e-109
BBC49960.1|1691981_1693295_+|tail	phage tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.6	1.3e-82
BBC49961.1|1693296_1693566_+	hypothetical protein	NA	Q6H9S8	Enterobacteria_phage	100.0	4.9e-45
BBC49962.1|1694229_1694523_+|transposase	IS1 family transposase InsB	transposase	U5P0U6	Shigella_phage	89.7	1.7e-43
BBC49963.1|1694821_1695280_+	T3SS secreted effector OspG	NA	NA	NA	NA	NA
BBC49964.1|1695657_1695828_+|tail	phage tail component	tail	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
BBC49965.1|1696317_1696824_-	hypothetical protein	NA	NA	NA	NA	NA
BBC49966.1|1696869_1697370_-	hypothetical protein	NA	NA	NA	NA	NA
BBC49967.1|1697455_1697635_-	hypothetical protein	NA	NA	NA	NA	NA
BBC49968.1|1698015_1698822_-	tryptophan synthase alpha chain	NA	NA	NA	NA	NA
BBC49969.1|1698821_1700015_-	tryptophan synthase beta chain	NA	NA	NA	NA	NA
BBC49970.1|1700026_1701385_-	indole-3-glycerolphosphate synthetase and N-(5-phosphoribosyl)anthranilate isomerase	NA	A0A0P0IR83	Acinetobacter_phage	40.7	4.3e-36
BBC49971.1|1701388_1702984_-	anthranilate synthase component II	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
BBC49972.1|1702983_1704546_-	component I of anthranilate synthase	NA	NA	NA	NA	NA
BBC49973.1|1704819_1705701_+|tRNA	S-adenosylmethionine tRNA ribosyltransferase	tRNA	NA	NA	NA	NA
BBC49974.1|1705697_1706318_+	RNA binding protein	NA	NA	NA	NA	NA
BBC49975.1|1706345_1707929_+	hypothetical protein	NA	NA	NA	NA	NA
BBC49976.1|1708141_1709014_+	ribosomal large subunit pseudouridine synthase B	NA	NA	NA	NA	NA
BBC49977.1|1709053_1709644_-	cob(I)alamin adenosyltransferase/cobinamide ATP-dependent adenosyltransferase	NA	NA	NA	NA	NA
BBC49978.1|1709640_1710399_-	EmrKY-TolC system oxoacyl-(acyl carrier protein) reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
BBC49979.1|1710618_1711668_+	peptidase	NA	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
BBC49980.1|1711703_1711955_-	hypothetical protein	NA	NA	NA	NA	NA
BBC49981.1|1712334_1714932_+	DNA topoisomerase I	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
BBC49982.1|1715141_1716116_+	N-acetylserine-responsive cysteine regulon transcriptional activator	NA	NA	NA	NA	NA
BBC49983.1|1716446_1716575_+	hypothetical protein	NA	NA	NA	NA	NA
BBC49984.1|1716577_1716745_+	hypothetical protein	NA	NA	NA	NA	NA
BBC49985.1|1717117_1719793_+	aconitate hydratase 1	NA	NA	NA	NA	NA
BBC49986.1|1719856_1720447_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
BBC49987.1|1720616_1721381_+	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
BBC49988.1|1721529_1721838_+	inner membrane-anchored protein	NA	NA	NA	NA	NA
BBC49989.1|1721844_1723014_+	hypothetical protein	NA	NA	NA	NA	NA
BBC49990.1|1723146_1723944_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
BBC49991.1|1723943_1724270_+	stress response translation initiation inhibitor	NA	NA	NA	NA	NA
BBC49992.1|1724395_1724614_-	osmotically and stress inducible lipoprotein	NA	NA	NA	NA	NA
BBC49993.1|1724882_1725632_-	global regulator of transcription	NA	NA	NA	NA	NA
BBC49994.1|1725721_1725895_-	hypothetical protein	NA	NA	NA	NA	NA
BBC49995.1|1726714_1727041_+|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBC49996.1|1727040_1727928_+|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
>prophage 9
AP018488	Escherichia coli O157:H7 pv15-279 DNA, complete genome	5598155	1987511	2182296	5598155	holin,portal,integrase,capsid,lysis,protease,head,tail,transposase,terminase	Enterobacteria_phage(40.78%)	243	2134824:2134843	2174538:2174557
BBC50206.1|1987511_1987715_+	selenoprotein	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
BBC50207.1|1987750_1989211_-	NAD-dependent D-mannonate oxidoreductase	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
BBC50208.1|1989299_1990583_-	transport protein	NA	NA	NA	NA	NA
BBC50209.1|1990642_1990957_+	DNA damage-inducible protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
BBC50210.1|1991200_1992088_-|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBC50211.1|1992087_1992414_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBC50212.1|1992439_1993528_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	48.2	9.9e-36
BBC50213.1|1995727_1995997_-	hypothetical protein	NA	H6WZN0	Escherichia_phage	98.9	6.4e-45
BBC50214.1|1995998_1997201_-|tail	phage tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.0	3.4e-61
BBC50215.1|1997375_1997975_-	outer membrane precursor Lom	NA	Q9EV15	Enterobacteria_phage	91.0	1.8e-100
BBC50216.1|1998042_1999116_-	phage host specificity protein	NA	Q9EYE7	Enterobacteria_phage	90.8	1.8e-159
BBC50217.1|1999112_1999559_-|tail	phage minor tail protein	tail	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
BBC50218.1|1999555_1999906_-|head,tail	phage head-tail adaptor	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
BBC50219.1|1999915_2000242_-	phage DNA packaging protein	NA	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
BBC50220.1|2000244_2001138_-|portal	phage portal protein	portal	Q6H9U5	Enterobacteria_phage	63.2	2.8e-76
BBC50221.1|2001134_2002499_-|portal	phage portal protein	portal	B6DZX6	Stx2-converting_phage	95.4	4.4e-251
BBC50222.1|2002710_2004636_-|head,protease	phage prohead protease	head,protease	B6ETE8	Enterobacteria_phage	96.7	0.0e+00
BBC50223.1|2004699_2006361_-|terminase	phage terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.0	0.0e+00
BBC50224.1|2006357_2006921_-|terminase	phage terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.5	3.3e-83
BBC50225.1|2007210_2007576_-	DNase	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
BBC50226.1|2007617_2007803_+	hypothetical protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
BBC50227.1|2007932_2008073_-	hypothetical protein	NA	NA	NA	NA	NA
BBC50228.1|2008429_2008654_-	hypothetical protein	NA	NA	NA	NA	NA
BBC50229.1|2008677_2009145_-	phage murein endopeptidase	NA	A0A0H4IT10	Shigella_phage	95.5	1.6e-75
BBC50230.1|2009152_2009299_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
BBC50231.1|2009298_2009868_-	phage antirepressor	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
BBC50232.1|2010257_2010584_+|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBC50233.1|2010583_2011471_+|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBC50234.1|2011277_2011985_-	phage endolysin	NA	B6DZ92	Enterobacteria_phage	98.1	4.3e-88
BBC50235.1|2012035_2012380_-	hypothetical protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
BBC50236.1|2012384_2012600_-|holin	phage holine protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
BBC50237.1|2012675_2012945_-	hypothetical protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
BBC50238.1|2012982_2013165_-	hypothetical protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
BBC50239.1|2013312_2015250_-	hypothetical protein	NA	Q6H9W1	Enterobacteria_phage	77.1	1.3e-293
BBC50240.1|2016046_2017105_-	DNA methylase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
BBC50241.1|2017254_2017452_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
BBC50242.1|2017693_2018224_-	phage antiterminator	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
BBC50243.1|2018232_2018592_-	endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
BBC50244.1|2018604_2019651_-	hypothetical protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
BBC50245.1|2019652_2019931_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
BBC50246.1|2020000_2020258_-	putative phage protein	NA	NA	NA	NA	NA
BBC50247.1|2020478_2020691_-	phage maintenance protein	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
BBC50248.1|2020969_2021728_-	porcine attaching-effacing associated protein Paa/adherence factor AdfO	NA	NA	NA	NA	NA
BBC50249.1|2022426_2022591_-	hypothetical protein	NA	NA	NA	NA	NA
BBC50250.1|2022587_2023169_-	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
BBC50251.1|2023355_2024021_-	phage replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.9e-85
BBC50252.1|2024147_2024474_+|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBC50253.1|2024670_2025360_+|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.6	1.7e-126
BBC50254.1|2025166_2026162_-	phage replication protein	NA	Q9EYF6	Enterobacteria_phage	96.3	3.1e-44
BBC50255.1|2026133_2026685_-	hypothetical protein	NA	NA	NA	NA	NA
BBC50256.1|2026668_2026896_-	phage repressor protein	NA	NA	NA	NA	NA
BBC50257.1|2026972_2027380_+	regulator for DicB	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
BBC50258.1|2027587_2027944_+	hypothetical protein	NA	NA	NA	NA	NA
BBC50259.1|2028016_2028235_+	hypothetical protein	NA	NA	NA	NA	NA
BBC50260.1|2028257_2028665_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
BBC50261.1|2028642_2028876_-	hypothetical protein	NA	NA	NA	NA	NA
BBC50262.1|2029434_2029623_+	cell division inhibition protein	NA	NA	NA	NA	NA
BBC50263.1|2029619_2029811_+	hypothetical protein	NA	NA	NA	NA	NA
BBC50264.1|2029903_2032375_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
BBC50265.1|2032665_2033796_+|integrase	integrase	integrase	O21940	Phage_21	51.4	3.4e-103
BBC50266.1|2034511_2034760_+	DNA-damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	96.3	1.2e-37
BBC50267.1|2036548_2036818_-	hypothetical protein	NA	Q6H9S8	Enterobacteria_phage	100.0	4.9e-45
BBC50268.1|2036819_2038088_-|tail	phage tail fiber protein	tail	B6DZB7	Enterobacteria_phage	91.2	1.6e-77
BBC50269.1|2038152_2038776_-	outer membrane protein Lom	NA	A0A1U8QHD6	Enterobacteria_phage	61.8	1.0e-69
BBC50270.1|2038842_2042319_-	phage host specificity protein	NA	Q6H9T2	Enterobacteria_phage	97.1	0.0e+00
BBC50271.1|2042554_2043136_-|tail	phage tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	99.0	1.7e-95
BBC50272.1|2043132_2043876_-|tail	phage tail assembly protein	tail	Q6H9T4	Enterobacteria_phage	96.8	1.0e-145
BBC50273.1|2043886_2044585_-|tail	phage minor tail protein	tail	H6WZM3	Escherichia_phage	98.3	1.5e-130
BBC50274.1|2044584_2044914_-|tail	phage minor tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
BBC50275.1|2044910_2047556_-|tail	phage tail length tape measure protein	tail	Q9EYE1	Enterobacteria_phage	89.9	0.0e+00
BBC50276.1|2047599_2047908_-|tail	phage minor tail protein	tail	S5MDP5	Escherichia_phage	98.0	6.6e-54
BBC50277.1|2047934_2048357_-|tail	phage minor tail protein	tail	Q687F5	Enterobacteria_phage	98.6	3.3e-72
BBC50278.1|2048370_2049123_-|tail	phage major tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
BBC50279.1|2049130_2049529_-|tail	phage minor tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
BBC50280.1|2049541_2050165_-|tail	phage minor tail protein	tail	Q8VNN3	Enterobacteria_phage	98.6	2.9e-104
BBC50281.1|2050167_2050449_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	98.9	1.3e-45
BBC50282.1|2050441_2050768_-	membrane protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
BBC50283.1|2050855_2052880_-|protease	phage protease/scaffold protein	protease	S5M7Q8	Escherichia_phage	99.5	0.0e+00
BBC50284.1|2052824_2054327_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	99.6	1.6e-289
BBC50285.1|2054326_2054539_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
BBC50286.1|2054535_2056659_-|terminase	phage terminase large subunit	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
BBC50287.1|2056655_2057132_-|terminase	phage terminase small subunit	terminase	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
BBC50288.1|2057591_2057816_-	hypothetical protein	NA	NA	NA	NA	NA
BBC50289.1|2057839_2058307_-	phage murein endopeptidase	NA	Q9EYC9	Enterobacteria_phage	85.3	6.3e-64
BBC50290.1|2058303_2058837_-	phage endolysin	NA	G9L6J6	Escherichia_phage	97.7	1.3e-100
BBC50291.1|2058841_2059057_-|lysis	phage lysis protein	lysis	G9L6J5	Escherichia_phage	100.0	9.0e-34
BBC50292.1|2059133_2059580_-	hypothetical protein	NA	Q6H9V9	Enterobacteria_phage	98.6	1.8e-55
BBC50293.1|2059762_2061709_-	hypothetical protein	NA	Q9EYC8	Enterobacteria_phage	97.4	0.0e+00
BBC50294.1|2062219_2062489_-	Shiga toxin 2a subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
BBC50295.1|2062500_2063460_-	Shiga toxin 2a subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
BBC50296.1|2063842_2064901_-	DNA methylase	NA	A0A0N7KZF8	Stx2-converting_phage	98.0	2.9e-205
BBC50297.1|2065052_2065250_-	hypothetical protein	NA	A0A0P0ZDH6	Stx2-converting_phage	100.0	8.0e-29
BBC50298.1|2065465_2065846_-	phage antiterminator Q	NA	S5M7R9	Escherichia_phage	99.2	1.4e-66
BBC50299.1|2065864_2066854_-	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	98.2	8.9e-193
BBC50300.1|2066905_2067163_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	71.1	1.2e-21
BBC50301.1|2067159_2068560_-	replication protein	NA	Q8W640	Enterobacteria_phage	92.4	1.7e-245
BBC50302.1|2068556_2069435_-	DNA helicase	NA	Q8W641	Enterobacteria_phage	96.0	2.0e-140
BBC50303.1|2069445_2070354_-	phage replication protein O	NA	Q8W642	Enterobacteria_phage	94.0	2.4e-59
BBC50304.1|2070340_2070574_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	47.2	1.6e-12
BBC50305.1|2070570_2071233_-	hypothetical protein	NA	Q8W643	Enterobacteria_phage	92.5	3.7e-110
BBC50306.1|2071341_2072049_-	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	94.0	2.6e-122
BBC50307.1|2072045_2072297_-	phage regulatory protein Cro	NA	NA	NA	NA	NA
BBC50308.1|2072411_2073158_+	phage repressor protein CI	NA	K7P7I4	Enterobacteria_phage	61.2	1.2e-80
BBC50309.1|2073290_2073977_+	transcriptional regulator	NA	A0A1B5FPB8	Escherichia_phage	56.6	2.3e-22
BBC50310.1|2073973_2074174_+	hypothetical protein	NA	NA	NA	NA	NA
BBC50311.1|2074256_2074370_+	hypothetical protein	NA	NA	NA	NA	NA
BBC50312.1|2074372_2074522_+	hypothetical protein	NA	NA	NA	NA	NA
BBC50313.1|2074561_2075134_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	71.3	5.5e-78
BBC50314.1|2075503_2076331_+|protease	serine protease	protease	Q8W654	Enterobacteria_phage	97.5	1.2e-129
BBC50315.1|2076371_2076743_+	hypothetical protein	NA	Q8W655	Enterobacteria_phage	95.1	2.3e-61
BBC50316.1|2076774_2076891_+	hypothetical protein	NA	Q8W656	Enterobacteria_phage	91.4	6.8e-12
BBC50317.1|2076934_2077189_+	phage excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
BBC50318.1|2077222_2078509_+|integrase	integrase	integrase	Q20GI2	Phage_258-320	99.8	6.9e-254
BBC50319.1|2080692_2081130_-|transposase	transposase	transposase	NA	NA	NA	NA
BBC50320.1|2081545_2082136_-	T3SS secreted effector EspM	NA	NA	NA	NA	NA
BBC50321.1|2082319_2082967_+	T3SS secreted effector NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
BBC50322.1|2083869_2084562_+|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	88.6	1.3e-110
BBC50323.1|2085217_2086543_+	T3SS secreted effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
BBC50324.1|2087569_2087839_-	hypothetical protein	NA	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
BBC50325.1|2087840_2089154_-|tail	phage tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.9	4.6e-80
BBC50326.1|2089305_2089905_-	outer membrane precursor Lom	NA	Q9EV15	Enterobacteria_phage	97.0	4.1e-108
BBC50327.1|2089972_2093446_-	phage host specificity protein	NA	A0A0P0ZBW1	Stx2-converting_phage	90.3	0.0e+00
BBC50328.1|2093692_2094274_-|tail	phage tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	88.5	1.1e-86
BBC50329.1|2094270_2095014_-|tail	phage tail assembly protein	tail	Q9EYE4	Enterobacteria_phage	98.4	1.7e-148
BBC50330.1|2095024_2095723_-|tail	phage minor tail protein	tail	H6WZM3	Escherichia_phage	97.0	1.1e-128
BBC50331.1|2095722_2096064_-|tail	phage minor tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
BBC50332.1|2096056_2099299_-|tail	phage tail length tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.9	0.0e+00
BBC50333.1|2099350_2099560_-|tail	phage minor tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
BBC50334.1|2099655_2100030_-|tail	phage tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
BBC50335.1|2100035_2100752_-|tail	phage major tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
BBC50336.1|2100816_2101068_-|tail	phage minor tail protein	tail	A0A0P0ZC17	Stx2-converting_phage	98.8	1.6e-37
BBC50337.1|2101037_2101160_-|tail	phage minor tail protein	tail	A0A0P0ZC17	Stx2-converting_phage	100.0	4.1e-07
BBC50338.1|2101156_2101603_-|tail	phage minor tail protein	tail	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
BBC50339.1|2101599_2101950_-|head,tail	phage head-tail adaptor	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
BBC50340.1|2101959_2102286_-	phage DNA packaging protein	NA	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
BBC50341.1|2102457_2103180_-|portal	phage portal protein	portal	B6DZX7	Stx2-converting_phage	62.9	1.7e-39
BBC50342.1|2103172_2104540_-|portal	phage portal protein	portal	B6DZX6	Stx2-converting_phage	95.8	1.2e-251
BBC50343.1|2104751_2106689_-|head,protease	phage prohead protease	head,protease	Q6H9U8	Enterobacteria_phage	99.7	0.0e+00
BBC50344.1|2106752_2108414_-|terminase	phage terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.5	0.0e+00
BBC50345.1|2108410_2108974_-|terminase	phage terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
BBC50346.1|2109264_2109630_-	DNase	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
BBC50347.1|2109671_2109899_+	hypothetical protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
BBC50348.1|2110261_2110729_-	phage endopeptidase	NA	Q9EYC9	Enterobacteria_phage	100.0	1.2e-78
BBC50349.1|2110736_2110883_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
BBC50350.1|2110882_2111521_-	phage antirepressor	NA	A0A1I9LJR6	Stx_converting_phage	100.0	1.9e-103
BBC50351.1|2111486_2112374_-|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBC50352.1|2112373_2112700_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBC50353.1|2113035_2113569_-	phage endolysin	NA	B6DZ92	Enterobacteria_phage	97.7	7.4e-101
BBC50354.1|2113619_2113964_-	hypothetical protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
BBC50355.1|2113968_2114175_-|holin	phage holine protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
BBC50356.1|2114661_2115528_-	hypothetical protein	NA	H6WZJ9	Escherichia_phage	99.6	2.8e-158
BBC50357.1|2115524_2115761_-	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	97.0	1.2e-31
BBC50358.1|2115841_2116480_-	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	98.2	5.2e-93
BBC50359.1|2116793_2116961_-	hypothetical protein	NA	H6WZJ7	Escherichia_phage	72.5	3.2e-10
BBC50360.1|2116957_2117104_-	TciA/TerB-like protein	NA	H6WZJ6	Escherichia_phage	97.9	1.4e-17
BBC50361.1|2117634_2118324_-	phage late gene regulator Q	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
BBC50362.1|2118320_2118680_-	phage endonuclease RUS	NA	V5URS4	Shigella_phage	68.4	4.1e-39
BBC50363.1|2118692_2119742_-	hypothetical protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
BBC50364.1|2120189_2120402_-	regulatory protein MokC for HokC	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
BBC50365.1|2120446_2120602_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	83.8	1.9e-09
BBC50366.1|2120590_2120695_-	hypothetical protein	NA	NA	NA	NA	NA
BBC50367.1|2120810_2121395_-	hypothetical protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
BBC50368.1|2121451_2121847_-	phage exclusion protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
BBC50369.1|2121862_2122633_-	hypothetical protein	NA	A0A088CE47	Shigella_phage	67.7	2.0e-83
BBC50370.1|2122658_2123399_-	phage DNA replication protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
BBC50371.1|2123405_2124368_-	phage replication protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
BBC50372.1|2124390_2124816_-	hypothetical protein	NA	NA	NA	NA	NA
BBC50373.1|2124812_2125115_-	phage antirepressor protein Cro	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
BBC50374.1|2125212_2125584_+	phage repressor protein CI	NA	NA	NA	NA	NA
BBC50375.1|2125604_2125796_+	hypothetical protein	NA	NA	NA	NA	NA
BBC50376.1|2125797_2126076_+	hypothetical protein	NA	NA	NA	NA	NA
BBC50377.1|2126371_2126728_+	hypothetical protein	NA	NA	NA	NA	NA
BBC50378.1|2126800_2127019_+	hypothetical protein	NA	NA	NA	NA	NA
BBC50379.1|2127022_2127187_-	hypothetical protein	NA	NA	NA	NA	NA
BBC50380.1|2127587_2127776_+	cell division inhibition protein	NA	NA	NA	NA	NA
BBC50381.1|2127772_2127964_+	hypothetical protein	NA	NA	NA	NA	NA
BBC50382.1|2128056_2129388_+	exonuclease family protein	NA	NA	NA	NA	NA
BBC50383.1|2129427_2130315_-|transposase	transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	9.5e-170
BBC50384.1|2130314_2130641_-|transposase	transposase	transposase	Q6H9S4	Enterobacteria_phage	97.2	4.1e-54
BBC50385.1|2130795_2131032_+	phage excisionase	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
BBC50386.1|2131657_2132038_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
BBC50387.1|2132034_2132382_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
BBC50388.1|2132431_2133970_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
2134824:2134843	attL	ATGACTCTTGAAATCCATAA	NA	NA	NA	NA
BBC50389.1|2134900_2135215_+	DNA damage-inducible protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
BBC50390.1|2135376_2136018_-	T3SS secreted effector NleG	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
BBC50391.1|2136800_2137376_-	T3SS secreted effector NleG	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
BBC50392.1|2137489_2137759_-	hypothetical protein	NA	H6WZN0	Escherichia_phage	98.9	1.4e-44
BBC50393.1|2138029_2138629_-	outer membrane precursor Lom	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	9.7e-110
BBC50394.1|2138696_2142104_-	phage host specificity protein	NA	B6DZB5	Enterobacteria_phage	96.6	0.0e+00
BBC50395.1|2142412_2142757_-|tail	phage tail assembly protein	tail	Q687E9	Enterobacteria_phage	96.5	7.4e-54
BBC50396.1|2142702_2142990_-|tail	phage tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	98.6	8.4e-35
BBC50397.1|2142986_2143730_-|tail	phage tail assembly protein	tail	Q9EYE4	Enterobacteria_phage	99.6	2.4e-150
BBC50398.1|2143740_2144439_-|tail	phage minor tail protein	tail	Q687F1	Enterobacteria_phage	98.7	1.8e-131
BBC50399.1|2144438_2144768_-|tail	phage minor tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
BBC50400.1|2144764_2147377_-|tail	phage tail length tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
BBC50401.1|2147357_2147771_-|tail	phage minor tail protein	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
BBC50402.1|2147797_2148220_-|tail	phage minor tail protein	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
BBC50403.1|2148233_2148986_-|tail	phage major tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
BBC50404.1|2148993_2149389_-|tail	phage minor tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
BBC50405.1|2149385_2149919_-|tail	phage minor tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
BBC50406.1|2149933_2150287_-|head,tail	phage head-tail adaptor protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
BBC50407.1|2150298_2150697_-	phage DNA packaging protein	NA	A0A0K2FIR1	Enterobacteria_phage	97.7	2.3e-62
BBC50408.1|2150738_2151764_-|capsid	phage major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
BBC50409.1|2151819_2152152_-|head	phage head-DNA stabilization protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
BBC50410.1|2152161_2153481_-|head,protease	phage prohead protease	head,protease	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
BBC50411.1|2153461_2155051_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	97.9	1.2e-303
BBC50412.1|2155047_2155254_-|head,tail	phage head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
BBC50413.1|2155250_2157176_-	phage tarminase large subunit	NA	A0A0K2FJ14	Enterobacteria_phage	98.0	0.0e+00
BBC50414.1|2157150_2157696_-	phage DNA packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
BBC50415.1|2158388_2158703_-	PchABC family transcriptional regulator	NA	NA	NA	NA	NA
BBC50416.1|2159166_2159625_-	phage endopeptidase	NA	Q7AYI6	Enterobacteria_phage	83.4	4.4e-62
BBC50417.1|2159636_2159783_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
BBC50418.1|2159782_2160352_-	phage antirepressor	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
BBC50419.1|2160603_2161491_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBC50420.1|2161490_2161817_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBC50421.1|2161935_2162469_-	phage endolysin	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
BBC50422.1|2162519_2162864_-	hypothetical protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
BBC50423.1|2162868_2163075_-|holin	phage holine protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
BBC50424.1|2163522_2164662_-	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	98.9	7.8e-217
BBC50425.1|2164663_2165380_-	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	98.2	5.8e-93
BBC50426.1|2165694_2165862_-	hypothetical protein	NA	H6WZJ7	Escherichia_phage	72.5	3.2e-10
BBC50427.1|2165858_2166296_-	TciA/TerB-like protein	NA	H6WZJ6	Escherichia_phage	95.9	2.4e-65
BBC50428.1|2166746_2167334_-	phage regulatory protein	NA	NA	NA	NA	NA
BBC50429.1|2167595_2167793_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
BBC50430.1|2168017_2168572_-	phage antiterminator	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
BBC50431.1|2168580_2168940_-	phage endonuclease RUS	NA	V5URS4	Shigella_phage	63.5	5.0e-37
BBC50432.1|2168952_2170002_-	hypothetical protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
BBC50433.1|2170003_2170276_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
BBC50434.1|2170397_2170742_-	hypothetical protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
BBC50435.1|2170861_2171074_-	regulatory protein MokC for HokC	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
BBC50436.1|2171307_2171865_-	putative phage protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
BBC50437.1|2172212_2172524_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.3	3.9e-54
BBC50438.1|2172720_2173047_+|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBC50439.1|2173046_2173934_+|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBC50440.1|2174086_2174509_+|integrase	integrase	integrase	B6DZ48	Enterobacteria_phage	62.2	2.4e-46
BBC50441.1|2174696_2175716_-	Zn-dependent NAD(P)-binding oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.5	1.1e-17
2174538:2174557	attR	ATGACTCTTGAAATCCATAA	NA	NA	NA	NA
BBC50442.1|2175727_2176942_-	bifunctional D-altronate/D-mannonate dehydratase	NA	Q6A202	Oenococcus_phage	29.0	3.1e-46
BBC50443.1|2177147_2177474_-	inner membrane protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
BBC50444.1|2177608_2177950_+	periplasmic protein	NA	NA	NA	NA	NA
BBC50445.1|2177984_2178545_+	spermidine N(1)-acetyltransferase	NA	NA	NA	NA	NA
BBC50446.1|2178547_2179294_-	lipoprotein	NA	NA	NA	NA	NA
BBC50447.1|2179365_2179671_+	hypothetical protein	NA	NA	NA	NA	NA
BBC50448.1|2179869_2182296_+	anaerobic dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.8	8.0e-211
>prophage 10
AP018488	Escherichia coli O157:H7 pv15-279 DNA, complete genome	5598155	2196909	2206933	5598155	head,tail,portal,protease	uncultured_Caudovirales_phage(88.89%)	13	NA	NA
BBC50463.1|2196909_2198571_-	phage tarminase large subunit	NA	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	2.0e-277
BBC50464.1|2198554_2198911_-	phage tarminase small subunit	NA	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
BBC50465.1|2199200_2199641_-	hypothetical protein	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
BBC50466.1|2199640_2199937_-	phage DNA packaging protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
BBC50467.1|2199933_2200272_-|head,tail	phage head-tail adaptor	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	8.7e-31
BBC50468.1|2200268_2201444_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	80.2	4.8e-185
BBC50469.1|2201481_2202054_-|head,protease	phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	4.7e-61
BBC50470.1|2202093_2203251_-|head	major head protein	head	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
BBC50471.1|2203542_2203767_-	hypothetical protein	NA	NA	NA	NA	NA
BBC50472.1|2203892_2204165_-	transcriptional regulator PchE	NA	NA	NA	NA	NA
BBC50473.1|2204175_2204586_-	single stranded DNA-binding protein	NA	NA	NA	NA	NA
BBC50474.1|2204582_2204828_-	hypothetical protein	NA	NA	NA	NA	NA
BBC50475.1|2205115_2206933_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	48.3	7.5e-129
>prophage 11
AP018488	Escherichia coli O157:H7 pv15-279 DNA, complete genome	5598155	2451489	2544897	5598155	portal,integrase,lysis,protease,tail,tRNA,terminase	Enterobacteria_phage(57.89%)	97	2525809:2525824	2543158:2543173
BBC50705.1|2451489_2453538_-|protease	carboxy-terminal protease for penicillin-binding protein 3	protease	A0A0R6PIZ1	Moraxella_phage	33.5	1.2e-85
BBC50706.1|2453557_2454256_-	ProP effector	NA	NA	NA	NA	NA
BBC50707.1|2454352_2454904_-	free methionine-(R)-sulfoxide reductase	NA	NA	NA	NA	NA
BBC50708.1|2454979_2456263_+	inner membrane PqiA domain protein	NA	NA	NA	NA	NA
BBC50709.1|2456231_2458865_+	hypothetical protein	NA	NA	NA	NA	NA
BBC50710.1|2458864_2460385_+	16S rRNA m(5)C1407 methyltransferase	NA	NA	NA	NA	NA
BBC50711.1|2460502_2460739_+	hypothetical protein	NA	NA	NA	NA	NA
BBC50712.1|2460759_2461035_+	hypothetical protein	NA	NA	NA	NA	NA
BBC50713.1|2461035_2461692_-	serine/threonine-specific protein phosphatase 1	NA	A0A222YWF0	Escherichia_phage	49.8	6.8e-56
BBC50714.1|2462087_2462429_-	hypothetical protein	NA	NA	NA	NA	NA
BBC50715.1|2462441_2463314_-	inner membrane protein	NA	NA	NA	NA	NA
BBC50716.1|2463317_2463692_-	hypothetical protein	NA	NA	NA	NA	NA
BBC50717.1|2463830_2464061_+	DNA polymerase III theta subunit HolE	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
BBC50718.1|2464162_2464819_+	hypothetical protein	NA	NA	NA	NA	NA
BBC50719.1|2464842_2465505_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
BBC50720.1|2465501_2467562_-|protease	protease II	protease	NA	NA	NA	NA
BBC50721.1|2467770_2468430_-	inner membrane protein	NA	NA	NA	NA	NA
BBC50722.1|2468756_2469113_-	extracellular Colicin M immunity family protein	NA	NA	NA	NA	NA
BBC50723.1|2469179_2469470_-	hypothetical protein	NA	NA	NA	NA	NA
BBC50724.1|2469603_2470782_+	phosphoribosylglycinamide formyltransferase 2	NA	NA	NA	NA	NA
BBC50725.1|2470837_2471479_-	ketohydroxyglutarate aldolase	NA	NA	NA	NA	NA
BBC50726.1|2471515_2473327_-	6-phosphogluconate dehydratase	NA	NA	NA	NA	NA
BBC50727.1|2473561_2475037_-	glucose-6-phosphate 1-dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
BBC50728.1|2475374_2476244_+	transcriptional regulator	NA	NA	NA	NA	NA
BBC50729.1|2476371_2477814_+	pyruvate kinase	NA	NA	NA	NA	NA
BBC50730.1|2477944_2478916_-	myristoyl-acyl carrier protein (ACP)-dependent acyltransferase	NA	NA	NA	NA	NA
BBC50731.1|2479035_2480358_-	murein DD-endopeptidase	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
BBC50732.1|2480373_2481360_-	zinc ABC transporter periplasmic binding protein	NA	NA	NA	NA	NA
BBC50733.1|2481384_2482140_+	zinc ABC transporter ATPase	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
BBC50734.1|2482136_2482922_+	zinc ABC transporter permease	NA	NA	NA	NA	NA
BBC50735.1|2483167_2484178_-	ATP-dependent DNA helicase	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
BBC50736.1|2484186_2484798_-	component of RuvABC resolvasome regulatory subunit	NA	NA	NA	NA	NA
BBC50737.1|2485071_2485674_+	hypothetical protein	NA	NA	NA	NA	NA
BBC50738.1|2485675_2486197_-	component of RuvABC resolvasome	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
BBC50739.1|2486231_2486972_-	hypothetical protein	NA	NA	NA	NA	NA
BBC50740.1|2487000_2487510_-	dihydroneopterin triphosphate pyrophosphatase	NA	NA	NA	NA	NA
BBC50741.1|2487570_2489343_-|tRNA	aspartyl-tRNA synthetase	tRNA	NA	NA	NA	NA
BBC50742.1|2489652_2490219_+	isochorismatase family protein	NA	NA	NA	NA	NA
BBC50743.1|2490536_2490785_+	DNA-damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	96.3	1.2e-37
BBC50744.1|2492573_2492822_-	hypothetical protein	NA	Q6H9S8	Enterobacteria_phage	100.0	4.0e-41
BBC50745.1|2492844_2494113_-|tail	phage tail fiber protein	tail	B6DZB7	Enterobacteria_phage	91.2	1.6e-77
BBC50746.1|2494177_2494801_-	outer membrane protein Lom	NA	A0A1U8QHD6	Enterobacteria_phage	61.8	1.0e-69
BBC50747.1|2494867_2498344_-	phage host specificity protein	NA	Q6H9T2	Enterobacteria_phage	97.1	0.0e+00
BBC50748.1|2498579_2499161_-|tail	phage tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	99.0	1.7e-95
BBC50749.1|2499157_2499901_-|tail	phage tail assembly protein	tail	Q6H9T4	Enterobacteria_phage	96.8	1.0e-145
BBC50750.1|2499911_2500610_-|tail	phage minor tail protein	tail	H6WZM3	Escherichia_phage	98.3	1.5e-130
BBC50751.1|2500609_2500939_-|tail	phage minor tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
BBC50752.1|2500935_2503581_-|tail	phage tail length tape measure protein	tail	Q9EYE1	Enterobacteria_phage	89.9	0.0e+00
BBC50753.1|2503624_2503933_-|tail	phage minor tail protein	tail	S5MDP5	Escherichia_phage	98.0	6.6e-54
BBC50754.1|2503959_2504382_-|tail	phage minor tail protein	tail	Q687F5	Enterobacteria_phage	98.6	3.3e-72
BBC50755.1|2504395_2505148_-|tail	phage major tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
BBC50756.1|2505155_2505554_-|tail	phage minor tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
BBC50757.1|2505566_2506190_-|tail	phage minor tail protein	tail	Q8VNN3	Enterobacteria_phage	98.6	2.9e-104
BBC50758.1|2506466_2506793_-	membrane protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
BBC50759.1|2506880_2508905_-|protease	phage protease/scaffold protein	protease	S5M7Q8	Escherichia_phage	99.5	0.0e+00
BBC50760.1|2508849_2510352_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	97.2	2.5e-279
BBC50761.1|2510560_2512684_-|terminase	phage terminase large subunit	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
BBC50762.1|2512680_2513157_-	hypothetical protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
BBC50763.1|2513864_2514350_-	phage endopeptidase	NA	Q9EYC9	Enterobacteria_phage	86.2	2.9e-64
BBC50764.1|2514328_2514862_-	phage endolysin	NA	G9L6J6	Escherichia_phage	97.7	1.3e-100
BBC50765.1|2514866_2515082_-|lysis	phage lysis protein	lysis	G9L6J5	Escherichia_phage	100.0	9.0e-34
BBC50766.1|2515158_2515605_-	hypothetical protein	NA	Q6H9V9	Enterobacteria_phage	98.6	1.8e-55
BBC50767.1|2515787_2517830_-	hypothetical protein	NA	Q9EYC8	Enterobacteria_phage	97.2	0.0e+00
BBC50768.1|2518244_2518514_-	Shiga toxin 2a subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
BBC50769.1|2518525_2519485_-	Shiga toxin 2a subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
BBC50770.1|2519867_2520926_-	DNA methylase	NA	A0A0N7KZF8	Stx2-converting_phage	98.0	2.9e-205
BBC50771.1|2521077_2521362_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.1	1.8e-34
BBC50772.1|2521490_2521871_-	hypothetical protein	NA	S5M7R9	Escherichia_phage	99.2	1.4e-66
BBC50773.1|2521889_2522885_-	hypothetical protein	NA	U5P0K4	Shigella_phage	97.9	6.9e-193
BBC50774.1|2522930_2523188_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	71.1	1.2e-21
BBC50775.1|2523184_2524585_-	replication protein	NA	Q8W640	Enterobacteria_phage	92.4	1.7e-245
BBC50776.1|2524581_2525460_-	DNA helicase	NA	Q8W641	Enterobacteria_phage	96.0	2.0e-140
BBC50777.1|2525470_2526379_-	phage replication protein O	NA	Q8W642	Enterobacteria_phage	94.0	2.4e-59
2525809:2525824	attL	ATTCCGGTGAATATTC	NA	NA	NA	NA
BBC50778.1|2526365_2526599_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	47.2	1.6e-12
BBC50779.1|2526595_2527258_-	hypothetical protein	NA	Q8W643	Enterobacteria_phage	92.5	3.7e-110
BBC50780.1|2527366_2528074_-	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	94.0	2.6e-122
BBC50781.1|2528070_2528322_-	phage regulatory protein Cro	NA	NA	NA	NA	NA
BBC50782.1|2528436_2529183_+	phage repressor protein CI	NA	K7P7I4	Enterobacteria_phage	61.2	1.2e-80
BBC50783.1|2529282_2530002_+	XRE family transcriptional regulator	NA	A0A1B5FPB8	Escherichia_phage	56.6	2.4e-22
BBC50784.1|2529998_2530199_+	hypothetical protein	NA	NA	NA	NA	NA
BBC50785.1|2530281_2530395_+	hypothetical protein	NA	NA	NA	NA	NA
BBC50786.1|2530397_2530547_+	hypothetical protein	NA	NA	NA	NA	NA
BBC50787.1|2530586_2531159_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	71.3	5.5e-78
BBC50788.1|2531343_2531532_+	hypothetical protein	NA	NA	NA	NA	NA
BBC50789.1|2531528_2532356_+|protease	serine protease	protease	Q8W654	Enterobacteria_phage	97.5	1.2e-129
BBC50790.1|2532396_2532768_+	hypothetical protein	NA	Q8W655	Enterobacteria_phage	95.1	2.3e-61
BBC50791.1|2532799_2532916_+	hypothetical protein	NA	Q8W656	Enterobacteria_phage	91.4	6.8e-12
BBC50792.1|2532959_2533214_+	phage excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
BBC50793.1|2533247_2534534_+|integrase	integrase	integrase	Q20GI2	Phage_258-320	99.8	6.9e-254
BBC50794.1|2535367_2535763_+	MAPEG family inner membrane protein	NA	NA	NA	NA	NA
BBC50795.1|2535803_2536547_+	carboxy-SAM synthase	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
BBC50796.1|2536543_2537515_+|tRNA	tRNA (cmo5U34)-carboxymethyltransferase	tRNA	NA	NA	NA	NA
BBC50797.1|2537679_2540109_-	biotin sulfoxide reductase	NA	NA	NA	NA	NA
BBC50798.1|2540133_2541234_-	TMAO reductase III cytochrome c-type subunit	NA	NA	NA	NA	NA
BBC50799.1|2541621_2542368_-	copper homeostasis protein	NA	NA	NA	NA	NA
BBC50800.1|2542381_2542948_-	hypothetical protein	NA	NA	NA	NA	NA
BBC50801.1|2543163_2544897_+|tRNA	arginyl-tRNA synthetase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
2543158:2543173	attR	ATTCCGGTGAATATTC	NA	NA	NA	NA
>prophage 12
AP018488	Escherichia coli O157:H7 pv15-279 DNA, complete genome	5598155	2574299	2606567	5598155	holin,portal,plate,integrase,capsid,tail,transposase,terminase	Enterobacteria_phage(82.05%)	45	2566213:2566227	2582753:2582767
2566213:2566227	attL	TCAGCGCCCGGCGTT	NA	NA	NA	NA
BBC50831.1|2574299_2575301_-|integrase	integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
BBC50832.1|2575306_2575654_-	hypothetical protein	NA	NA	NA	NA	NA
BBC50833.1|2575683_2576334_-	membrane protein	NA	NA	NA	NA	NA
BBC50834.1|2576349_2576754_-	phage repressor protein	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
BBC50835.1|2576843_2576981_-	hypothetical protein	NA	NA	NA	NA	NA
BBC50836.1|2577052_2577256_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
BBC50837.1|2577277_2577628_+	hypothetical protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
BBC50838.1|2577638_2577917_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
BBC50839.1|2577928_2578171_+	hypothetical protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
BBC50840.1|2578167_2578281_+	membrane protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
BBC50841.1|2578373_2578790_+	hypothetical protein	NA	NA	NA	NA	NA
BBC50842.1|2578813_2579017_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
BBC50843.1|2579013_2579280_+	MarR family transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
BBC50844.1|2579276_2579576_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
BBC50845.1|2579898_2580129_+	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	94.7	5.9e-31
BBC50846.1|2580201_2580567_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
BBC50847.1|2580573_2583396_+	replication protein	NA	A0A0A7NQ77	Enterobacteria_phage	97.8	0.0e+00
2582753:2582767	attR	AACGCCGGGCGCTGA	NA	NA	NA	NA
BBC50848.1|2583472_2584432_+	plasmid partition protein	NA	A0A0A7NPX4	Enterobacteria_phage	98.7	7.9e-178
BBC50849.1|2584436_2584751_+	plasmid partition protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
BBC50850.1|2584833_2585676_-	hypothetical protein	NA	NA	NA	NA	NA
BBC50851.1|2585672_2586212_-	hypothetical protein	NA	NA	NA	NA	NA
BBC50852.1|2586860_2587907_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	7.4e-206
BBC50853.1|2587906_2589658_-|terminase	phage terminase large subunit	terminase	A0A0A7NV54	Enterobacteria_phage	98.3	0.0e+00
BBC50854.1|2589812_2590649_+	phage scaffolding protein	NA	A0A0A7NRY7	Enterobacteria_phage	99.6	6.0e-150
BBC50855.1|2590672_2591725_+|capsid	phage major capsid protein	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.0e-194
BBC50856.1|2591770_2592571_+|terminase	phage terminase small subunit	terminase	A0A0A7NPX9	Enterobacteria_phage	92.1	6.0e-131
BBC50857.1|2592672_2593167_+|capsid	phage capsid completion protein	capsid	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
BBC50858.1|2593166_2593367_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
BBC50859.1|2593369_2593612_+|holin	phage holin protein	holin	A0A0A7NRY9	Enterobacteria_phage	98.8	6.4e-36
BBC50860.1|2593689_2594082_+	phage endolysin	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	1.3e-70
BBC50861.1|2594078_2594486_+	hypothetical protein	NA	A0A0A7NPY2	Enterobacteria_phage	96.3	1.9e-64
BBC50862.1|2594623_2595091_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
BBC50863.1|2595074_2595719_+|tail	phage tail completion protein	tail	A0A0A7NV60	Enterobacteria_phage	99.1	1.6e-113
BBC50864.1|2595715_2596297_+|plate	phage baseplate assembly protein	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	5.6e-102
BBC50865.1|2596293_2596644_+|plate	phage baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
BBC50866.1|2596647_2597544_+|plate	phage baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	1.6e-153
BBC50867.1|2597536_2598067_+|tail	phage tail protein	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	1.6e-92
BBC50868.1|2598069_2600229_+|tail	phage tail fiber protein	tail	A0A0A7NV63	Enterobacteria_phage	96.2	6.0e-109
BBC50869.1|2600225_2601128_+	O-acetyl-ADP-ribose deacetylase	NA	A0A0M4QWS3	Salmonella_phage	63.9	6.8e-99
BBC50870.1|2601136_2601715_+|tail	phage tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	2.0e-96
BBC50871.1|2601758_2602331_-	hypothetical protein	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
BBC50872.1|2602487_2602976_-|tail	phage tail assembly protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
BBC50873.1|2602988_2605172_-|tail	phage tail protein	tail	A0A0A7NRZ9	Enterobacteria_phage	89.4	0.0e+00
BBC50874.1|2605353_2605680_+|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBC50875.1|2605679_2606567_+|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	3.6e-169
>prophage 13
AP018488	Escherichia coli O157:H7 pv15-279 DNA, complete genome	5598155	2674047	2733443	5598155	holin,portal,integrase,protease,head,tail,transposase,terminase	Escherichia_phage(36.36%)	67	2667861:2667875	2714525:2714539
2667861:2667875	attL	CATATTCCTCCGGCA	NA	NA	NA	NA
BBC50942.1|2674047_2674575_+	copper/zinc-superoxide dismutase	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
BBC50943.1|2674765_2675347_-|tail	phage tail assembly protein	tail	H6WZM5	Escherichia_phage	100.0	1.9e-94
BBC50944.1|2675343_2676087_-|tail	phage tail assembly protein	tail	Q6H9T4	Enterobacteria_phage	98.8	2.7e-149
BBC50945.1|2676097_2676796_-|tail	phage minor tail protein	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
BBC50946.1|2676795_2677125_-|tail	phage minor tail protein	tail	Q687F2	Enterobacteria_phage	94.5	1.2e-53
BBC50947.1|2679680_2680094_-|tail	phage minor tail protein	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
BBC50948.1|2680120_2680552_-|tail	phage minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
BBC50949.1|2680565_2681195_-|tail	phage major tail protein	tail	Q687F6	Enterobacteria_phage	97.6	1.8e-106
BBC50950.1|2681287_2681554_-|head	phage head protein	head	NA	NA	NA	NA
BBC50951.1|2681611_2681959_-|head	phage head-DNA stabilization protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
BBC50952.1|2681995_2683501_-|head,protease	phage prohead protease	head,protease	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
BBC50953.1|2683490_2683700_-|tail	phage tail protein	tail	E4WL21	Enterobacteria_phage	55.6	4.7e-11
BBC50954.1|2683699_2685082_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.0	1.1e-145
BBC50955.1|2685078_2685285_-|head,tail	phage head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
BBC50956.1|2687167_2687677_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
BBC50957.1|2688377_2688692_-	PchABC family transcriptional regulator	NA	NA	NA	NA	NA
BBC50958.1|2689153_2689621_-	phage endopeptidase	NA	Q7AYI6	Enterobacteria_phage	88.3	7.2e-68
BBC50959.1|2689628_2689760_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
BBC50960.1|2689772_2689955_-	hypothetical protein	NA	NA	NA	NA	NA
BBC50961.1|2690110_2690644_-	phage endolysin	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
BBC50962.1|2690694_2691039_-	hypothetical protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
BBC50963.1|2691043_2691250_-|holin	phage holine protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
BBC50964.1|2691551_2693402_-	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
BBC50965.1|2693715_2693883_-	hypothetical protein	NA	H6WZJ7	Escherichia_phage	70.6	5.4e-10
BBC50966.1|2693879_2694026_-	TciA/TerB-like protein	NA	H6WZJ6	Escherichia_phage	95.8	6.8e-17
BBC50967.1|2694941_2695631_-	phage late gene regulator Q	NA	I6PDF8	Cronobacter_phage	50.7	1.5e-58
BBC50968.1|2695627_2695987_-	phage endonuclease RUS	NA	V5URS4	Shigella_phage	64.9	1.5e-36
BBC50969.1|2695999_2697049_-	hypothetical protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
BBC50970.1|2697496_2697709_-	regulatory protein MokC for HokC	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
BBC50971.1|2697895_2698000_-	hypothetical protein	NA	NA	NA	NA	NA
BBC50972.1|2698109_2698673_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
BBC50973.1|2698799_2699111_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
BBC50974.1|2699107_2699260_-	hypothetical protein	NA	NA	NA	NA	NA
BBC50975.1|2699292_2699649_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
BBC50976.1|2699645_2699870_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
BBC50977.1|2699891_2700590_-	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
BBC50978.1|2700624_2701047_-	phage replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
BBC50979.1|2701078_2702116_-	replication protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
BBC50980.1|2702184_2702610_-	transcriptional regulator	NA	NA	NA	NA	NA
BBC50981.1|2702606_2702834_-	phage antirepressor protein Cro	NA	NA	NA	NA	NA
BBC50982.1|2702931_2703576_+	phage repressor protein CI	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
BBC50983.1|2703849_2704002_+	hypothetical protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
BBC50984.1|2704482_2704671_+	division inhibition protein DicB	NA	NA	NA	NA	NA
BBC50985.1|2704667_2704856_+	hypothetical protein	NA	NA	NA	NA	NA
BBC50986.1|2704951_2707423_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
BBC50987.1|2707481_2707685_+	hypothetical protein	NA	NA	NA	NA	NA
BBC50988.1|2707684_2708518_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	54.4	7.0e-74
BBC50989.1|2708520_2709408_-|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBC50990.1|2709407_2709734_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBC50991.1|2710258_2711056_+	anti-repressor for DgsA	NA	NA	NA	NA	NA
BBC50992.1|2714470_2715358_-|transposase	transposase	transposase	Q6H9S6	Enterobacteria_phage	100.0	3.3e-170
2714525:2714539	attR	TGCCGGAGGAATATG	NA	NA	NA	NA
BBC50993.1|2715357_2715684_-|transposase	transposase	transposase	Q6H9S4	Enterobacteria_phage	97.2	4.1e-54
BBC50994.1|2717283_2718336_-	hypothetical protein	NA	NA	NA	NA	NA
BBC50995.1|2718650_2719967_+	shikimate transporter	NA	NA	NA	NA	NA
BBC50996.1|2720068_2721523_+	AMP nucleosidase	NA	NA	NA	NA	NA
BBC50997.1|2721865_2722582_+	hypothetical protein	NA	NA	NA	NA	NA
BBC50998.1|2723207_2723576_-	hypothetical protein	NA	NA	NA	NA	NA
BBC50999.1|2723541_2724663_-	MATE efflux family protein	NA	NA	NA	NA	NA
BBC51000.1|2724969_2725920_-	ssuEADCB/tauABCD operon transcriptional activator	NA	NA	NA	NA	NA
BBC51001.1|2726021_2726939_-	nitrogen assimilation regulon transcriptional regulator	NA	NA	NA	NA	NA
BBC51002.1|2727395_2728331_-	L,D-transpeptidase linking Lpp to murein	NA	NA	NA	NA	NA
BBC51003.1|2728392_2729472_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
BBC51004.1|2729483_2730227_-	cobalamin synthase	NA	NA	NA	NA	NA
BBC51005.1|2730223_2730766_-	cobinamide kinase and cobinamide phosphate guanylyltransferase	NA	NA	NA	NA	NA
BBC51006.1|2731130_2731511_+	hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
BBC51007.1|2731507_2731855_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
BBC51008.1|2731904_2733443_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
>prophage 14
AP018488	Escherichia coli O157:H7 pv15-279 DNA, complete genome	5598155	2745387	2800962	5598155	holin,integrase,protease,head,tail,terminase	Stx2-converting_phage(50.0%)	75	2755787:2755802	2804307:2804322
BBC51023.1|2745387_2746554_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
BBC51024.1|2748752_2749628_-	T3SS secreted effector OspB	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
BBC51025.1|2749769_2750039_-	hypothetical protein	NA	H6WZN0	Escherichia_phage	98.9	1.4e-44
BBC51026.1|2750040_2751354_-|tail	phage tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	100.0	3.2e-81
BBC51027.1|2751418_2752018_-	outer membrane precursor Lom	NA	Q687E7	Enterobacteria_phage	99.5	6.7e-111
BBC51028.1|2752085_2755562_-	phage host specificity protein	NA	B6DZB5	Enterobacteria_phage	98.5	0.0e+00
2755787:2755802	attL	TTTTTTTATTCTTTTT	NA	NA	NA	NA
BBC51029.1|2755800_2756382_-|tail	phage tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	98.4	8.6e-95
BBC51030.1|2756378_2757116_-|tail	phage tail assembly protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
BBC51031.1|2757169_2758174_-	antirepressor	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	3.4e-192
BBC51032.1|2758163_2758337_-	transcriptional regulator	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
BBC51033.1|2758444_2758765_+	regulatory protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
BBC51034.1|2758781_2759480_-|tail	phage minor tail protein	tail	B6DZB1	Enterobacteria_phage	100.0	6.6e-134
BBC51035.1|2759479_2759821_-|tail	phage minor tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
BBC51036.1|2759813_2763056_-|tail	phage tail length tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
BBC51037.1|2763103_2763313_-|tail	phage minor tail protein	tail	A0A0P0ZED8	Stx2-converting_phage	98.6	3.3e-33
BBC51038.1|2763408_2763783_-|tail	phage tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
BBC51039.1|2763797_2764514_-|tail	phage major tail protein	tail	B6DZA6	Enterobacteria_phage	100.0	1.2e-127
BBC51040.1|2764579_2764924_-|tail	phage minor tail protein	tail	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
BBC51041.1|2764920_2765367_-|tail	phage minor tail protein	tail	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
BBC51042.1|2765363_2765714_-|head,tail	phage head-tail adaptor	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
BBC51043.1|2765724_2766051_-	phage DNA packaging protein	NA	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
BBC51044.1|2768576_2768798_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
BBC51045.1|2768842_2770780_-|head,protease	phage prohead protease	head,protease	A0A0P0ZCT9	Stx2-converting_phage	99.5	0.0e+00
BBC51046.1|2770843_2772505_-|terminase	phage terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
BBC51047.1|2772501_2773065_-|terminase	phage terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	93.6	4.7e-82
BBC51048.1|2773353_2773719_-	DNase	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
BBC51049.1|2773760_2773988_+	hypothetical protein	NA	A0A0P0ZCG8	Stx2-converting_phage	100.0	1.3e-35
BBC51050.1|2774450_2774708_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
BBC51051.1|2774704_2775202_-	hypothetical protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
BBC51052.1|2775404_2775842_-	endopeptidase	NA	A0A0P0ZBQ9	Stx2-converting_phage	96.6	4.2e-70
BBC51053.1|2775838_2776336_-	phage lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	96.4	9.3e-90
BBC51054.1|2776335_2776551_-|holin	phage holine protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
BBC51055.1|2776627_2776900_-	hypothetical protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
BBC51056.1|2776940_2777120_-	hypothetical protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
BBC51057.1|2777257_2779195_-	hypothetical protein	NA	Q6H9W1	Enterobacteria_phage	99.2	0.0e+00
BBC51058.1|2779694_2779964_-	Shiga toxin 1 subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
BBC51059.1|2779973_2780921_-	Shiga toxin 1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
BBC51060.1|2781495_2782089_-	hypothetical protein	NA	V5UT42	Shigella_phage	99.0	5.9e-107
BBC51061.1|2782220_2782643_-	antiterminator Q	NA	D2X3C1	Enterobacteria_phage	91.2	1.5e-69
BBC51062.1|2782593_2782788_-	hypothetical protein	NA	Q6H9W6	Enterobacteria_phage	89.1	1.3e-26
BBC51063.1|2782784_2783390_-	recombination endonuclease	NA	Q8VNP2	Enterobacteria_phage	97.0	6.8e-95
BBC51064.1|2783389_2784112_-	hypothetical protein	NA	A0A0N7C231	Escherichia_phage	98.8	3.3e-128
BBC51065.1|2784186_2784861_-	phage antirepressor protein	NA	A0A0P0ZDQ5	Stx2-converting_phage	88.4	6.9e-112
BBC51066.1|2785126_2785435_-	phage antirepressor protein	NA	A0A0P0ZC44	Stx2-converting_phage	99.0	5.3e-51
BBC51067.1|2785889_2786417_-	DNA methylase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
BBC51068.1|2786413_2786860_-	recombination protein	NA	A0A1U9AJ79	Stx1_converting_phage	100.0	2.4e-81
BBC51069.1|2786816_2787053_-	hypothetical protein	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
BBC51070.1|2787063_2787279_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
BBC51071.1|2787411_2787690_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
BBC51072.1|2787760_2789137_-	replication protein	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
BBC51073.1|2789133_2789955_-	replication protein	NA	B6DZ75	Enterobacteria_phage	100.0	1.5e-153
BBC51074.1|2789941_2790103_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
BBC51075.1|2790135_2790432_-	phage regulatory protein CII	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
BBC51076.1|2790573_2790789_-	phage repressor protein	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
BBC51077.1|2790906_2791560_+	phage repressor protein CI	NA	A0A0N7BTS4	Escherichia_phage	100.0	6.2e-126
BBC51078.1|2792061_2792583_+	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
BBC51079.1|2793151_2793334_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
BBC51080.1|2793311_2793584_+	phage early gene regulator N	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
BBC51081.1|2793642_2793894_+	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
BBC51082.1|2794076_2794445_+	single stranded DNA-binding protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
BBC51083.1|2794517_2794682_+	phage regulatory protein CIII	NA	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
BBC51084.1|2794650_2794794_+	phage kil protein	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
BBC51085.1|2794868_2795165_+	phage host-nuclease inhibitor protein Gam	NA	A0A0P0ZE86	Stx2-converting_phage	100.0	3.3e-50
BBC51086.1|2795170_2795956_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
BBC51087.1|2795952_2796630_+	exonuclease	NA	A0A1I9LJM9	Stx_converting_phage	99.1	2.3e-131
BBC51088.1|2796629_2796812_+	hypothetical protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
BBC51089.1|2796784_2796976_+	hypothetical protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
BBC51090.1|2797052_2797268_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
BBC51091.1|2797366_2797588_+	hypothetical protein	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
BBC51092.1|2797584_2798532_+	hypothetical protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
BBC51093.1|2798725_2799280_+	hypothetical protein	NA	Q6H9Z7	Enterobacteria_phage	73.0	6.1e-74
BBC51094.1|2799276_2799366_+	hypothetical protein	NA	NA	NA	NA	NA
BBC51095.1|2799467_2799812_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
BBC51096.1|2799893_2800085_+	phage excisionase	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
BBC51097.1|2800065_2800962_-|integrase	integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	100.0	4.9e-174
2804307:2804322	attR	AAAAAGAATAAAAAAA	NA	NA	NA	NA
>prophage 15
AP018488	Escherichia coli O157:H7 pv15-279 DNA, complete genome	5598155	2916218	3001120	5598155	holin,transposase,integrase,protease,head,tail,tRNA,terminase	Stx2-converting_phage(72.37%)	83	2940287:2940307	2998626:2998646
BBC51197.1|2916218_2918252_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
BBC51198.1|2919792_2920680_-|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBC51199.1|2920679_2921006_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBC51200.1|2925321_2928954_+	hypothetical protein	NA	NA	NA	NA	NA
BBC51201.1|2929015_2929333_+	hypothetical protein	NA	NA	NA	NA	NA
BBC51202.1|2929964_2931053_+	hexameric AAA+ MoxR family ATPase	NA	NA	NA	NA	NA
BBC51203.1|2933335_2934472_+	VMA domain YehL ATPase stimulator	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
BBC51204.1|2934468_2936472_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
BBC51205.1|2936596_2937058_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	4.1e-76
BBC51206.1|2937099_2937570_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
BBC51207.1|2937616_2938336_-	two-component regulatory system response regulator YehT	NA	NA	NA	NA	NA
BBC51208.1|2938332_2940018_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
2940287:2940307	attL	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
BBC51209.1|2940767_2940878_-	hypothetical protein	NA	NA	NA	NA	NA
BBC51210.1|2940844_2941240_-	hypothetical protein	NA	NA	NA	NA	NA
BBC51211.1|2941634_2945021_+	T3SS secreted effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	100.0	0.0e+00
BBC51212.1|2945623_2946529_-|transposase	IS2 transposase	transposase	Q9ZXG3	Shigella_phage	99.0	3.7e-177
BBC51213.1|2946486_2946672_-|transposase	transposase	transposase	Q76S41	Shigella_phage	98.4	3.9e-25
BBC51214.1|2946620_2946848_-|transposase	transposase	transposase	Q76S41	Shigella_phage	100.0	5.3e-16
BBC51215.1|2947214_2947484_-	hypothetical protein	NA	A0A0P0ZCV7	Stx2-converting_phage	100.0	4.4e-46
BBC51216.1|2947485_2948799_-|tail	phage tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	100.0	3.2e-81
BBC51217.1|2948863_2949463_-	outer membrane precursor Lom	NA	A0A0P0ZCF6	Stx2-converting_phage	100.0	1.0e-111
BBC51218.1|2949529_2953003_-	phage host specificity protein	NA	A0A0P0ZCI5	Stx2-converting_phage	100.0	0.0e+00
BBC51219.1|2953116_2953521_+	hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
BBC51220.1|2953517_2953865_+|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
BBC51221.1|2953913_2955452_+|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	100.0	1.0e-296
BBC51222.1|2955709_2956291_-|tail	phage tail assembly protein	tail	A0A0N7KZG2	Stx2-converting_phage	99.5	5.4e-89
BBC51223.1|2956287_2957031_-|tail	phage tail assembly protein	tail	A0A0P0ZE89	Stx2-converting_phage	100.0	3.7e-151
BBC51224.1|2957041_2957740_-|tail	phage minor tail protein	tail	A0A0N7KZH0	Stx2-converting_phage	98.3	3.4e-130
BBC51225.1|2957739_2958081_-|tail	phage minor tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
BBC51226.1|2958073_2961316_-|tail	phage tail length tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
BBC51227.1|2961363_2961573_-|tail	phage minor tail protein	tail	A0A0P0ZED8	Stx2-converting_phage	98.6	3.3e-33
BBC51228.1|2961668_2962043_-|tail	phage tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
BBC51229.1|2962057_2962774_-|tail	phage major tail protein	tail	B6DZA6	Enterobacteria_phage	100.0	1.2e-127
BBC51230.1|2962839_2963184_-|tail	phage minor tail protein	tail	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
BBC51231.1|2963180_2963627_-|tail	phage minor tail protein	tail	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
BBC51232.1|2963623_2963974_-|head,tail	phage head-tail adaptor	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
BBC51233.1|2963984_2964311_-	phage DNA packaging protein	NA	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
BBC51234.1|2966837_2967059_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
BBC51235.1|2967103_2969041_-|head,protease	phage prohead protease	head,protease	A0A0P0ZCT9	Stx2-converting_phage	100.0	0.0e+00
BBC51236.1|2969104_2970766_-|terminase	phage terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	100.0	0.0e+00
BBC51237.1|2970762_2971326_-|terminase	phage terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
BBC51238.1|2971614_2971980_-	DNase	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
BBC51239.1|2972611_2973079_-	phage endopeptidase	NA	A0A0P0ZDL0	Stx2-converting_phage	100.0	9.0e-79
BBC51240.1|2973086_2973233_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
BBC51241.1|2973232_2973802_-	phage antirepressor	NA	A0A0P0ZE74	Stx2-converting_phage	100.0	1.4e-105
BBC51242.1|2974072_2974603_-	phage endolysin	NA	A0A0N7KZF9	Stx2-converting_phage	100.0	1.3e-102
BBC51243.1|2974653_2974998_-	hypothetical protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
BBC51244.1|2975002_2975218_-|holin	phage holine protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
BBC51245.1|2975294_2975567_-	hypothetical protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
BBC51246.1|2975607_2975787_-	hypothetical protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
BBC51247.1|2975922_2977860_-	hypothetical protein	NA	A0A0P0ZBH7	Stx2-converting_phage	100.0	0.0e+00
BBC51248.1|2978103_2978427_+	RpoS stabilzer during Mg starvation	NA	Q20GJ2	Phage_258-320	100.0	2.0e-61
BBC51249.1|2978789_2979677_-|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBC51250.1|2979676_2980003_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBC51251.1|2980028_2980307_-	Shiga toxin 2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	3.8e-40
BBC51252.1|2980318_2981278_-	Shiga toxin 2c subunit A	NA	A0A0P0ZDQ7	Stx2-converting_phage	100.0	2.1e-175
BBC51253.1|2981661_2982720_-	DNA methylase	NA	A0A0N7KZF8	Stx2-converting_phage	100.0	9.5e-209
BBC51254.1|2982870_2983068_-	hypothetical protein	NA	A0A0P0ZDH6	Stx2-converting_phage	100.0	8.0e-29
BBC51255.1|2983312_2984344_+	hypothetical protein	NA	A0A0P0ZDC5	Stx2-converting_phage	100.0	1.3e-189
BBC51256.1|2984336_2984876_+	hypothetical protein	NA	A0A0P0ZCX2	Stx2-converting_phage	100.0	9.4e-88
BBC51257.1|2984897_2985239_-	phage antiterminator Q	NA	A0A0P0ZCW0	Stx2-converting_phage	100.0	1.6e-61
BBC51258.1|2985256_2986246_-	hypothetical protein	NA	A0A0P0ZD76	Stx2-converting_phage	100.0	3.3e-195
BBC51259.1|2986253_2987051_-	hypothetical protein	NA	A0A0P0ZCS0	Stx2-converting_phage	100.0	5.2e-151
BBC51260.1|2987070_2987460_-	phage Holliday junction resolvase	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
BBC51261.1|2987456_2987783_-	repressor	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	9.2e-54
BBC51262.1|2987779_2988433_-	DNA adenine methylase	NA	A0A0P0ZCC0	Stx2-converting_phage	100.0	1.1e-127
BBC51263.1|2988432_2988921_-	hypothetical protein	NA	A0A0P0ZCF0	Stx2-converting_phage	100.0	6.5e-88
BBC51264.1|2988923_2989742_-	phage replication protein	NA	A0A0P0ZCQ6	Stx2-converting_phage	100.0	2.1e-123
BBC51265.1|2989738_2989963_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
BBC51266.1|2989959_2991111_-	phage antirepressor Ant	NA	A0A0P0ZE80	Stx2-converting_phage	100.0	2.3e-216
BBC51267.1|2991107_2991659_-	transcriptional regulator	NA	A0A0P0ZE62	Stx2-converting_phage	100.0	3.4e-101
BBC51268.1|2991651_2991912_-	phage antirepressor Cro	NA	A0A0P0ZCZ7	Stx2-converting_phage	100.0	1.6e-40
BBC51269.1|2992054_2992702_+	phage repressor protein CI	NA	A0A0N7KZF6	Stx2-converting_phage	100.0	6.2e-118
BBC51270.1|2993480_2993843_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
BBC51271.1|2993908_2994733_+	hypothetical protein	NA	A0A0P0ZBZ4	Stx2-converting_phage	100.0	2.7e-150
BBC51272.1|2994860_2995397_+	hypothetical protein	NA	A0A0P0ZCH9	Stx2-converting_phage	100.0	9.7e-101
BBC51273.1|2995387_2995738_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	100.0	7.0e-60
BBC51274.1|2995734_2996541_+	hypothetical protein	NA	A0A0P0ZD75	Stx2-converting_phage	100.0	1.1e-153
BBC51275.1|2996864_2996999_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
BBC51276.1|2997301_2998588_+|integrase	integrase	integrase	A0A0N7KZF5	Stx2-converting_phage	100.0	5.8e-253
BBC51277.1|2998662_2999310_+	transcriptional activator of csgD and csgBA	NA	Q9EYF2	Enterobacteria_phage	99.4	5.6e-95
2998626:2998646	attR	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
BBC51278.1|2999457_3000189_-	ABC transporter permease	NA	NA	NA	NA	NA
BBC51279.1|3000193_3001120_-	transporter subunit: ATP-binding component of ABC superfamily protein	NA	G9BWD6	Planktothrix_phage	35.1	4.3e-24
>prophage 16
AP018488	Escherichia coli O157:H7 pv15-279 DNA, complete genome	5598155	3214670	3308804	5598155	head,tRNA,transposase,integrase	Stx2-converting_phage(28.0%)	85	3235844:3235860	3247807:3247823
BBC51460.1|3214670_3215483_-|tRNA	tRNA pseudouridine(38-40) synthase	tRNA	NA	NA	NA	NA
BBC51461.1|3215482_3216496_-	semialdehyde dehydrogenase	NA	NA	NA	NA	NA
BBC51462.1|3216561_3217698_-	erythronate-4-phosphate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.8	3.1e-24
BBC51463.1|3217796_3218792_+	flagella assembly protein	NA	NA	NA	NA	NA
BBC51464.1|3218788_3219967_-	arabinose efflux transporter	NA	NA	NA	NA	NA
BBC51465.1|3220241_3221462_-	3-oxoacyl-[acyl-carrier-protein] synthase I	NA	NA	NA	NA	NA
BBC51466.1|3221620_3223627_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
BBC51467.1|3223747_3224026_-	hypothetical protein	NA	NA	NA	NA	NA
BBC51468.1|3224059_3224608_-	elongation factor	NA	NA	NA	NA	NA
BBC51469.1|3224607_3225417_-	TauE/TSUP family inner membrane protein	NA	NA	NA	NA	NA
BBC51470.1|3225416_3226241_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
BBC51471.1|3226244_3227330_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
BBC51472.1|3227364_3228297_-	adenine-specific methylase	NA	NA	NA	NA	NA
BBC51473.1|3228462_3229014_+	DNA endonuclease	NA	NA	NA	NA	NA
BBC51474.1|3229184_3230027_-	outer membrane protein	NA	NA	NA	NA	NA
BBC51475.1|3230028_3230550_-	fimbrial-like adhesin protein	NA	NA	NA	NA	NA
BBC51476.1|3230546_3230975_-	fimbrial-like adhesin protein	NA	NA	NA	NA	NA
BBC51477.1|3231013_3231514_-	fimbrial-like adhesin protein	NA	NA	NA	NA	NA
BBC51478.1|3231524_3232283_-	periplasmic pilin chaperone	NA	NA	NA	NA	NA
BBC51479.1|3232305_3234945_-	outer membrane usher protein	NA	NA	NA	NA	NA
BBC51480.1|3235026_3235590_-	fimbrial-like adhesin protein	NA	NA	NA	NA	NA
3235844:3235860	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
BBC51481.1|3236234_3236720_-	phosphohistidine phosphatase	NA	NA	NA	NA	NA
BBC51482.1|3236922_3239067_-	fatty acid oxidation complex subunit alpha	NA	NA	NA	NA	NA
BBC51483.1|3239066_3240377_-	beta-ketoacyl-CoA thiolase	NA	NA	NA	NA	NA
BBC51484.1|3240556_3240841_-	hypothetical protein	NA	NA	NA	NA	NA
BBC51485.1|3241212_3242553_+	long-chain fatty acid outer membrane transporter	NA	NA	NA	NA	NA
BBC51486.1|3242917_3243949_+	hypothetical protein	NA	NA	NA	NA	NA
BBC51487.1|3244343_3245099_-	phospholipid-binding lipoprotein	NA	NA	NA	NA	NA
BBC51488.1|3245392_3246325_+	inner membrane protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
BBC51489.1|3246636_3247794_+|integrase	integrase	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
BBC51490.1|3247968_3249105_-	phage DNA injection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
3247807:3247823	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
BBC51491.1|3249114_3249795_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
BBC51492.1|3249781_3250249_-	hypothetical protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
BBC51493.1|3250248_3250818_-|head	phage head DNA stabilization protein	head	Q716G6	Shigella_phage	99.3	4.6e-69
BBC51494.1|3250996_3251884_-|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBC51495.1|3251883_3252210_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBC51496.1|3253372_3253792_-	hypothetical protein	NA	NA	NA	NA	NA
BBC51497.1|3253897_3254446_-	hypothetical protein	NA	NA	NA	NA	NA
BBC51498.1|3254526_3254784_-	hypothetical protein	NA	NA	NA	NA	NA
BBC51499.1|3254970_3255147_-	hypothetical protein	NA	NA	NA	NA	NA
BBC51500.1|3255449_3256076_+	resolvase	NA	A0A0A8WJD4	Clostridium_phage	28.7	5.9e-09
BBC51501.1|3256673_3257921_-	sucrose transport protein	NA	NA	NA	NA	NA
BBC51502.1|3257992_3258907_-	fructokinase	NA	NA	NA	NA	NA
BBC51503.1|3259122_3260556_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.0	1.2e-28
BBC51504.1|3260563_3261517_-	sucrose operon repressor	NA	NA	NA	NA	NA
BBC51505.1|3261801_3262020_+	GntP family permease	NA	NA	NA	NA	NA
BBC51506.1|3262037_3263366_+	D-serine dehydratase	NA	NA	NA	NA	NA
BBC51507.1|3263473_3265012_-	multidrug efflux system	NA	NA	NA	NA	NA
BBC51508.1|3265011_3266175_-	multidrug resistance efflux pump membrane fusion protein	NA	NA	NA	NA	NA
BBC51509.1|3266590_3267205_+	two-component regulatory system response regulator EvgA	NA	NA	NA	NA	NA
BBC51510.1|3267209_3270803_+	hybrid sensory histidine kinase in two-component regulatory system with EvgA	NA	A0A1V0SGX0	Hokovirus	32.1	7.8e-37
BBC51511.1|3271093_3271474_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
BBC51512.1|3271470_3271818_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
BBC51513.1|3271867_3272986_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	5.7e-212
BBC51514.1|3273061_3273442_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
BBC51515.1|3273438_3273786_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
BBC51516.1|3273835_3275374_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
BBC51517.1|3275424_3275856_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	5.4e-78
BBC51518.1|3275866_3276904_-	CoA-transferase	NA	NA	NA	NA	NA
BBC51519.1|3276977_3277922_-	transporter	NA	NA	NA	NA	NA
BBC51520.1|3277991_3279686_-	oxalyl CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.4e-23
BBC51521.1|3279739_3280990_-	formyl-CoA transferase	NA	NA	NA	NA	NA
BBC51522.1|3281502_3282138_-	hypothetical protein	NA	NA	NA	NA	NA
BBC51523.1|3282433_3282709_+	colanic acid biosynthesis lipoprotein	NA	NA	NA	NA	NA
BBC51524.1|3282785_3283028_-	inner membrane protein	NA	NA	NA	NA	NA
BBC51525.1|3283380_3284301_+	palmitoleoyl-acyl carrier protein (ACP)-dependent acyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
BBC51526.1|3284792_3286031_-	glutamate-pyruvate aminotransferase	NA	NA	NA	NA	NA
BBC51527.1|3288118_3288853_+	response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
BBC51528.1|3288865_3289723_+	DNA-binding protein	NA	NA	NA	NA	NA
BBC51529.1|3289725_3292221_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
BBC51530.1|3292245_3293283_-	aminopeptidase	NA	NA	NA	NA	NA
BBC51531.1|3293282_3294368_-	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
BBC51532.1|3294382_3295630_-	enzyme IIC component of PTS	NA	NA	NA	NA	NA
BBC51533.1|3295651_3295978_-	enzyme IIB component of PTS	NA	NA	NA	NA	NA
BBC51534.1|3296196_3297162_-	glucokinase	NA	NA	NA	NA	NA
BBC51535.1|3297365_3298622_+	ion channel protein	NA	NA	NA	NA	NA
BBC51536.1|3298736_3299063_+	hypothetical protein	NA	NA	NA	NA	NA
BBC51537.1|3299202_3300441_-	manganese/divalent cation transporter	NA	NA	NA	NA	NA
BBC51538.1|3300776_3301979_+	nucleoside transporter	NA	NA	NA	NA	NA
BBC51539.1|3302028_3304218_-	diguanylate cyclase	NA	NA	NA	NA	NA
BBC51540.1|3304836_3305196_+	transcriptional regulator	NA	NA	NA	NA	NA
BBC51541.1|3305218_3305590_+	hypothetical protein	NA	NA	NA	NA	NA
BBC51542.1|3305629_3306778_-|transposase	IS609 transposase	transposase	A0A1W6JP07	Morganella_phage	97.9	4.3e-207
BBC51543.1|3306845_3307388_+|transposase	IS609 transposase	transposase	A0A1S5RHE3	Helicobacter_phage	57.7	5.1e-41
BBC51544.1|3307388_3308804_-|tRNA	glutamyl-tRNA synthetase	tRNA	NA	NA	NA	NA
>prophage 17
AP018488	Escherichia coli O157:H7 pv15-279 DNA, complete genome	5598155	3506006	3598249	5598155	holin,transposase,protease,head,tail,tRNA,terminase	Stx2-converting_phage(41.3%)	89	NA	NA
BBC51727.1|3506006_3506744_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
BBC51728.1|3506875_3508210_+	ATP-dependent RNA helicase	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
BBC51729.1|3508242_3509124_-	transcriptional regulator	NA	NA	NA	NA	NA
BBC51730.1|3509226_3509814_+	cysteine and O-acetylserine exporter	NA	NA	NA	NA	NA
BBC51731.1|3509869_3510253_-	autonomous glycyl radical cofactor	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
BBC51732.1|3510557_3511247_+	uracil-DNA-glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	3.5e-55
BBC51733.1|3511294_3512332_-	methyltransferase	NA	NA	NA	NA	NA
BBC51734.1|3512538_3512958_+	thioredoxin 2	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
BBC51735.1|3513026_3513725_+	hypothetical protein	NA	NA	NA	NA	NA
BBC51736.1|3513756_3516417_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
BBC51737.1|3516530_3517886_+	phosphatidylserine synthase	NA	NA	NA	NA	NA
BBC51738.1|3517982_3518255_+	lipoprotein	NA	NA	NA	NA	NA
BBC51739.1|3518251_3519550_-	alpha-ketoglutarate transporter	NA	Q6JIH2	Burkholderia_virus	32.2	7.4e-46
BBC51740.1|3525321_3527895_-	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
BBC51741.1|3528024_3528756_-	hypothetical protein	NA	NA	NA	NA	NA
BBC51742.1|3528752_3529733_-	ribosomal large subunit pseudouridine synthase D	NA	NA	NA	NA	NA
BBC51743.1|3529867_3530605_+	BamABCDE complex OM biogenesis lipoprotein	NA	NA	NA	NA	NA
BBC51744.1|3530875_3531217_+	translation inhibitor protein RaiA	NA	NA	NA	NA	NA
BBC51745.1|3531466_3532627_+	chorismate mutase and prephenate dehydratase	NA	NA	NA	NA	NA
BBC51746.1|3532669_3533791_-	chorismate mutase-T and prephenate dehydrogenase	NA	NA	NA	NA	NA
BBC51747.1|3533801_3534872_-	3-deoxy-D-arabino-heptulosonate-7-phosphate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	6.9e-90
BBC51748.1|3535084_3535447_+	lipoprotein	NA	NA	NA	NA	NA
BBC51749.1|3535596_3536115_+	periplasmic inhibitor of YfiN activity	NA	NA	NA	NA	NA
BBC51750.1|3536104_3537331_+	membrane-anchored diguanylate cyclase	NA	NA	NA	NA	NA
BBC51751.1|3537346_3537829_+	OM lipoprotein positive effector of YfiN activity	NA	NA	NA	NA	NA
BBC51752.1|3537905_3538253_-	50S ribosomal subunit protein L19	NA	NA	NA	NA	NA
BBC51753.1|3538294_3539062_-|tRNA	tRNA m(1)G37 methyltransferase	tRNA	NA	NA	NA	NA
BBC51754.1|3539092_3539641_-	ribosome maturation factor	NA	NA	NA	NA	NA
BBC51755.1|3539659_3539908_-	30S ribosomal subunit protein S16	NA	NA	NA	NA	NA
BBC51756.1|3540044_3541406_-	signal recognition particle protein	NA	NA	NA	NA	NA
BBC51757.1|3541497_3542364_+	cytochrome c assembly protein family inner membrane protein	NA	NA	NA	NA	NA
BBC51758.1|3542430_3543672_+	inner membrane protein	NA	NA	NA	NA	NA
BBC51759.1|3543726_3544320_-	co-chaperone GrpE	NA	NA	NA	NA	NA
BBC51760.1|3544442_3545321_+	NAD kinase	NA	NA	NA	NA	NA
BBC51761.1|3545406_3547068_+	recombination and repair protein RecN	NA	NA	NA	NA	NA
BBC51762.1|3547216_3547558_+	lipoprotein component of BamABCDE OM biogenesis complex	NA	NA	NA	NA	NA
BBC51763.1|3547619_3547910_-	hypothetical protein	NA	NA	NA	NA	NA
BBC51764.1|3547899_3548349_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
BBC51765.1|3548507_3548990_+	tmRNA-binding trans-translation protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
BBC51766.1|3549835_3550084_+	DNA-damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
BBC51767.1|3550585_3551176_-	T3SS secreted effector EspM	NA	NA	NA	NA	NA
BBC51768.1|3551358_3552009_+	T3SS secreted effector NleG	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
BBC51769.1|3552087_3553146_+	T3SS secreted effector EspW	NA	NA	NA	NA	NA
BBC51770.1|3553858_3554128_-	hypothetical protein	NA	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
BBC51771.1|3554196_3555420_-|tail	phage tail fiber protein	tail	H6WZM9	Escherichia_phage	99.1	1.2e-58
BBC51772.1|3555484_3556084_-	outer membrane precursor Lom	NA	A0A0P0ZBV0	Stx2-converting_phage	99.5	6.7e-111
BBC51773.1|3556150_3559627_-	phage host specificity protein	NA	A0A0P0ZBW1	Stx2-converting_phage	99.1	0.0e+00
BBC51774.1|3559872_3560454_-|tail	phage tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	94.8	4.9e-90
BBC51775.1|3560450_3561188_-|tail	phage tail assembly protein	tail	A0A0N7KZA3	Stx2-converting_phage	99.6	9.1e-150
BBC51776.1|3561241_3562120_-	phage antirepressor protein	NA	I6R977	Salmonella_phage	77.2	2.5e-93
BBC51777.1|3562913_3563612_-|tail	phage minor tail protein	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
BBC51778.1|3563611_3563953_-|tail	phage minor tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	100.0	1.5e-62
BBC51779.1|3563945_3567188_-|tail	phage tail length tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
BBC51780.1|3567239_3567449_-|tail	phage minor tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
BBC51781.1|3567544_3567919_-|tail	phage tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
BBC51782.1|3567924_3568641_-|tail	phage major tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
BBC51783.1|3568708_3569053_-|tail	phage minor tail protein	tail	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
BBC51784.1|3569049_3569496_-|tail	phage minor tail protein	tail	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
BBC51785.1|3569492_3569843_-|head,tail	phage head-tail adaptor	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
BBC51786.1|3569852_3570179_-	phage DNA packaging protein	NA	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
BBC51787.1|3573133_3576490_-|head,protease	phage prohead protease	head,protease	B6DZX5	Stx2-converting_phage	99.2	0.0e+00
BBC51788.1|3576489_3576795_-|terminase	phage terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	93.5	1.1e-45
BBC51789.1|3576791_3577355_-|terminase	phage terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
BBC51790.1|3577642_3578008_-	DNase	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
BBC51791.1|3578048_3578303_+	hypothetical protein	NA	A0A0P0ZE23	Stx2-converting_phage	98.4	2.0e-27
BBC51792.1|3578635_3579103_-	phage endopeptidase	NA	Q6H9V3	Enterobacteria_phage	100.0	6.9e-79
BBC51793.1|3579255_3579825_-	phage antirepressor	NA	A0A1I9LJR6	Stx_converting_phage	99.5	4.4e-104
BBC51794.1|3580467_3581157_+|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.6	1.7e-126
BBC51795.1|3581159_3581504_-	phage endolysin	NA	B6DZ92	Enterobacteria_phage	97.0	3.8e-50
BBC51796.1|3581554_3581899_-	hypothetical protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
BBC51797.1|3581903_3582119_-|holin	phage holine protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
BBC51798.1|3582268_3584122_-	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
BBC51799.1|3584362_3584692_+	hypothetical protein	NA	NA	NA	NA	NA
BBC51800.1|3584782_3585022_-	membrane protein	NA	NA	NA	NA	NA
BBC51801.1|3585029_3585524_-	membrane protein	NA	NA	NA	NA	NA
BBC51802.1|3585776_3586400_-	phage antitermination protein Q	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
BBC51803.1|3586396_3587062_-	serine/threonine-specific protein phosphatase 1	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
BBC51804.1|3587058_3587670_-	recombination endonuclease	NA	A0A1U9AJF8	Stx1_converting_phage	96.1	6.5e-93
BBC51805.1|3587644_3588211_-	hypothetical protein	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
BBC51806.1|3589052_3589427_+	putative lipoprotein	NA	NA	NA	NA	NA
BBC51807.1|3589502_3590711_-	hypothetical protein	NA	NA	NA	NA	NA
BBC51808.1|3591106_3591520_-	hypothetical protein	NA	NA	NA	NA	NA
BBC51809.1|3591617_3592016_-	hypothetical protein	NA	NA	NA	NA	NA
BBC51810.1|3592016_3593648_-	DNA-binding protein	NA	NA	NA	NA	NA
BBC51811.1|3594029_3594956_-	hypothetical protein	NA	NA	NA	NA	NA
BBC51812.1|3594957_3596163_-	site specific recombinase	NA	NA	NA	NA	NA
BBC51813.1|3596483_3596690_-	putative phage protein	NA	A0A1V0E8E5	Vibrio_phage	43.3	1.8e-07
BBC51814.1|3597035_3597923_-|transposase	transposase	transposase	Q6H9S6	Enterobacteria_phage	100.0	3.3e-170
BBC51815.1|3597922_3598249_-|transposase	transposase	transposase	Q6H9S4	Enterobacteria_phage	97.2	4.1e-54
>prophage 18
AP018488	Escherichia coli O157:H7 pv15-279 DNA, complete genome	5598155	3925789	3963834	5598155	tRNA,transposase,integrase,protease	Stx2-converting_phage(57.14%)	37	3942553:3942569	3971969:3971985
BBC52107.1|3925789_3926548_+|protease	metalloprotease	protease	NA	NA	NA	NA
BBC52108.1|3926753_3927674_-	agmatinase	NA	NA	NA	NA	NA
BBC52109.1|3927809_3928541_-	lipoprotein	NA	NA	NA	NA	NA
BBC52110.1|3928686_3930663_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
BBC52111.1|3931150_3931402_-	inner membrane protein	NA	NA	NA	NA	NA
BBC52112.1|3931457_3932612_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
BBC52113.1|3933048_3934443_+	D-galactose transporter	NA	NA	NA	NA	NA
BBC52114.1|3934561_3935017_+	hypothetical protein	NA	NA	NA	NA	NA
BBC52115.1|3935111_3935819_+	DNA-specific endonuclease I	NA	NA	NA	NA	NA
BBC52116.1|3935898_3936630_+	16S rRNA m(3)U1498 methyltransferase	NA	NA	NA	NA	NA
BBC52117.1|3936642_3937590_+	glutathione synthetase	NA	NA	NA	NA	NA
BBC52118.1|3937629_3938265_+	hypothetical protein	NA	NA	NA	NA	NA
BBC52119.1|3938264_3938681_+	Holliday junction resolvase	NA	NA	NA	NA	NA
BBC52120.1|3938871_3939852_-	twitching motility protein PilT	NA	NA	NA	NA	NA
BBC52121.1|3939869_3940574_+	hypothetical protein	NA	NA	NA	NA	NA
BBC52122.1|3940591_3941158_+	hypothetical protein	NA	NA	NA	NA	NA
BBC52123.1|3941154_3941445_+	hypothetical protein	NA	NA	NA	NA	NA
BBC52124.1|3941452_3942046_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
BBC52125.1|3942038_3943175_+	oxidoreductase	NA	NA	NA	NA	NA
3942553:3942569	attL	CGCTGGAAGAGGCGCTT	NA	NA	NA	NA
BBC52126.1|3943417_3944425_-	hypothetical protein	NA	NA	NA	NA	NA
BBC52127.1|3944541_3945588_-	periplasmic L-asparaginase 2	NA	NA	NA	NA	NA
BBC52128.1|3945763_3946483_-	hypothetical protein	NA	NA	NA	NA	NA
BBC52129.1|3946666_3946993_-	hypothetical protein	NA	NA	NA	NA	NA
BBC52130.1|3946992_3947712_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
BBC52131.1|3947872_3948925_+	adenine DNA glycosylase	NA	NA	NA	NA	NA
BBC52132.1|3948952_3949228_+	oxidative damage protective factor for iron-sulfur proteins	NA	NA	NA	NA	NA
BBC52133.1|3949292_3950372_+	membrane-bound lytic murein transglycosylase C	NA	NA	NA	NA	NA
BBC52134.1|3950573_3951830_+	nucleoside transporter	NA	NA	NA	NA	NA
BBC52135.1|3951879_3954015_-	ornithine decarboxylase isozyme	NA	NA	NA	NA	NA
BBC52136.1|3954412_3955120_+	inner membrane protein	NA	NA	NA	NA	NA
BBC52137.1|3955498_3956764_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	38.1	3.0e-76
BBC52138.1|3956880_3957666_-	hypothetical protein	NA	A0A0P0ZBS5	Stx2-converting_phage	99.0	2.3e-114
BBC52139.1|3957754_3958429_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	30.1	2.4e-11
BBC52140.1|3958425_3958773_+|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	72.0	1.0e-42
BBC52141.1|3958792_3960241_+|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	55.6	3.5e-137
BBC52142.1|3961094_3961628_-	PagC-like membrane protein	NA	Q9LA63	Enterobacterial_phage	32.4	1.2e-15
BBC52143.1|3962943_3963834_+|transposase	transposase	transposase	NA	NA	NA	NA
3971969:3971985	attR	CGCTGGAAGAGGCGCTT	NA	NA	NA	NA
>prophage 19
AP018488	Escherichia coli O157:H7 pv15-279 DNA, complete genome	5598155	3966878	3981707	5598155	transposase,protease	Stx2-converting_phage(83.33%)	15	NA	NA
BBC52145.1|3966878_3967868_+	T3SS secreted effector NleB	NA	Q8HAB2	Salmonella_phage	58.5	2.9e-98
BBC52146.1|3967916_3968591_+	T3SS secreted effector NleE	NA	NA	NA	NA	NA
BBC52147.1|3969024_3969813_+	endonuclease	NA	NA	NA	NA	NA
BBC52148.1|3970701_3970890_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	97.7	7.4e-16
BBC52149.1|3970886_3971234_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
BBC52150.1|3971283_3972822_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
BBC52151.1|3973044_3973395_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	65.5	1.8e-39
BBC52152.1|3973607_3975011_+|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.3	7.0e-175
BBC52153.1|3975407_3976793_-	phosphate transporter	NA	NA	NA	NA	NA
BBC52154.1|3977083_3978943_-	glutathionylspermidine synthetase/amidase	NA	NA	NA	NA	NA
BBC52155.1|3979147_3980014_+	S-transferase	NA	NA	NA	NA	NA
BBC52156.1|3980136_3980385_-	hydrogenase 2 accessory protein	NA	NA	NA	NA	NA
BBC52157.1|3980397_3980739_-	hydrogenase nickel incorporation protein	NA	NA	NA	NA	NA
BBC52158.1|3980731_3981220_-	hydrogenase 2-specific chaperone	NA	NA	NA	NA	NA
BBC52159.1|3981212_3981707_-|protease	maturation protease for hydrogenase 2	protease	NA	NA	NA	NA
>prophage 20
AP018488	Escherichia coli O157:H7 pv15-279 DNA, complete genome	5598155	4167915	4220235	5598155	transposase,protease	Escherichia_phage(17.65%)	52	NA	NA
BBC52327.1|4167915_4169859_-|protease	ATP-dependent zinc-metallo protease	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.4e-118
BBC52328.1|4169949_4170579_-	23S rRNA U2552 2'-O-ribose methyltransferase	NA	NA	NA	NA	NA
BBC52329.1|4170704_4170998_+	RNA binding protein associated with pre-50S ribosomal subunits	NA	NA	NA	NA	NA
BBC52330.1|4171153_4171630_-	transcript cleavage factor	NA	NA	NA	NA	NA
BBC52331.1|4171877_4173311_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
BBC52332.1|4173350_4174523_-	GTPase	NA	NA	NA	NA	NA
BBC52333.1|4174538_4175504_-	inner membrane transporter	NA	NA	NA	NA	NA
BBC52334.1|4175630_4175888_-	50S ribosomal subunit protein L27	NA	NA	NA	NA	NA
BBC52335.1|4175908_4176220_-	50S ribosomal subunit protein L21	NA	NA	NA	NA	NA
BBC52336.1|4176478_4177450_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
BBC52337.1|4177678_4177957_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
BBC52338.1|4178004_4179264_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
BBC52339.1|4179318_4179588_-	acid stress protein	NA	NA	NA	NA	NA
BBC52340.1|4179732_4180026_-	phospholipid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
BBC52341.1|4180025_4180661_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
BBC52342.1|4180679_4181231_-	ABC-type organic solvent transporter	NA	NA	NA	NA	NA
BBC52343.1|4181235_4182018_-	ABC transporter permease	NA	NA	NA	NA	NA
BBC52344.1|4182025_4182835_-	organic solvent ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
BBC52345.1|4183044_4184022_+	calcium/sodium:proton antiporter	NA	NA	NA	NA	NA
BBC52346.1|4184035_4185022_+	D-arabinose 5-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
BBC52347.1|4185042_4185609_+	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
BBC52348.1|4185605_4186181_+	periplasmic membrane-anchored LPS-binding protein	NA	NA	NA	NA	NA
BBC52349.1|4186149_4186707_+	lipopolysaccharide export system protein LptA	NA	NA	NA	NA	NA
BBC52350.1|4186713_4187439_+	lipopolysaccharide export ABC transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
BBC52351.1|4187486_4188920_+	RNA polymerase sigma 54 factor RpoN	NA	NA	NA	NA	NA
BBC52352.1|4188942_4189230_+	ribosome hibernation promoting factor HPF	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
BBC52353.1|4189347_4189839_+	sugar-specific enzyme IIA component of PTS	NA	NA	NA	NA	NA
BBC52354.1|4189884_4190739_+	nucleotide-binding protein	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
BBC52355.1|4190735_4191008_+	phosphohistidinoprotein-hexose phosphotransferase component of N-regulated PTS system	NA	NA	NA	NA	NA
BBC52356.1|4191221_4191854_+	Mg(2+)-starvation-stimulated protein	NA	NA	NA	NA	NA
BBC52357.1|4191850_4192579_-	biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
BBC52358.1|4192575_4193229_-	isoprenoid biosynthesis protein with amidotransferase-like domain	NA	NA	NA	NA	NA
BBC52359.1|4193458_4195795_-	aerobic respiration control sensor histidine protein kinase	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
BBC52360.1|4195890_4196820_-	Fe-S oxidoreductase	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	2.0e-16
BBC52361.1|4197400_4201954_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
BBC52362.1|4201966_4203385_+	glutamate synthase small subunit	NA	NA	NA	NA	NA
BBC52363.1|4204676_4205141_-	hypothetical protein	NA	NA	NA	NA	NA
BBC52364.1|4205137_4206013_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
BBC52365.1|4206009_4206699_-	N-acetylmannosamine-6-P epimerase	NA	NA	NA	NA	NA
BBC52366.1|4206746_4208237_-	sialic acid transporter	NA	Q6JIH2	Burkholderia_virus	23.6	3.7e-09
BBC52367.1|4208345_4209239_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
BBC52368.1|4209360_4210152_-	sialic acid-inducible nan operon repressor	NA	NA	NA	NA	NA
BBC52369.1|4210663_4211551_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	99.7	3.1e-168
BBC52370.1|4211550_4211877_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBC52371.1|4213246_4213744_-|protease	ClpXP protease specificity enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
BBC52372.1|4213749_4214388_-	stringent starvation protein A	NA	NA	NA	NA	NA
BBC52373.1|4214782_4215175_-	30S ribosomal subunit protein S9	NA	NA	NA	NA	NA
BBC52374.1|4215190_4215619_-	50S ribosomal subunit protein L13	NA	NA	NA	NA	NA
BBC52375.1|4215837_4216965_-	cell division protein ZapE	NA	NA	NA	NA	NA
BBC52376.1|4217158_4217557_+	inner membrane-anchored protein	NA	NA	NA	NA	NA
BBC52377.1|4217710_4219078_+|protease	serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
BBC52378.1|4219167_4220235_+|protease	serine endoprotease	protease	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 21
AP018488	Escherichia coli O157:H7 pv15-279 DNA, complete genome	5598155	4625653	4683610	5598155	tRNA,transposase,integrase	Stx2-converting_phage(14.29%)	55	4638763:4638777	4683409:4683423
BBC52748.1|4625653_4626127_+|tRNA	tRNA Leu mC34,mU34 2'-O-methyltransferase	tRNA	NA	NA	NA	NA
BBC52749.1|4626179_4627001_-	serine acetyltransferase	NA	NA	NA	NA	NA
BBC52750.1|4627080_4628100_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
BBC52751.1|4628099_4628567_-	protein-export protein SecB	NA	NA	NA	NA	NA
BBC52752.1|4628629_4628881_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
BBC52753.1|4629022_4629454_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
BBC52754.1|4629698_4631243_+	phosphoglyceromutase	NA	NA	NA	NA	NA
BBC52755.1|4631276_4632536_+	murein hydrolase activator	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
BBC52756.1|4632539_4633499_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
BBC52757.1|4633504_4634521_-	LPS(HepIII)-glucuronic acid glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	2.2e-08
BBC52758.1|4634759_4635785_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	1.8e-18
BBC52759.1|4635794_4636991_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
BBC52760.1|4637265_4638138_-	hypothetical protein	NA	NA	NA	NA	NA
BBC52761.1|4638425_4639358_+	ADP-L-glycero-D-mannoheptose-6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
4638763:4638777	attL	ACGCTTCTTCCGCAG	NA	NA	NA	NA
BBC52762.1|4639367_4640414_+	heptosyltransferase II	NA	NA	NA	NA	NA
BBC52763.1|4640417_4641410_+	heptosyltransferase I	NA	NA	NA	NA	NA
BBC52764.1|4641406_4642615_+	O-antigen ligase	NA	NA	NA	NA	NA
BBC52765.1|4642650_4643793_-	lipopolysaccharide 1,2-N- acetylglucosamine transferase WaaD	NA	NA	NA	NA	NA
BBC52766.1|4643809_4644814_-	lipopolysaccharide 1,2-glucosyltransferase WaaR	NA	NA	NA	NA	NA
BBC52767.1|4644838_4645546_-	lipopolysaccharide core biosynthesis protein WaaY	NA	NA	NA	NA	NA
BBC52768.1|4645571_4646579_-	UDP-D-galactose:(glucosyl)lipopolysaccharide- alpha-1,3-D-galactosyltransferase	NA	NA	NA	NA	NA
BBC52769.1|4646621_4647419_-	kinase that phosphorylates core heptose of lipopolysaccharide	NA	NA	NA	NA	NA
BBC52770.1|4647411_4648536_-	glucosyltransferase I	NA	NA	NA	NA	NA
BBC52771.1|4648532_4649591_-	lipopolysaccharide core biosynthesis protein WaaQ	NA	NA	NA	NA	NA
BBC52772.1|4650003_4651281_+	3-deoxy-D-manno-octulosonic-acid transferase	NA	NA	NA	NA	NA
BBC52773.1|4651288_4651768_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
BBC52774.1|4651806_4652616_-	formamidopyrimidine/5-formyluracil/5- hydroxymethyluracil DNA glycosylase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
BBC52775.1|4652713_4652881_-	50S ribosomal subunit protein L33	NA	NA	NA	NA	NA
BBC52776.1|4652901_4653138_-	50S ribosomal subunit protein L28	NA	NA	NA	NA	NA
BBC52777.1|4653354_4654023_-	hypothetical protein	NA	NA	NA	NA	NA
BBC52778.1|4654194_4655415_+	phosphopantothenoylcysteine decarboxylase	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
BBC52779.1|4655392_4655851_+	deoxyuridinetriphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
BBC52780.1|4655957_4656554_+	division inhibitor protein	NA	NA	NA	NA	NA
BBC52781.1|4656590_4657232_-	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
BBC52782.1|4657297_4658014_-	ribonuclease PH	NA	NA	NA	NA	NA
BBC52783.1|4658140_4659004_+	hypothetical protein	NA	NA	NA	NA	NA
BBC52784.1|4659224_4660049_+	DNA-damage-inducible protein DinD	NA	A0A1W6JPJ7	Morganella_phage	76.1	4.5e-89
BBC52785.1|4660514_4660895_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
BBC52786.1|4660891_4661239_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
BBC52787.1|4661288_4662827_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
BBC52788.1|4663404_4665087_-	DNA ligase	NA	A0A1Q2U2Q6	Vibrio_phage	23.8	3.3e-22
BBC52789.1|4665344_4665968_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	33.9	3.5e-17
BBC52790.1|4666022_4666298_+	RNA polymerase omega subunit	NA	NA	NA	NA	NA
BBC52791.1|4666316_4668425_+	bifunctional (p)ppGpp synthase/hydrolase SpoT	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
BBC52792.1|4668464_4669121_+|tRNA	tRNA mG18-2'-O-methyltransferase	tRNA	NA	NA	NA	NA
BBC52793.1|4669126_4671208_+	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
BBC52794.1|4671192_4672059_-	hypothetical protein	NA	NA	NA	NA	NA
BBC52795.1|4672061_4673267_-	glutamate transporter	NA	NA	NA	NA	NA
BBC52796.1|4673546_4674938_+	xanthine permease	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
BBC52797.1|4675058_4676768_+	hypothetical protein	NA	NA	NA	NA	NA
BBC52798.1|4676820_4679139_-	alpha-glucosidase	NA	NA	NA	NA	NA
BBC52799.1|4679148_4680531_-	transporter	NA	NA	NA	NA	NA
BBC52800.1|4681113_4682295_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	68.9	1.4e-160
BBC52801.1|4682429_4682744_+|transposase	IS602 transposase	transposase	Q716C1	Shigella_phage	59.6	3.6e-23
BBC52802.1|4682863_4683610_+|transposase	IS602 transposase	transposase	Q716C2	Shigella_phage	59.4	8.8e-84
4683409:4683423	attR	ACGCTTCTTCCGCAG	NA	NA	NA	NA
>prophage 22
AP018488	Escherichia coli O157:H7 pv15-279 DNA, complete genome	5598155	5173744	5215489	5598155	portal,integrase,tail,tRNA,protease,head,holin,transposase,terminase	Stx2-converting_phage(45.45%)	49	5175025:5175040	5219634:5219649
BBC53216.1|5173744_5174278_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
BBC53217.1|5174474_5174648_+	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
BBC53218.1|5174695_5174977_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5175025:5175040	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
BBC53219.1|5175373_5176912_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
BBC53220.1|5176961_5177309_-|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
BBC53221.1|5177305_5177686_-	hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
BBC53222.1|5178013_5178259_+	hypothetical protein	NA	NA	NA	NA	NA
BBC53223.1|5178176_5178473_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
BBC53224.1|5178645_5179320_-	phage repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
BBC53225.1|5179410_5179611_+	antirepressor	NA	U5P445	Shigella_phage	100.0	7.9e-32
BBC53226.1|5179660_5179909_+	phage antitermination protein Q	NA	K7PGU5	Enterobacteria_phage	97.5	3.0e-41
BBC53227.1|5181188_5183039_+	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
BBC53228.1|5183487_5183694_+|holin	phage holine protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
BBC53229.1|5183693_5184191_+	phage lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
BBC53230.1|5184187_5184655_+	phage murein endopeptidase	NA	Q7AYI6	Enterobacteria_phage	80.1	4.0e-58
BBC53231.1|5185120_5185435_+	PchABC family transcriptional regulator	NA	NA	NA	NA	NA
BBC53232.1|5185516_5185741_-	hypothetical protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
BBC53233.1|5185782_5186247_+	DNase	NA	H6WZK7	Escherichia_phage	84.7	1.4e-63
BBC53234.1|5186429_5186993_+|terminase	phage terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
BBC53235.1|5186989_5188651_+|terminase	phage terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.1	0.0e+00
BBC53236.1|5188714_5190652_+|head,protease	phage prohead protease	head,protease	Q6H9U8	Enterobacteria_phage	99.7	0.0e+00
BBC53237.1|5190863_5192228_+|portal	phage portal protein	portal	B6DZX6	Stx2-converting_phage	95.8	3.1e-252
BBC53238.1|5192224_5193040_+|portal	phage portal protein	portal	Q6H9U5	Enterobacteria_phage	60.7	7.6e-57
BBC53239.1|5193119_5193446_+	phage DNA packaging protein	NA	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
BBC53240.1|5193455_5193806_+|head,tail	phage head-tail adaptor	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
BBC53241.1|5193802_5194249_+|tail	phage minor tail protein	tail	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
BBC53242.1|5194245_5194590_+|tail	phage minor tail protein	tail	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
BBC53243.1|5194655_5195372_+|tail	phage major tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
BBC53244.1|5195377_5195884_+|tail	phage tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	3.1e-64
BBC53245.1|5195846_5196056_+|tail	phage minor tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
BBC53246.1|5196107_5199350_+|tail	phage tail length tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.9	0.0e+00
BBC53247.1|5199342_5199684_+|tail	phage minor tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
BBC53248.1|5199683_5200382_+|tail	phage minor tail protein	tail	H6WZM3	Escherichia_phage	97.0	1.1e-128
BBC53249.1|5200392_5201136_+|tail	phage tail assembly protein	tail	Q9EYE4	Enterobacteria_phage	98.4	1.7e-148
BBC53250.1|5201132_5201714_+|tail	phage tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	88.5	1.1e-86
BBC53251.1|5201958_5202927_+	phage host specificity protein	NA	A0A0P0ZBW1	Stx2-converting_phage	99.3	5.7e-168
BBC53252.1|5202923_5205347_+	phage host specificity protein	NA	A0A0P0ZCI5	Stx2-converting_phage	82.9	0.0e+00
BBC53253.1|5205414_5206014_+	outer membrane precursor Lom	NA	Q687E7	Enterobacteria_phage	99.0	2.0e-110
BBC53254.1|5206078_5207392_+|tail	phage tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	8.8e-79
BBC53255.1|5207393_5207663_+	hypothetical protein	NA	A0A0P0ZEF0	Stx2-converting_phage	96.6	1.2e-43
BBC53256.1|5207774_5208347_+	T3SS secreted effector NleG	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
BBC53257.1|5208419_5209049_+	T3SS secreted effector NleG	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
BBC53258.1|5209130_5209772_+	T3SS secreted effector NleG	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
BBC53259.1|5209932_5210181_-	DNA-damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
BBC53260.1|5210242_5211340_-|integrase	integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
BBC53261.1|5211428_5212466_+|tRNA	tRNA-dihydrouridine synthase A	tRNA	NA	NA	NA	NA
BBC53262.1|5212599_5212842_+	phage shock protein G	NA	NA	NA	NA	NA
BBC53263.1|5213007_5213991_-	quinone oxidoreductase	NA	NA	NA	NA	NA
BBC53264.1|5214073_5215489_+	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.1	8.3e-200
5219634:5219649	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
>prophage 23
AP018488	Escherichia coli O157:H7 pv15-279 DNA, complete genome	5598155	5432998	5492864	5598155	tRNA,transposase,integrase	Escherichia_phage(20.0%)	36	5446070:5446129	5488913:5490222
BBC53465.1|5432998_5435854_-|tRNA	valyl-tRNA synthetase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
BBC53466.1|5435853_5436297_-	DNA polymerase III chi subunit HolC	NA	NA	NA	NA	NA
BBC53467.1|5436650_5438162_-	multifunctional aminopeptidase A	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
BBC53468.1|5438449_5439529_+	lipopolysaccharide export ABC permease	NA	NA	NA	NA	NA
BBC53469.1|5439528_5440611_+	lipopolysaccharide export ABC permease	NA	NA	NA	NA	NA
BBC53470.1|5440771_5442274_-	hypothetical protein	NA	A0A248XCZ8	Klebsiella_phage	44.0	3.9e-83
BBC53471.1|5442403_5443423_-	alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	2.4e-44
BBC53472.1|5443793_5445743_+|integrase	integrase	integrase	NA	NA	NA	NA
5446070:5446129	attL	TGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATC	NA	NA	NA	NA
BBC53473.1|5446111_5446999_-|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBC53474.1|5446998_5447325_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBC53475.1|5447350_5447716_-	hypothetical protein	NA	NA	NA	NA	NA
BBC53476.1|5447837_5448170_-	hypothetical protein	NA	NA	NA	NA	NA
BBC53477.1|5449173_5449641_-	hypothetical protein	NA	A0A0F6WE62	Mycobacterium_phage	43.0	7.3e-28
BBC53478.1|5449833_5450403_+	site-specific recombinases	NA	A0A219Y9V9	Aeromonas_phage	41.6	8.6e-23
BBC53479.1|5450601_5451918_-	hypothetical protein	NA	NA	NA	NA	NA
BBC53480.1|5452069_5452822_-	hypothetical protein	NA	NA	NA	NA	NA
BBC53481.1|5452944_5453403_+	transcription regulator	NA	NA	NA	NA	NA
BBC53482.1|5454118_5454946_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	40.4	4.3e-55
BBC53483.1|5455405_5456257_-	restriction endonuclease	NA	NA	NA	NA	NA
BBC53484.1|5456243_5456552_-	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
BBC53485.1|5456797_5457901_-	HNH endonuclease	NA	NA	NA	NA	NA
BBC53486.1|5457904_5458612_-	hypothetical protein	NA	NA	NA	NA	NA
BBC53487.1|5458618_5460271_-	membrane protein	NA	NA	NA	NA	NA
BBC53488.1|5460482_5463842_+	hypothetical protein	NA	NA	NA	NA	NA
BBC53489.1|5463841_5470156_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	21.7	1.2e-35
BBC53490.1|5470379_5473238_+	ATP-dependent helicase	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	24.9	2.9e-42
BBC53491.1|5473240_5478175_+	hypothetical protein	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	20.9	4.1e-28
BBC53492.1|5478174_5484516_+	RNA helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	22.1	6.4e-58
BBC53493.1|5484512_5486627_+	DNA helicase	NA	G3MA40	Bacillus_virus	24.1	5.9e-08
BBC53494.1|5487716_5488043_+|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBC53495.1|5488042_5488930_+|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBC53496.1|5489016_5489397_+	hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
BBC53497.1|5489393_5489741_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
BBC53498.1|5489790_5491329_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
5488913:5490222	attR	GATGATCTGGCAGCCTGAGTTCACAGATAAAACACTCTCCAGGAAACCCGGGGCGGTTCAAAGTGGTGTCCACCAAATAAGTAGTGGGAACCAAAGTATCAGATATGCAGAAAAATGTGACTCCCGGCAGGCGAAAAGGCTGCCCTAATTATCCTCCCGAATTTAAACAGCAGCTCGTTGCTGCCTCCTGTGAACCCGGGATATCCATCTCAAAACTTGCTCTTGAAAATGGCATTAACGCCAATCTGTTGTTCAAATGGCGACAACAATGGCGCGAGGGAAAGCTGCTATTACCTTCTTCAGAGAGCCCCCAGCTACTTCCTGTGACTCTCGATGCAGCTGCCGAACAGCCAGAATCGCTCGCAGAGGACCCGGAAACCCTCAGTATCAGCTGTGAGGTAACGTTCCGGCACGGGACGCTCCGCTTCAATGGCAATGTCAGCGAAAAGCTCCTGACTCTGCTGATACAGGAACTGAAGCGATGATCCCGTTACCTTCCGGGACCAAAATTTGGCTGGTTGCCGGTATCACCGATATGAGAAATGGCTTCAACGGCCTGGCTGCGAAAGTACAAACGGCGCTGAAAGACGATCCCATGTCCGGCCATGTTTTCATTTTCCGGGGCCGCAGCGGCAGTCAGGTTAAACTGCTGTGGTCCACCGGTGACGGACTGTGCCTCCTGACCAAACGGCTGGAGCGTGGGCGCTTCGCCTGGCCGTCAGCCCGTGATGGCAAAGTGTTCCTTACGCAGGCGCAGCTGGCGATGCTGCTGGAAGGTATCGACTGGCGACAGCCTAAGCGGCTGCTGACCTCCCTGACCATGCTGTAAATCTCTTTATCCTGGTTGTCACAGAATAAGCCCGGTAAAATACGGGCTTATGAACGACATCTCTTCTGACGACATCTTCCTGCTGAAACAGCGCCTGGCCGAACAGGAAGCGCTGATCCACGCCCTGCAGGAAAAGCTGAGCAACCGGGAGCGCGAAATAGACCATCTGCAGGCGCAGCTGGATAAACTCCGCCGGATGAACTTCGGCAGTCGTTCCGAAAAAGTCTCCCGCCGTATCGCACAAATGGAAGCCGATCTGAACCGGCTTCAGAAAGAGAGCGATACGCTGACTGGTAGGGTGTATGACCCGGCAGTACAGCGTCCGTTGCGTCAGACCCGCACCCGTAAGCCGTTCCCTGAATCACTACCCCGTGACGAAAAGCGACTGTTGCCTGCGGCGCCGTGCTGCCCGAACTGCGGCGGTTCACTGAGCTATCTGGGCGAGGATACCGCCGAACAGCTGGAGTTGATGCGTAGCGCC	NA	NA	NA	NA
BBC53499.1|5491339_5491588_-	hypothetical protein	NA	NA	NA	NA	NA
BBC53500.1|5491883_5492864_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	56.9	1.9e-102
>prophage 1
AP018489	Escherichia coli O157:H7 plasmid pO157pv15279 pv15-279 DNA, complete genome	94391	14541	57362	94391	transposase	Shigella_phage(15.0%)	50	NA	NA
BBC53607.1|14541_14847_+|transposase	IS911 transposase	transposase	Q716C1	Shigella_phage	97.0	1.1e-43
BBC53608.1|15059_15713_+|transposase	IS911 transposase	transposase	Q716C2	Shigella_phage	90.3	1.7e-120
BBC53609.1|16253_16769_+	hemolysin C	NA	NA	NA	NA	NA
BBC53610.1|16770_19767_+	hemolysin A	NA	NA	NA	NA	NA
BBC53611.1|19816_21937_+	hemolysin B	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
BBC53612.1|21940_23380_+	hemolysin D	NA	NA	NA	NA	NA
BBC53613.1|24571_25033_+	recombinase	NA	NA	NA	NA	NA
BBC53614.1|25080_25461_+	hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
BBC53615.1|25457_25805_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
BBC53616.1|25854_27393_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
BBC53617.1|27426_27669_-	hypothetical protein	NA	NA	NA	NA	NA
BBC53618.1|27752_27872_+	hypothetical protein	NA	NA	NA	NA	NA
BBC53619.1|27947_28925_-	replication protein RepFIB	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
BBC53620.1|30054_31221_+	SopA protein	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
BBC53621.1|31220_32192_+	SopB protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
BBC53622.1|32862_33789_+	hypothetical protein	NA	NA	NA	NA	NA
BBC53623.1|34174_34858_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
BBC53624.1|34858_35080_+	hypothetical protein	NA	NA	NA	NA	NA
BBC53625.1|35093_35528_+	hypothetical protein	NA	NA	NA	NA	NA
BBC53626.1|35573_36350_+	hypothetical protein	NA	NA	NA	NA	NA
BBC53627.1|36767_37193_+	antirestriction protein	NA	NA	NA	NA	NA
BBC53628.1|37239_37662_+	hypothetical protein	NA	NA	NA	NA	NA
BBC53629.1|37658_37850_+	hypothetical protein	NA	NA	NA	NA	NA
BBC53630.1|38838_39069_+	hypothetical protein	NA	NA	NA	NA	NA
BBC53631.1|39120_40482_+	hydrolase	NA	NA	NA	NA	NA
BBC53632.1|40528_41092_+	hypothetical protein	NA	A8HNV9	Thalassomonas_phage	36.7	1.0e-20
BBC53633.1|41091_41334_+	hypothetical protein	NA	NA	NA	NA	NA
BBC53634.1|41928_42381_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	59.3	4.4e-46
BBC53635.1|42437_42671_+	hypothetical protein	NA	NA	NA	NA	NA
BBC53636.1|42736_44695_+	partitioning protein ParB	NA	G8DH78	Emiliania_huxleyi_virus	26.7	1.8e-19
BBC53637.1|44749_45184_+	plasmid SOS inhibition protein PsiB	NA	NA	NA	NA	NA
BBC53638.1|45180_45900_+	plasmid SOS inhibition protein PsiA	NA	NA	NA	NA	NA
BBC53639.1|46116_46329_+	modulator of Hok protein	NA	NA	NA	NA	NA
BBC53640.1|47164_47458_-	hypothetical protein	NA	NA	NA	NA	NA
BBC53641.1|47637_48459_+	hypothetical protein	NA	A0A2C9CYF8	Yersinia_phage	37.5	1.8e-42
BBC53642.1|48754_49264_-	hypothetical protein	NA	NA	NA	NA	NA
BBC53643.1|49695_50079_+	conjugal transfer protein TraM	NA	NA	NA	NA	NA
BBC53644.1|50269_50917_+	conjugal transfer protein TraJ	NA	NA	NA	NA	NA
BBC53645.1|51052_51268_+	conjugal transfer protein TraY	NA	NA	NA	NA	NA
BBC53646.1|51310_51709_+	conjugal transfer protein TraA	NA	NA	NA	NA	NA
BBC53647.1|51723_52035_+	conjugal transfer protein TraL	NA	NA	NA	NA	NA
BBC53648.1|52056_52623_+	conjugal transfer protein TraE	NA	NA	NA	NA	NA
BBC53649.1|52609_53338_+	conjugal transfer protein TraK	NA	NA	NA	NA	NA
BBC53650.1|53337_53538_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
BBC53651.1|53594_53972_+|transposase	IS602 transposase	transposase	Q716C1	Shigella_phage	55.8	6.5e-19
BBC53652.1|53928_54786_+|transposase	IS30 transposase	transposase	Q9MBM9	Staphylococcus_prophage	32.2	1.4e-13
BBC53653.1|54903_55230_+|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBC53654.1|55229_56117_+|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBC53655.1|56410_56770_-|transposase	IS3 family transposase OrfB	transposase	A0A0P0I4A4	Acinetobacter_phage	40.5	1.3e-08
BBC53656.1|56951_57362_+|transposase	IS21 transposase Orf1	transposase	U5N3F9	Enterobacteria_phage	91.3	3.3e-40
>prophage 2
AP018489	Escherichia coli O157:H7 plasmid pO157pv15279 pv15-279 DNA, complete genome	94391	76949	86366	94391	transposase	Escherichia_phage(38.46%)	13	NA	NA
BBC53668.1|76949_77276_+|transposase	transposase	transposase	Q6H9S4	Enterobacteria_phage	97.2	4.1e-54
BBC53669.1|77275_78163_+|transposase	transposase	transposase	Q6H9S6	Enterobacteria_phage	100.0	3.3e-170
BBC53670.1|78202_79297_-|transposase	transposase	transposase	A0A1B0V7H9	Salmonella_phage	63.6	1.1e-127
BBC53671.1|79705_80086_+	hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
BBC53672.1|80082_80430_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
BBC53673.1|80479_82018_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
BBC53674.1|81924_82737_-|transposase	transposase	transposase	A0A1B0V7H9	Salmonella_phage	47.4	6.5e-48
BBC53675.1|82702_83590_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBC53676.1|83589_83916_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBC53677.1|84081_84342_+|transposase	IS100 transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	3.3e-30
BBC53678.1|84419_84995_+|transposase	transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.0	1.7e-111
BBC53679.1|84994_85774_+|transposase	IS100 transposase	transposase	A0A2L1IVB6	Escherichia_phage	98.8	6.5e-138
BBC53680.1|85817_86366_-|transposase	IS3 family transposase OrfB	transposase	A0A0P0I4A4	Acinetobacter_phage	41.8	4.5e-29
