The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028311	Salmonella enterica subsp. enterica serovar Heidelberg strain CFSAN067218 chromosome, complete genome	4793457	93825	107464	4793457	integrase	Enterobacteria_phage(80.0%)	16	NA	NA
AZR43895.1|93825_95016_-	ATP-binding protein	NA	C7BGE8	Burkholderia_phage	34.3	1.2e-10
AZR43896.1|95693_96038_+	hypothetical protein	NA	NA	NA	NA	NA
AZR43897.1|96499_96646_-|integrase	attP region and P4int integrase	integrase	NA	NA	NA	NA
AZR43898.1|96851_99185_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
AZR43899.1|99199_99520_-	hypothetical protein	NA	NA	NA	NA	NA
AZR43900.1|99655_100111_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
AZR43901.1|100103_100391_-	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
AZR43902.1|100383_100974_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	4.1e-60
AZR43903.1|100970_101237_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
AZR43904.1|101249_101441_-	hypothetical protein	NA	NA	NA	NA	NA
AZR43905.1|101788_102523_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	99.2	2.7e-130
AZR43906.1|102519_103020_+	transactivation protein	NA	NA	NA	NA	NA
AZR43907.1|103093_103666_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	1.9e-94
AZR43908.1|103993_104419_-	hypothetical protein	NA	NA	NA	NA	NA
AZR43909.1|104415_106275_-	helicase	NA	A0A097BY72	Enterococcus_phage	22.4	1.8e-13
AZR43910.1|106294_107464_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	88.1	1.7e-198
>prophage 2
CP028311	Salmonella enterica subsp. enterica serovar Heidelberg strain CFSAN067218 chromosome, complete genome	4793457	1644499	1660376	4793457	transposase,tail,holin	Salmonella_phage(38.46%)	15	NA	NA
AZR45301.1|1644499_1645423_-|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	94.5	5.4e-168
AZR48316.1|1646119_1646323_-	virulence protein MsgA	NA	NA	NA	NA	NA
AZR45302.1|1646625_1647417_+|tail	phage tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
AZR45303.1|1647713_1647917_+|tail	phage tail protein	tail	NA	NA	NA	NA
AZR45304.1|1648085_1650452_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
AZR48317.1|1650780_1651770_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
AZR45305.1|1651784_1652153_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
AZR45306.1|1652181_1653513_-	NTPase	NA	R9TRQ8	Vibrio_phage	28.5	4.6e-19
AZR45307.1|1653809_1654139_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
AZR45308.1|1654731_1655973_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
AZR45309.1|1655975_1656503_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
AZR45310.1|1656880_1657324_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
AZR45311.1|1657377_1659207_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
AZR45312.1|1659554_1659845_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
AZR45313.1|1659872_1660376_+	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 3
CP028311	Salmonella enterica subsp. enterica serovar Heidelberg strain CFSAN067218 chromosome, complete genome	4793457	1732425	1741596	4793457	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AZR45382.1|1732425_1733373_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
AZR45383.1|1733356_1734088_+	ABC transporter permease	NA	NA	NA	NA	NA
AZR45384.1|1734068_1734176_-	hypothetical protein	NA	NA	NA	NA	NA
AZR45385.1|1734235_1734967_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AZR45386.1|1735189_1736875_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
AZR45387.1|1736871_1737591_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AZR45388.1|1737637_1738105_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AZR45389.1|1738161_1738692_-	lipoprotein	NA	NA	NA	NA	NA
AZR45390.1|1738863_1739322_-	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AZR45391.1|1739562_1741596_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
CP028311	Salmonella enterica subsp. enterica serovar Heidelberg strain CFSAN067218 chromosome, complete genome	4793457	1809872	1820378	4793457		Enterobacteria_phage(37.5%)	10	NA	NA
AZR45446.1|1809872_1811276_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	6.8e-21
AZR45447.1|1811453_1812347_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AZR45448.1|1812723_1813809_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
AZR45449.1|1813808_1814708_+	NAD(P)-dependent oxidoreductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
AZR48321.1|1814755_1815634_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
AZR45450.1|1815634_1816186_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
AZR45451.1|1816191_1817184_+	protein RfbI	NA	NA	NA	NA	NA
AZR45452.1|1817180_1817954_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AZR45453.1|1817958_1819038_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
AZR45454.1|1819064_1820378_+	LPS biosynthesis protein	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 5
CP028311	Salmonella enterica subsp. enterica serovar Heidelberg strain CFSAN067218 chromosome, complete genome	4793457	1906373	1916974	4793457		Morganella_phage(25.0%)	13	NA	NA
AZR45538.1|1906373_1906847_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
AZR45539.1|1907494_1907785_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	52.6	2.1e-09
AZR45540.1|1908156_1908954_-	protein MtfA	NA	NA	NA	NA	NA
AZR45541.1|1909214_1909457_+	hypothetical protein	NA	NA	NA	NA	NA
AZR45542.1|1909434_1909596_+	hypothetical protein	NA	NA	NA	NA	NA
AZR45543.1|1909722_1910142_+	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
AZR45544.1|1910144_1911413_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	1.2e-226
AZR45545.1|1911867_1912080_+	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
AZR48326.1|1912090_1912279_+	cold-shock protein	NA	NA	NA	NA	NA
AZR45546.1|1912536_1913733_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	5.1e-110
AZR45547.1|1914383_1914695_+	hypothetical protein	NA	NA	NA	NA	NA
AZR45548.1|1914774_1915470_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	1.6e-07
AZR45549.1|1915543_1916974_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
>prophage 6
CP028311	Salmonella enterica subsp. enterica serovar Heidelberg strain CFSAN067218 chromosome, complete genome	4793457	2816106	2900012	4793457	tail,transposase,protease,portal,terminase,tRNA,lysis	Salmonella_phage(48.21%)	99	NA	NA
AZR46445.1|2816106_2816787_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
AZR46446.1|2817132_2817342_-	hypothetical protein	NA	NA	NA	NA	NA
AZR46447.1|2817407_2818067_+	transmembrane protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AZR46448.1|2818153_2818483_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
AZR46449.1|2818479_2818761_-	acylphosphatase	NA	NA	NA	NA	NA
AZR46450.1|2818809_2819589_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZR46451.1|2819614_2820163_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AZR46452.1|2820377_2821589_+	ribosomal RNA large subunit methyltransferase I	NA	NA	NA	NA	NA
AZR46453.1|2821646_2821964_+	heat-shock protein HspQ	NA	NA	NA	NA	NA
AZR46454.1|2822008_2822425_-	CoA-binding protein	NA	NA	NA	NA	NA
AZR46455.1|2822595_2823258_+	DUF2057 domain-containing protein	NA	NA	NA	NA	NA
AZR46456.1|2823352_2823811_+	methylglyoxal synthase	NA	NA	NA	NA	NA
AZR46457.1|2823846_2825901_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
AZR46458.1|2826024_2826471_+	YccF domain-containing protein	NA	NA	NA	NA	NA
AZR46459.1|2826489_2828643_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AZR46460.1|2828629_2829235_-	DNA transformation protein	NA	NA	NA	NA	NA
AZR46461.1|2829451_2829961_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
AZR48368.1|2830317_2831370_+	outer membrane protein A	NA	NA	NA	NA	NA
AZR46462.1|2831441_2831894_-	macrodomain Ter protein	NA	NA	NA	NA	NA
AZR46463.1|2832079_2833840_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
AZR46464.1|2833908_2834427_+	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AZR46465.1|2834526_2834694_-	ribosome modulation factor	NA	NA	NA	NA	NA
AZR46466.1|2834949_2835513_-	hypothetical protein	NA	NA	NA	NA	NA
AZR46467.1|2835509_2837150_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
AZR46468.1|2837154_2838408_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
AZR46469.1|2838422_2840330_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
AZR46470.1|2840342_2842451_-	ribosomal RNA large subunit methyltransferase K/L	NA	NA	NA	NA	NA
AZR46471.1|2842549_2843659_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
AZR46472.1|2843655_2844198_-	cell division protein ZapC	NA	NA	NA	NA	NA
AZR46473.1|2844363_2845374_-	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AZR46474.1|2845581_2848194_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
AZR46475.1|2848628_2849126_+	hypothetical protein	NA	NA	NA	NA	NA
AZR46476.1|2849122_2850343_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AZR46477.1|2850562_2850781_-	Hin recombinase	NA	S4TTF2	Salmonella_phage	89.7	1.7e-24
AZR46478.1|2850993_2851716_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
AZR46479.1|2851912_2852494_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	87.4	1.8e-92
AZR46480.1|2852483_2852804_-	hypothetical protein	NA	A0A0M4QWS3	Salmonella_phage	79.2	4.9e-44
AZR46481.1|2853304_2855680_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	64.9	1.9e-87
AZR46482.1|2855733_2855976_-	hypothetical protein	NA	NA	NA	NA	NA
AZR46483.1|2856014_2856890_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.8	2.6e-50
AZR46484.1|2859436_2860141_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	2.0e-66
AZR46485.1|2860038_2860776_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.6	5.2e-113
AZR46486.1|2860785_2861481_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
AZR46487.1|2861570_2862104_+	superoxide dismutase [Cu-Zn] SodC1	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
AZR46488.1|2862193_2862718_-	Ail/OmpX	NA	A0A1B0VBR9	Salmonella_phage	35.3	1.8e-19
AZR46489.1|2862816_2863149_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
AZR48369.1|2863145_2866133_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.0	2.5e-262
AZR46490.1|2866212_2866542_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
AZR46491.1|2866538_2866937_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
AZR46492.1|2866982_2867732_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
AZR46493.1|2867743_2868145_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
AZR46494.1|2868141_2868708_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	95.7	2.1e-13
AZR46495.1|2868688_2868988_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
AZR46496.1|2868980_2869304_-	recombinase RecA	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
AZR48370.1|2871395_2872913_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.7	7.5e-175
AZR46497.1|2872939_2873146_-	primosomal replication protein PriB/PriC domain protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
AZR46498.1|2873142_2875281_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	6.9e-291
AZR46499.1|2875237_2875771_-	DNA breaking-rejoining protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
AZR48371.1|2875981_2876467_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	80.4	1.1e-58
AZR46500.1|2876783_2877323_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	72.4	2.2e-76
AZR48372.1|2877300_2877603_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZR46501.1|2877805_2877994_-	hypothetical protein	NA	NA	NA	NA	NA
AZR46502.1|2878048_2878237_+	hypothetical protein	NA	NA	NA	NA	NA
AZR46503.1|2878274_2878493_-	hypothetical protein	NA	NA	NA	NA	NA
AZR46504.1|2878432_2878624_-	hypothetical protein	NA	NA	NA	NA	NA
AZR46505.1|2878659_2879457_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
AZR46506.1|2879446_2879593_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
AZR46507.1|2879589_2880201_-	protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	4.2e-92
AZR46508.1|2880203_2880410_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
AZR46509.1|2880409_2881012_-	hypothetical protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AZR46510.1|2881046_2881295_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
AZR46511.1|2881411_2881645_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
AZR46512.1|2881875_2882520_-	hypothetical protein	NA	NA	NA	NA	NA
AZR46513.1|2882627_2883029_-	hypothetical protein	NA	I6R0R2	Salmonella_phage	82.0	1.2e-18
AZR46514.1|2883039_2883297_-	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	95.3	4.5e-40
AZR46515.1|2883298_2883832_-	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	89.8	8.1e-92
AZR48373.1|2883828_2884230_-	chromosome partitioning protein ParB	NA	S4TTI6	Salmonella_phage	98.5	5.4e-72
AZR46516.1|2884274_2884976_-	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	99.1	1.9e-128
AZR46517.1|2884972_2885878_-	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	99.7	9.1e-176
AZR46518.1|2885969_2886344_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	1.9e-63
AZR46519.1|2886309_2886546_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	73.1	9.0e-27
AZR46520.1|2886650_2887046_+	transcriptional regulator	NA	K7PM35	Enterobacteria_phage	72.5	3.5e-47
AZR46521.1|2887088_2887514_+	hypothetical protein	NA	NA	NA	NA	NA
AZR46522.1|2887515_2887950_+	hypothetical protein	NA	NA	NA	NA	NA
AZR46523.1|2887976_2888183_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	1.6e-16
AZR46524.1|2888470_2888671_+	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AZR46525.1|2888761_2889058_+	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	100.0	1.1e-48
AZR46526.1|2889063_2889849_+	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	98.8	2.4e-148
AZR46527.1|2889845_2890526_+	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	97.8	3.3e-130
AZR46528.1|2890522_2891392_+	DNA methylase	NA	A0A1C9II58	Salmonella_phage	86.3	7.2e-146
AZR48374.1|2891397_2891637_+	DUF4060 domain-containing protein	NA	S4TR31	Salmonella_phage	98.7	3.3e-37
AZR46529.1|2891677_2891926_+	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AZR46530.1|2891970_2893263_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	100.0	3.4e-253
AZR46531.1|2893457_2894660_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AZR46532.1|2894740_2896174_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
AZR46533.1|2896418_2897633_-	PLP-dependent lyase/thiolase	NA	NA	NA	NA	NA
AZR46534.1|2897719_2897953_+	hypothetical protein	NA	NA	NA	NA	NA
AZR46535.1|2897949_2898411_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AZR46536.1|2898611_2900012_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
>prophage 7
CP028311	Salmonella enterica subsp. enterica serovar Heidelberg strain CFSAN067218 chromosome, complete genome	4793457	2964673	2972696	4793457	transposase,protease,integrase	Ralstonia_phage(14.29%)	10	2959280:2959294	2971432:2971446
2959280:2959294	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AZR46585.1|2964673_2965051_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	40.2	1.7e-19
AZR46586.1|2965212_2965410_+	hypothetical protein	NA	NA	NA	NA	NA
AZR46587.1|2965683_2966142_-|transposase	IS200/IS605 family transposase IS200F	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
AZR46588.1|2966098_2966281_-	hypothetical protein	NA	NA	NA	NA	NA
AZR46589.1|2966332_2968609_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
AZR46590.1|2968639_2968960_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AZR46591.1|2969283_2969505_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AZR46592.1|2969459_2969654_-	hypothetical protein	NA	NA	NA	NA	NA
AZR46593.1|2969634_2971581_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
2971432:2971446	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
AZR46594.1|2971577_2972696_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 8
CP028311	Salmonella enterica subsp. enterica serovar Heidelberg strain CFSAN067218 chromosome, complete genome	4793457	3576922	3620518	4793457	tail,integrase,protease,portal,terminase,coat,lysis	Enterobacteria_phage(44.78%)	68	3577362:3577407	3616627:3616672
AZR47146.1|3576922_3577198_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	64.1	1.9e-23
3577362:3577407	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
AZR47147.1|3577399_3577579_-	hypothetical protein	NA	M1E3P7	Enterobacteria_phage	100.0	1.9e-16
AZR47148.1|3577695_3578058_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
AZR47149.1|3578054_3578987_+	glycosyltransferase	NA	A0A192Y8W7	Salmonella_phage	100.0	5.5e-176
AZR47150.1|3578976_3580434_+	hypothetical protein	NA	A0A192Y7W8	Salmonella_phage	100.0	4.5e-241
AZR47151.1|3580492_3582496_-	endorhamnosidase	NA	A0A2H4FWI0	Salmonella_phage	99.9	0.0e+00
AZR47152.1|3582631_3582886_+	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	63.3	4.4e-19
AZR47153.1|3583288_3583774_+	hypothetical protein	NA	NA	NA	NA	NA
AZR47154.1|3583864_3585862_-	DNA transfer protein	NA	Q716G2	Shigella_phage	94.9	0.0e+00
AZR47155.1|3585861_3587157_-	acyltransferase	NA	Q716G3	Shigella_phage	84.5	2.1e-181
AZR47156.1|3587166_3587859_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	98.7	1.2e-108
AZR47157.1|3587861_3588317_-	hypothetical protein	NA	A0A192Y6V9	Salmonella_phage	100.0	5.2e-87
AZR47158.1|3588316_3589018_-|tail	phage tail protein	tail	A0A192Y6T9	Salmonella_phage	100.0	8.8e-78
AZR47159.1|3589021_3590440_-	hypothetical protein	NA	A0A075B8I2	Enterobacteria_phage	100.0	7.6e-278
AZR47160.1|3590399_3590900_-	hypothetical protein	NA	I1TEJ0	Salmonella_phage	99.4	5.5e-90
AZR47161.1|3590883_3591093_-	hypothetical protein	NA	A0A192Y697	Salmonella_phage	100.0	1.3e-32
AZR47162.1|3591131_3592424_-|coat	coat protein	coat	A0A192Y6V4	Salmonella_phage	100.0	3.2e-243
AZR47163.1|3592423_3593335_-	scaffolding protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
AZR47164.1|3593348_3595526_-|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	99.9	0.0e+00
AZR47165.1|3595525_3597025_-|terminase	terminase	terminase	A0A192Y824	Salmonella_phage	99.8	1.4e-306
AZR47166.1|3597002_3597491_-	DNA-packaging protein	NA	O80290	Bacteriophage	100.0	2.9e-88
AZR47167.1|3597514_3597694_-	hypothetical protein	NA	Q9AZ02	Salmonella_phage	91.5	3.0e-22
AZR47168.1|3597695_3597938_-	DUF2560 domain-containing protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
AZR47169.1|3598240_3598927_-	hypothetical protein	NA	A0A192Y918	Salmonella_phage	99.6	4.7e-124
AZR47170.1|3598913_3599105_-	hypothetical protein	NA	A0A1V0E5I0	Salmonella_phage	95.2	1.1e-27
AZR47171.1|3599139_3599577_-|lysis	lysis protein	lysis	O80289	Bacteriophage	99.3	9.1e-73
AZR47172.1|3599665_3600163_-	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	97.0	6.0e-89
AZR47173.1|3600140_3600344_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
AZR47174.1|3600483_3600693_-	hypothetical protein	NA	M1E3N9	Enterobacteria_phage	100.0	6.7e-34
AZR47175.1|3600782_3601406_-	antitermination protein	NA	A0A075B8H9	Enterobacteria_phage	100.0	2.3e-114
AZR47176.1|3601402_3601582_-	hypothetical protein	NA	A0A1U8QR34	Salmonella_phage	100.0	1.4e-24
AZR47177.1|3601562_3601766_-	protein ninH	NA	A0A075B8J4	Enterobacteria_phage	100.0	7.2e-33
AZR47178.1|3601762_3601987_-	protein ninY	NA	Q5G8R9	Enterobacteria_phage	100.0	2.2e-38
AZR47179.1|3601983_3602595_-	recombination protein NinG	NA	A0A075B8E9	Enterobacteria_phage	100.0	1.3e-98
AZR47180.1|3602587_3602764_-	protein ninF	NA	I6S668	Salmonella_phage	100.0	2.5e-26
AZR47181.1|3602756_3603095_-	DUF2591 domain-containing protein	NA	A0A075B8G3	Enterobacteria_phage	100.0	3.3e-62
AZR47182.1|3603091_3603268_-	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
AZR47183.1|3603234_3603408_-	protein ninD	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
AZR47184.1|3603404_3603860_-	recombination protein NinB	NA	A8CGE3	Salmonella_phage	100.0	1.4e-79
AZR47185.1|3603915_3605292_-	replicative DNA helicase	NA	A0A075B8G2	Enterobacteria_phage	100.0	3.3e-254
AZR47186.1|3605288_3606104_-	DNA replication protein	NA	A0A075B8J2	Enterobacteria_phage	100.0	9.4e-148
AZR47187.1|3606096_3606243_-	DUF2740 domain-containing protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
AZR47188.1|3606277_3606556_-	hypothetical protein	NA	Q5G8T2	Enterobacteria_phage	100.0	2.5e-44
AZR47189.1|3606662_3606848_-	hypothetical protein	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
AZR47190.1|3606928_3607579_+	LexA family transcriptional repressor	NA	B1B6L9	Salmonella_phage	100.0	5.4e-122
AZR47191.1|3607932_3608235_+	regulator	NA	B8K1E6	Salmonella_phage	98.0	1.1e-48
AZR48405.1|3608255_3608834_-	superinfection exclusion protein B	NA	A0A075B8E6	Enterobacteria_phage	100.0	8.8e-92
AZR47192.1|3609048_3609243_+	restriction endonuclease	NA	A0A075B8G0	Enterobacteria_phage	100.0	2.5e-30
AZR47193.1|3609279_3609516_+	hypothetical protein	NA	A0A075B8J0	Enterobacteria_phage	100.0	4.3e-37
AZR47194.1|3609515_3609719_+	DUF551 domain-containing protein	NA	A0A0N7CAQ5	Salmonella_phage	100.0	1.7e-34
AZR47195.1|3609866_3610178_+	superinfection exclusion protein	NA	A0A075B8E5	Enterobacteria_phage	100.0	1.1e-48
AZR47196.1|3610263_3610422_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A075B8H4	Enterobacteria_phage	100.0	4.0e-23
AZR47197.1|3610402_3610591_+	protein kil	NA	A0A075B8F9	Enterobacteria_phage	100.0	1.4e-30
AZR47198.1|3610720_3611338_+	recombinase	NA	A0A0N7CFJ3	Salmonella_phage	100.0	3.3e-105
AZR47199.1|3611337_3611622_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	97.9	2.6e-44
AZR47200.1|3611668_3611965_+	RecBCD nuclease inhibitor	NA	Q76H42	Enterobacteria_phage	90.8	3.9e-43
AZR48406.1|3611975_3612140_+	DUF2737 domain-containing protein	NA	A0A2I6PID4	Escherichia_phage	98.1	1.6e-22
AZR47201.1|3612136_3612763_+	hNH endonuclease	NA	A5VWB1	Enterobacteria_phage	71.2	7.1e-71
AZR47202.1|3612759_3613245_+	hypothetical protein	NA	A5VWB3	Enterobacteria_phage	86.1	1.3e-43
AZR47203.1|3613246_3613510_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	2.0e-30
AZR47204.1|3613520_3614207_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	53.2	4.3e-53
AZR47205.1|3614303_3614483_+	Eag protein	NA	A0A075B8F7	Enterobacteria_phage	98.3	1.6e-28
AZR47206.1|3614583_3615219_+	Eac protein	NA	A0A075B8I7	Enterobacteria_phage	99.5	1.3e-120
AZR47207.1|3615221_3615572_+	DNA-binding protein	NA	A0A075B8K2	Enterobacteria_phage	100.0	6.4e-61
AZR48407.1|3615943_3616612_+|integrase	site-specific integrase	integrase	A0A192Y6Q1	Salmonella_phage	100.0	6.1e-129
AZR47208.1|3616817_3618068_-	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	48.2	2.1e-98
3616627:3616672	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
AZR47209.1|3618079_3619183_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
AZR47210.1|3619465_3620518_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	2.2e-112
>prophage 9
CP028311	Salmonella enterica subsp. enterica serovar Heidelberg strain CFSAN067218 chromosome, complete genome	4793457	4360383	4407903	4793457	tRNA,tail,plate	Burkholderia_phage(40.91%)	50	NA	NA
AZR47856.1|4360383_4361382_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AZR47857.1|4361469_4362780_-	conjugal transfer protein	NA	NA	NA	NA	NA
AZR47858.1|4363026_4363542_+	transcriptional regulator Zur	NA	NA	NA	NA	NA
AZR47859.1|4363640_4363850_-	CsbD family protein	NA	NA	NA	NA	NA
AZR48436.1|4363871_4363985_-	hypothetical protein	NA	NA	NA	NA	NA
AZR47860.1|4363981_4365307_-	MATE family efflux transporter	NA	NA	NA	NA	NA
AZR47861.1|4365485_4366094_-	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
AZR47862.1|4366202_4366571_-	diacylglycerol kinase	NA	NA	NA	NA	NA
AZR47863.1|4366741_4369162_+	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
AZR47864.1|4369260_4370133_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
AZR47865.1|4370146_4370644_-	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
AZR47866.1|4370824_4371742_-	maltose operon protein MalM	NA	NA	NA	NA	NA
AZR47867.1|4371905_4373264_-	maltoporin	NA	NA	NA	NA	NA
AZR47868.1|4373352_4374462_-	maltose/maltodextrin import ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
AZR47869.1|4374823_4376014_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
AZR47870.1|4376145_4377690_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
AZR47871.1|4377704_4378595_+	maltose ABC transporter permease	NA	NA	NA	NA	NA
AZR47872.1|4378760_4379171_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
AZR47873.1|4379313_4381410_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
AZR47874.1|4381409_4382147_-	hypothetical protein	NA	NA	NA	NA	NA
AZR47875.1|4382143_4382782_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
AZR47876.1|4382845_4383088_-	outer membrane protein	NA	NA	NA	NA	NA
AZR47877.1|4383531_4385181_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AZR47878.1|4385525_4386875_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
AZR47879.1|4387007_4387355_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
AZR47880.1|4387930_4388218_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
AZR47881.1|4388220_4388826_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
AZR47882.1|4388838_4389153_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
AZR47883.1|4389312_4389768_+	hypothetical protein	NA	NA	NA	NA	NA
AZR47884.1|4389764_4389962_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
AZR47885.1|4389951_4391379_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
AZR47886.1|4391378_4391903_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	2.3e-67
AZR47887.1|4391954_4392272_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AZR47888.1|4392231_4392360_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AZR47889.1|4392456_4394811_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
AZR47890.1|4394810_4395764_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
AZR47891.1|4395763_4395973_+	hypothetical protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
AZR47892.1|4395960_4397004_+	phage protein D	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
AZR47893.1|4397013_4397736_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
AZR47894.1|4398063_4398426_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
AZR47895.1|4398422_4399352_+	glycosyltransferase	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
AZR47896.1|4399351_4400899_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
AZR47897.1|4401061_4401421_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
AZR47898.1|4401411_4402527_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	3.1e-101
AZR47899.1|4402519_4403152_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	8.6e-24
AZR47900.1|4403154_4404813_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	1.8e-52
AZR47901.1|4404819_4405434_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
AZR47902.1|4405430_4405886_+	hypothetical protein	NA	NA	NA	NA	NA
AZR48437.1|4406266_4406683_+	serine acetyltransferase	NA	NA	NA	NA	NA
AZR47903.1|4407261_4407903_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.9	4.6e-33
>prophage 10
CP028311	Salmonella enterica subsp. enterica serovar Heidelberg strain CFSAN067218 chromosome, complete genome	4793457	4545905	4582093	4793457	tail,head,plate,capsid,integrase,portal,terminase,holin,lysis	Escherichia_phage(46.34%)	47	4545748:4545794	4577147:4577193
4545748:4545794	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
AZR48017.1|4545905_4546160_-	transcriptional regulator	NA	M1SNR2	Escherichia_phage	100.0	1.3e-44
AZR48018.1|4546205_4547369_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	7.0e-205
AZR48019.1|4547368_4547848_-|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	1.5e-84
AZR48020.1|4547862_4550310_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	97.1	0.0e+00
AZR48021.1|4550302_4550422_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AZR48022.1|4550454_4550730_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
AZR48023.1|4550786_4551305_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AZR48024.1|4551317_4552508_-|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	4.8e-225
AZR48025.1|4552567_4553161_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	97.0	1.3e-103
AZR48026.1|4553691_4554405_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
AZR48027.1|4554601_4555009_-|tail	phage tail protein	tail	A0A1B0V844	Salmonella_phage	84.2	1.8e-59
AZR48028.1|4555015_4556635_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	88.3	4.8e-143
AZR48029.1|4556631_4557243_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	6.4e-117
AZR48030.1|4557235_4558144_-|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	100.0	8.8e-163
AZR48031.1|4558148_4558496_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
AZR48032.1|4558492_4559128_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	9.0e-114
AZR48033.1|4559194_4559647_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
AZR48034.1|4559639_4560107_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	8.7e-82
AZR48035.1|4560069_4560243_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
AZR48036.1|4560214_4560640_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	96.5	4.7e-66
AZR48037.1|4560627_4561053_-	protein lysA	NA	U5N096	Enterobacteria_phage	95.7	2.8e-58
AZR48038.1|4561067_4561565_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
AZR48039.1|4561564_4561846_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
AZR48040.1|4561849_4562053_-|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
AZR48041.1|4562052_4562562_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
AZR48042.1|4562661_4563405_-|terminase	terminase	terminase	U5N091	Enterobacteria_phage	97.2	3.3e-123
AZR48043.1|4563408_4564482_-|capsid	phage major capsid protein, P2 family	capsid	Q94MD1	Enterobacteria_phage	100.0	5.1e-202
AZR48044.1|4564540_4565395_-|capsid	capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	96.5	9.0e-133
AZR48045.1|4565568_4567341_+	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	99.5	0.0e+00
AZR48046.1|4567340_4568375_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	1.2e-200
AZR48047.1|4568805_4571013_+	hypothetical protein	NA	NA	NA	NA	NA
AZR48048.1|4571243_4573532_-	replication endonuclease	NA	Q858T4	Yersinia_virus	97.0	0.0e+00
AZR48049.1|4573521_4573797_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	97.8	1.6e-43
AZR48050.1|4573793_4574018_-	hypothetical protein	NA	A0A0F7LDG9	Escherichia_phage	97.3	8.5e-35
AZR48051.1|4574017_4574320_-	hypothetical protein	NA	U5N0U2	Enterobacteria_phage	97.0	2.5e-45
AZR48052.1|4574319_4574544_-	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	98.6	2.3e-32
AZR48440.1|4574607_4575108_-	replication protein B	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
AZR48053.1|4575277_4575550_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
AZR48054.1|4575686_4575980_+	transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
AZR48055.1|4576049_4577030_+|integrase	integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
AZR48056.1|4577215_4577716_-	stress adaptor protein CpxP	NA	NA	NA	NA	NA
4577147:4577193	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
AZR48057.1|4577866_4578565_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
AZR48058.1|4578561_4579935_+	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
AZR48059.1|4579982_4580186_-	hypothetical protein	NA	NA	NA	NA	NA
AZR48060.1|4580306_4580702_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
AZR48061.1|4580713_4581466_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
AZR48062.1|4581472_4582093_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
>prophage 1
CP028312	Salmonella enterica subsp. enterica serovar Heidelberg strain CFSAN067218 plasmid pSH-04-1, complete sequence	117928	11909	53601	117928	transposase,integrase	Enterobacteria_phage(16.67%)	47	35224:35240	60896:60912
AZR48464.1|11909_13064_-|integrase	integrase	integrase	B5WZU7	Pseudomonas_phage	43.0	1.3e-46
AZR48580.1|13197_13416_+	shufflon protein D'	NA	NA	NA	NA	NA
AZR48465.1|13403_13709_+	shufflon protein B	NA	NA	NA	NA	NA
AZR48581.1|13918_14242_+	shufflon protein C	NA	NA	NA	NA	NA
AZR48466.1|14238_14394_-	shufflon protein C'	NA	NA	NA	NA	NA
AZR48467.1|16111_16768_-	prepilin peptidase	NA	NA	NA	NA	NA
AZR48468.1|16752_17313_-	lytic transglycosylase	NA	NA	NA	NA	NA
AZR48469.1|17322_17937_-	pilus assembly protein PilX	NA	NA	NA	NA	NA
AZR48470.1|17954_19052_-	pilus assembly protein PilR	NA	NA	NA	NA	NA
AZR48471.1|19064_20618_-	ATP-binding protein	NA	NA	NA	NA	NA
AZR48472.1|20628_21081_-	type IV pilus biogenesis protein PilP	NA	NA	NA	NA	NA
AZR48473.1|21067_22363_-	pilus assembly protein PilO	NA	NA	NA	NA	NA
AZR48474.1|22355_24038_-	PilN family type IVB pilus formation outer membrane protein	NA	NA	NA	NA	NA
AZR48475.1|24051_24489_-	pilus assembly protein PilP	NA	NA	NA	NA	NA
AZR48476.1|24488_25355_-	pili assembly chaperone	NA	NA	NA	NA	NA
AZR48477.1|25588_26179_-	pili assembly chaperone	NA	NA	NA	NA	NA
AZR48478.1|26228_26681_-	pili assembly chaperone	NA	NA	NA	NA	NA
AZR48479.1|26723_26978_-	pilus assembly protein	NA	NA	NA	NA	NA
AZR48480.1|27245_27812_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
AZR48481.1|27825_28509_-	conjugal transfer protein TraC	NA	NA	NA	NA	NA
AZR48482.1|28611_28791_+	hypothetical protein	NA	NA	NA	NA	NA
AZR48582.1|28762_29296_-	transcription termination factor NusG	NA	NA	NA	NA	NA
AZR48483.1|29301_29424_-	conjugal transfer protein TraA	NA	NA	NA	NA	NA
AZR48484.1|29737_29974_-	conjugal transfer protein TraA	NA	NA	NA	NA	NA
AZR48485.1|29942_30206_-	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	54.0	6.1e-08
AZR48486.1|30679_30886_+	hypothetical protein	NA	NA	NA	NA	NA
AZR48584.1|30882_31203_-	hypothetical protein	NA	NA	NA	NA	NA
AZR48583.1|31178_32210_+	replication initiation protein	NA	NA	NA	NA	NA
AZR48487.1|32775_32907_-	replication protein RepA4	NA	NA	NA	NA	NA
AZR48488.1|33192_34203_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	4.9e-21
AZR48489.1|34423_34999_+	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	40.1	2.4e-28
35224:35240	attL	AAATAAAGCACGCTAAG	NA	NA	NA	NA
AZR48490.1|35316_35994_+|transposase	transposase	transposase	NA	NA	NA	NA
AZR48491.1|35978_36839_+	EamA family transporter	NA	NA	NA	NA	NA
AZR48492.1|36870_38070_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AZR48493.1|38148_38826_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZR48494.1|38857_39100_-	relaxase	NA	NA	NA	NA	NA
AZR48495.1|39157_42124_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
AZR48496.1|42127_42688_-|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
AZR48497.1|42644_42968_-|transposase	transposase	transposase	NA	NA	NA	NA
AZR48498.1|42912_43926_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AZR48585.1|44071_44863_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AZR48499.1|45984_46251_-|transposase	IS1 family transposase	transposase	U5P0U6	Shigella_phage	93.2	1.2e-40
AZR48500.1|46350_47784_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	1.4e-106
AZR48501.1|47817_49026_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	2.1e-34
AZR48502.1|49353_50058_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZR48503.1|50549_51410_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AZR48504.1|52230_53601_-|transposase	IS1182 family transposase ISCfr1	transposase	NA	NA	NA	NA
60896:60912	attR	CTTAGCGTGCTTTATTT	NA	NA	NA	NA
>prophage 2
CP028312	Salmonella enterica subsp. enterica serovar Heidelberg strain CFSAN067218 plasmid pSH-04-1, complete sequence	117928	85518	92353	117928	transposase	Stx2-converting_phage(50.0%)	11	NA	NA
AZR48545.1|85518_86115_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	55.3	3.4e-14
AZR48546.1|86186_87077_+	DUF1472 domain-containing protein	NA	G9FHQ1	Rhodococcus_virus	27.3	4.3e-05
AZR48547.1|87216_87516_-	hypothetical protein	NA	NA	NA	NA	NA
AZR48548.1|87537_87783_+	hypothetical protein	NA	NA	NA	NA	NA
AZR48549.1|87805_88240_+	post-segregation killing protein PndC	NA	NA	NA	NA	NA
AZR48550.1|88333_88600_+	hypothetical protein	NA	NA	NA	NA	NA
AZR48551.1|88664_89603_+|transposase	transposase	transposase	Q2A0A7	Sodalis_phage	53.4	3.6e-66
AZR48552.1|89641_89776_-	copper resistance protein	NA	NA	NA	NA	NA
AZR48553.1|89737_90415_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AZR48554.1|90414_90762_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AZR48555.1|90781_92353_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
