assembly_id	genome_id	genome_def	crispr_array_locus_merge	crispr_array_location_merge	crispr_locus_id	crispr_pred_method	array_in_prot	prot_within_array_20000	prot_in_genome	crispr_type_by_cas_prot	consensus_repeat	repeat_length	self-targeting_spacer_number	self-targeting_target_number	spacer_location	protospacer_location	repeat_type	spacer_locus_num	spacer_num	correct_crispr_type	genome_cas_prots	unknown_protein_around_crispr	L10	L10_domain	L9	L9_domain	L8	L8_domain	L7	L7_domain	L6	L6_domain	L5	L5_domain	L4	L4_domain	L3	L3_domain	L2	L2_domain	L1	L1_domain	R1	R1_domain	R2	R2_domain	R3	R3_domain	R4	R4_domain	R5	R5_domain	R6	R6_domain	R7	R7_domain	R8	R8_domain	R9	R9_domain	R10	R10_domain
GCA_003966915.1_ASM396691v1	AP018150	Mycoavidus cysteinexigens DNA, complete genome, strain: B1-EB	1	1307762-1307834	1	CRISPRCasFinder	no		RT,DinG,DEDDh,PD-DExK,cas3	Orphan	CTTGACCCTGCCCCAGAATTAGT	23	1	1	1307785-1307811	AP018150.1_2760426-2760452	NA	1	1	Orphan	RT,DinG,DEDDh,PD-DExK,cas3	NA|116aa|up_9|AP018150.1_1291717_1292065_+,NA|87aa|up_8|AP018150.1_1292061_1292322_+,NA|198aa|up_4|AP018150.1_1295196_1295790_+,NA|72aa|up_2|AP018150.1_1301905_1302121_+,NA|73aa|down_2|AP018150.1_1310238_1310457_-,NA|96aa|down_4|AP018150.1_1311030_1311318_-	NA|116aa|up_9|AP018150.1_1291717_1292065_+	NA	NA|87aa|up_8|AP018150.1_1292061_1292322_+	NA	NA|154aa|up_7|AP018150.1_1292377_1292839_-	smart00871, AraC_E_bind, Bacterial transcription activator, effector binding domain	NA|178aa|up_6|AP018150.1_1293046_1293580_+	COG5340, COG5340, Predicted transcriptional regulator [Transcription]	NA|307aa|up_5|AP018150.1_1293563_1294484_+	pfam08843, AbiEii, Nucleotidyl transferase AbiEii toxin, Type IV TA system	NA|198aa|up_4|AP018150.1_1295196_1295790_+	NA	NA|1810aa|up_3|AP018150.1_1295904_1301334_-	cd00200, WD40, WD40 domain, found in a number of eukaryotic proteins that cover a wide variety of functions including adaptor/regulatory modules in signal transduction, pre-mRNA processing and cytoskeleton assembly; typically contains a GH dipeptide 11-24 residues from its N-terminus and the WD dipeptide at its C-terminus and is 40 residues long, hence the name WD40; between GH and WD lies a conserved core; serves as a stable propeller-like platform to which proteins can bind either stably or reversibly; forms a propeller-like structure with several blades where each blade is composed of a four-stranded anti-parallel b-sheet; instances with few detectable copies are hypothesized to form larger structures by dimerization; each WD40 sequence repeat forms the first three strands of one blade and the last strand in the next blade; the last C-terminal WD40 repeat completes the blade structure of the first WD40 repeat to create the closed ring propeller-structure; residues on the top and bottom surface of the propeller are proposed to coordinate interactions with other proteins and/or small ligands; 7 copies of the repeat are present in this alignment	NA|72aa|up_2|AP018150.1_1301905_1302121_+	NA	NA|156aa|up_1|AP018150.1_1303201_1303669_+	cd00735, T4-like_lys, bacteriophage T4-like lysozymes	NA|1258aa|up_0|AP018150.1_1303621_1307395_-	cd00200, WD40, WD40 domain, found in a number of eukaryotic proteins that cover a wide variety of functions including adaptor/regulatory modules in signal transduction, pre-mRNA processing and cytoskeleton assembly; typically contains a GH dipeptide 11-24 residues from its N-terminus and the WD dipeptide at its C-terminus and is 40 residues long, hence the name WD40; between GH and WD lies a conserved core; serves as a stable propeller-like platform to which proteins can bind either stably or reversibly; forms a propeller-like structure with several blades where each blade is composed of a four-stranded anti-parallel b-sheet; instances with few detectable copies are hypothesized to form larger structures by dimerization; each WD40 sequence repeat forms the first three strands of one blade and the last strand in the next blade; the last C-terminal WD40 repeat completes the blade structure of the first WD40 repeat to create the closed ring propeller-structure; residues on the top and bottom surface of the propeller are proposed to coordinate interactions with other proteins and/or small ligands; 7 copies of the repeat are present in this alignment	NA|301aa|down_0|AP018150.1_1308394_1309297_-	cd05242, SDR_a8, atypical (a) SDRs, subgroup 8	NA|233aa|down_1|AP018150.1_1309337_1310036_-	PRK09009, PRK09009, SDR family oxidoreductase	NA|73aa|down_2|AP018150.1_1310238_1310457_-	NA	NA|220aa|down_3|AP018150.1_1310398_1311058_+	PRK10477, PRK10477, outer membrane lipoprotein Blc; Provisional	NA|96aa|down_4|AP018150.1_1311030_1311318_-	NA	NA|304aa|down_5|AP018150.1_1311204_1312116_+	COG3380, COG3380, Predicted NAD/FAD-dependent oxidoreductase [General function prediction only]	NA|912aa|down_6|AP018150.1_1312768_1315504_-	cd00200, WD40, WD40 domain, found in a number of eukaryotic proteins that cover a wide variety of functions including adaptor/regulatory modules in signal transduction, pre-mRNA processing and cytoskeleton assembly; typically contains a GH dipeptide 11-24 residues from its N-terminus and the WD dipeptide at its C-terminus and is 40 residues long, hence the name WD40; between GH and WD lies a conserved core; serves as a stable propeller-like platform to which proteins can bind either stably or reversibly; forms a propeller-like structure with several blades where each blade is composed of a four-stranded anti-parallel b-sheet; instances with few detectable copies are hypothesized to form larger structures by dimerization; each WD40 sequence repeat forms the first three strands of one blade and the last strand in the next blade; the last C-terminal WD40 repeat completes the blade structure of the first WD40 repeat to create the closed ring propeller-structure; residues on the top and bottom surface of the propeller are proposed to coordinate interactions with other proteins and/or small ligands; 7 copies of the repeat are present in this alignment	NA|192aa|down_7|AP018150.1_1315608_1316184_-	pfam00665, rve, Integrase core domain	NA|57aa|down_8|AP018150.1_1316177_1316348_-	pfam01527, HTH_Tnp_1, Transposase	NA|515aa|down_9|AP018150.1_1316662_1318207_+	PRK00029, PRK00029, YdiU family protein
