The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031293	Escherichia coli strain EC17GD31 chromosome, complete genome	4975832	97488	103556	4975832	transposase	Stx2-converting_phage(57.14%)	8	NA	NA
AZR86973.1|97488_98883_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	57.9	1.1e-143
AZR86974.1|98902_99250_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AZR86975.1|99249_99927_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AZR86976.1|99903_100011_+	copper resistance protein	NA	NA	NA	NA	NA
AZR86977.1|99976_100180_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	100.0	2.5e-33
AZR86978.1|100836_102099_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	45.8	6.0e-93
AZR86979.1|102095_102734_+	aldolase	NA	A0A077SK32	Escherichia_phage	52.7	6.6e-56
AZR86980.1|102749_103556_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	42.1	4.2e-47
>prophage 2
CP031293	Escherichia coli strain EC17GD31 chromosome, complete genome	4975832	1569466	1582394	4975832	integrase	Escherichia_phage(83.33%)	6	1564427:1564440	1571566:1571579
1564427:1564440	attL	GCGTATTTATTTTA	NA	NA	NA	NA
AZR88310.1|1569466_1570036_-|integrase	integrase	integrase	A0A2L1IV36	Escherichia_phage	52.2	9.1e-49
AZR88311.1|1570784_1571414_+	pilus assembly protein	NA	A0A2L1IV36	Escherichia_phage	99.0	5.4e-119
AZR88312.1|1571731_1572352_+	LuxR family transcriptional regulator	NA	A0A2L1IV08	Escherichia_phage	99.0	1.3e-117
1571566:1571579	attR	TAAAATAAATACGC	NA	NA	NA	NA
AZR88313.1|1572376_1580296_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV38	Escherichia_phage	97.9	0.0e+00
AZR88314.1|1580343_1580874_+	OmpH family outer membrane protein	NA	A0A2L1IV11	Escherichia_phage	97.7	3.3e-85
AZR88315.1|1581461_1582394_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	99.7	2.1e-167
>prophage 3
CP031293	Escherichia coli strain EC17GD31 chromosome, complete genome	4975832	2879102	2924932	4975832	plate,integrase,transposase	Ralstonia_phage(20.0%)	46	2877271:2877286	2897023:2897038
2877271:2877286	attL	TAGCCTTACGGTATAA	NA	NA	NA	NA
AZR89521.1|2879102_2880323_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.3	6.2e-79
AZR89522.1|2880524_2880914_+	VOC family protein	NA	NA	NA	NA	NA
AZR89523.1|2881056_2882520_-	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
AZR89524.1|2882572_2883130_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
AZR89525.1|2883525_2883831_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
AZR89526.1|2883827_2884193_-	hypothetical protein	NA	NA	NA	NA	NA
AZR89527.1|2884497_2885376_+	hypothetical protein	NA	NA	NA	NA	NA
AZR89528.1|2885379_2885688_-	hypothetical protein	NA	NA	NA	NA	NA
AZR89529.1|2886337_2887819_+	conjugal transfer protein	NA	NA	NA	NA	NA
AZR89530.1|2887897_2888380_+	hypothetical protein	NA	NA	NA	NA	NA
AZR89531.1|2888438_2889011_+	hypothetical protein	NA	NA	NA	NA	NA
AZR89532.1|2889104_2889635_-	hypothetical protein	NA	NA	NA	NA	NA
AZR89533.1|2890069_2890543_+	DUF4755 domain-containing protein	NA	NA	NA	NA	NA
AZR89534.1|2890574_2890952_+	hypothetical protein	NA	NA	NA	NA	NA
AZR89535.1|2891001_2891613_-	hypothetical protein	NA	NA	NA	NA	NA
AZR89536.1|2891629_2893066_-	hypothetical protein	NA	NA	NA	NA	NA
AZR89537.1|2894369_2894756_-	hypothetical protein	NA	NA	NA	NA	NA
AZR89538.1|2894883_2895108_-	hypothetical protein	NA	NA	NA	NA	NA
AZR89539.1|2896022_2896568_+	replication protein	NA	NA	NA	NA	NA
AZR89540.1|2896722_2897202_+	DUF4756 family protein	NA	NA	NA	NA	NA
2897023:2897038	attR	TTATACCGTAAGGCTA	NA	NA	NA	NA
AZR89541.1|2897359_2897764_+	DNA-binding protein	NA	NA	NA	NA	NA
AZR89542.1|2897827_2898178_-	hypothetical protein	NA	NA	NA	NA	NA
AZR89543.1|2898282_2898525_-	DNA-binding protein	NA	NA	NA	NA	NA
AZR89544.1|2898598_2898895_-	hypothetical protein	NA	NA	NA	NA	NA
AZR89545.1|2898939_2899230_-	hypothetical protein	NA	NA	NA	NA	NA
AZR89546.1|2899311_2899530_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	51.9	1.2e-09
AZR89547.1|2899745_2900582_-	hypothetical protein	NA	NA	NA	NA	NA
AZR91568.1|2901043_2901841_+	protein MtfA	NA	NA	NA	NA	NA
AZR89548.1|2902183_2903446_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	37.3	3.8e-71
AZR89549.1|2903746_2904960_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.1	1.1e-102
AZR89550.1|2904980_2905709_-	hypothetical protein	NA	NA	NA	NA	NA
AZR89551.1|2905988_2906780_+	hypothetical protein	NA	NA	NA	NA	NA
AZR89552.1|2906988_2907288_-	hypothetical protein	NA	NA	NA	NA	NA
AZR89553.1|2907340_2907820_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
AZR89554.1|2907841_2909197_-	hypothetical protein	NA	NA	NA	NA	NA
AZR91569.1|2909207_2912669_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AZR89555.1|2912747_2914241_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AZR89556.1|2914179_2914923_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
AZR89557.1|2914919_2917658_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.1	2.9e-84
AZR91570.1|2917669_2918440_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AZR89558.1|2918492_2919836_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AZR91571.1|2919838_2920342_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AZR91572.1|2920368_2921655_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AZR89559.1|2921671_2922715_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AZR89560.1|2922681_2924505_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AZR89561.1|2924509_2924932_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 4
CP031293	Escherichia coli strain EC17GD31 chromosome, complete genome	4975832	3024391	3061042	4975832	coat,terminase,lysis,protease,holin,tail,portal	Enterobacteria_phage(62.07%)	60	NA	NA
AZR89634.1|3024391_3025321_-	phage antirepressor Ant	NA	A5VW58	Enterobacteria_phage	90.9	1.0e-161
AZR89635.1|3025387_3025534_-	Arc family DNA-binding protein	NA	A0A0M4S6R9	Salmonella_phage	95.8	8.0e-18
AZR89636.1|3025646_3025898_+	Arc family DNA-binding protein	NA	A5VW59	Enterobacteria_phage	92.7	2.5e-35
AZR89637.1|3025894_3026209_+	hypothetical protein	NA	NA	NA	NA	NA
AZR89638.1|3026234_3026720_+	hypothetical protein	NA	NA	NA	NA	NA
AZR89639.1|3026722_3028885_-	DNA transfer protein	NA	A5VW64	Enterobacteria_phage	98.9	0.0e+00
AZR89640.1|3028884_3030225_-	DNA injection protein	NA	Q9AYZ0	Salmonella_phage	73.9	1.2e-171
AZR89641.1|3030234_3030927_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	99.6	2.1e-111
AZR89642.1|3030929_3031385_-	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	98.0	9.7e-86
AZR89643.1|3031384_3032086_-|tail	phage tail protein	tail	G5DA78	Enterobacteria_phage	97.4	1.9e-117
AZR89644.1|3032085_3033504_-	hypothetical protein	NA	A0A2D1GM00	Escherichia_phage	99.6	5.4e-276
AZR89645.1|3033504_3034005_-	recombinase RmuC	NA	G8EYJ2	Enterobacteria_phage	98.2	5.5e-90
AZR89646.1|3033982_3034219_-	hypothetical protein	NA	A0A2D1GLK1	Escherichia_phage	67.0	1.8e-22
AZR89647.1|3034263_3035559_-|coat	coat protein	coat	G5DA99	Enterobacteria_phage	98.8	7.5e-240
AZR89648.1|3035558_3036470_-	scaffolding protein	NA	A0A2D1GLN7	Escherichia_phage	99.7	2.8e-161
AZR89649.1|3036483_3038649_-|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.7	0.0e+00
AZR89650.1|3038649_3040149_-|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	100.0	4.8e-307
AZR91576.1|3040126_3040615_-	DNA-packaging protein	NA	A0A0M3ULC0	Salmonella_phage	100.0	5.0e-88
AZR89651.1|3040638_3040818_-	hypothetical protein	NA	A0A088CPS9	Enterobacteria_phage	98.3	3.2e-24
AZR89652.1|3040819_3041062_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
AZR89653.1|3041365_3041845_-	DUF2829 domain-containing protein	NA	A0A1Y0T2L3	Pseudomonas_phage	60.4	1.1e-55
AZR89654.1|3041927_3042080_-	hypothetical protein	NA	K7PHR3	Enterobacteria_phage	100.0	1.2e-21
AZR89655.1|3042067_3042535_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	98.1	2.5e-76
AZR89656.1|3042531_3043008_-	lysozyme	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
AZR89657.1|3042991_3043315_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
AZR91577.1|3043425_3043608_+	hypothetical protein	NA	A0A088CPS7	Enterobacteria_phage	91.5	1.2e-23
AZR89658.1|3043748_3044372_-	antitermination protein	NA	K7P6X1	Enterobacteria_phage	100.0	3.0e-114
AZR89659.1|3044368_3045034_-	serine/threonine protein phosphatase	NA	A0A2D1GLI5	Escherichia_phage	97.7	1.8e-128
AZR89660.1|3045011_3045218_-	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
AZR89661.1|3045214_3045826_-	recombination protein NinG	NA	K7PHM2	Enterobacterial_phage	99.5	4.6e-99
AZR89662.1|3045818_3045995_-	protein ninF	NA	Q76H71	Enterobacteria_phage	100.0	6.7e-27
AZR89663.1|3045994_3046354_-	DUF2591 domain-containing protein	NA	G8EYI2	Enterobacteria_phage	95.0	2.7e-62
AZR89664.1|3046356_3046533_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
AZR89665.1|3046529_3047057_-	phage N-6-adenine-methyltransferase	NA	M1FN83	Enterobacteria_phage	99.4	5.6e-101
AZR89666.1|3047053_3047497_-	recombination protein NinB	NA	A0A2I6PIF6	Escherichia_phage	97.3	3.3e-78
AZR89667.1|3047641_3047956_-	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	70.5	5.0e-33
AZR89668.1|3047973_3048180_-	hypothetical protein	NA	K7P7Y0	Enterobacteria_phage	97.1	6.9e-31
AZR89669.1|3048252_3049629_-	replicative DNA helicase	NA	A0A0P0ZC27	Stx2-converting_phage	99.8	1.6e-253
AZR89670.1|3049625_3050513_-	replication protein	NA	A5VW95	Enterobacteria_phage	99.3	2.4e-144
AZR89671.1|3050575_3050848_-	hypothetical protein	NA	G9L679	Escherichia_phage	98.9	3.0e-42
AZR89672.1|3050870_3051164_-	hypothetical protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
AZR89673.1|3051272_3051458_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
AZR89674.1|3051538_3052189_+	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	100.0	1.1e-122
AZR89675.1|3052795_3053095_+	hypothetical protein	NA	A5VW99	Enterobacteria_phage	100.0	9.0e-32
AZR89676.1|3053106_3053730_+	hypothetical protein	NA	K7PKU5	Enterobacteria_phage	99.5	1.2e-110
AZR89677.1|3053903_3054872_+	cell envelope biogenesis protein TolA	NA	G5DA88	Enterobacteria_phage	99.7	1.3e-55
AZR89678.1|3054895_3055027_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
AZR89679.1|3055011_3055164_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
AZR89680.1|3055418_3056126_+	recombinase	NA	K7PKU3	Enterobacteria_phage	100.0	7.6e-138
AZR89681.1|3056126_3056633_+	single-stranded DNA-binding protein	NA	K7PHK1	Enterobacteria_phage	100.0	2.3e-80
AZR89682.1|3056646_3056940_+	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	99.0	1.9e-50
AZR89683.1|3056950_3057118_+	DUF2737 family protein	NA	Q716F2	Shigella_phage	100.0	1.7e-24
AZR89684.1|3057114_3057741_+	ead/Ea22-like family protein	NA	K7P6T4	Enterobacteria_phage	73.2	8.7e-85
AZR89685.1|3057737_3058241_+	DUF551 domain-containing protein	NA	V5UT79	Shigella_phage	65.2	4.4e-47
AZR89686.1|3058240_3058525_+	DUF4752 family protein	NA	G9L657	Escherichia_phage	96.8	2.2e-48
AZR89687.1|3058517_3058799_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	93.5	2.3e-45
AZR89688.1|3058912_3059104_+	hypothetical protein	NA	G8C7S2	Escherichia_phage	67.2	1.1e-17
AZR89689.1|3059184_3059352_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
AZR89690.1|3059691_3059883_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
AZR89691.1|3059863_3061042_-	DUF4102 domain-containing protein	NA	K7P7J2	Enterobacteria_phage	99.2	7.5e-231
>prophage 5
CP031293	Escherichia coli strain EC17GD31 chromosome, complete genome	4975832	3076560	3087818	4975832		Acanthocystis_turfacea_Chlorella_virus(25.0%)	10	NA	NA
AZR89707.1|3076560_3077727_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	1.7e-110
AZR89708.1|3077974_3079381_-	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
AZR89709.1|3079544_3080915_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	28.4	2.2e-32
AZR89710.1|3080939_3081686_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	41.6	2.1e-08
AZR89711.1|3081769_3083155_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.5	1.9e-47
AZR89712.1|3083166_3083622_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
AZR89713.1|3083624_3084590_-	GDP-L-fucose synthase	NA	M1I5W5	Acanthocystis_turfacea_Chlorella_virus	51.7	9.9e-88
AZR89714.1|3084593_3085715_-	GDP-mannose 4,6-dehydratase	NA	M1HVG7	Acanthocystis_turfacea_Chlorella_virus	64.7	2.2e-131
AZR89715.1|3085725_3086733_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AZR89716.1|3086801_3087818_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	44.3	6.3e-77
>prophage 6
CP031293	Escherichia coli strain EC17GD31 chromosome, complete genome	4975832	3199961	3209403	4975832		Enterobacteria_phage(85.71%)	10	NA	NA
AZR89811.1|3199961_3201098_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	98.4	5.9e-164
AZR89812.1|3201094_3203095_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	94.9	0.0e+00
AZR89813.1|3203219_3203681_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
AZR89814.1|3203721_3204192_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	1.5e-81
AZR89815.1|3204238_3204958_-	two-component system response regulator YehT	NA	NA	NA	NA	NA
AZR89816.1|3204954_3206640_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.5	9.5e-304
AZR89817.1|3206861_3207593_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
AZR89818.1|3207652_3207760_+	hypothetical protein	NA	NA	NA	NA	NA
AZR89819.1|3207740_3208472_-	ABC transporter permease	NA	NA	NA	NA	NA
AZR89820.1|3208476_3209403_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 7
CP031293	Escherichia coli strain EC17GD31 chromosome, complete genome	4975832	3515376	3614531	4975832	transposase,terminase,head,lysis,protease,holin,tail,integrase,portal,capsid	Enterobacteria_phage(43.55%)	110	3565821:3565867	3614545:3614591
AZR90111.1|3515376_3516639_-|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AZR90112.1|3517170_3518391_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.5	2.7e-58
AZR90113.1|3518363_3518993_+	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	53.3	1.3e-56
AZR90114.1|3518993_3520154_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AZR90115.1|3520262_3521351_+	oxidoreductase	NA	NA	NA	NA	NA
AZR90116.1|3521360_3521558_-	DUF466 domain-containing protein	NA	NA	NA	NA	NA
AZR90117.1|3521712_3523818_-	carbon starvation protein	NA	NA	NA	NA	NA
AZR90118.1|3523998_3524412_-	proofreading thioesterase EntH	NA	NA	NA	NA	NA
AZR90119.1|3524414_3525161_-	2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase	NA	NA	NA	NA	NA
AZR90120.1|3525160_3526018_-	enterobactin biosynthesis bifunctional isochorismatase/aryl carrier protein EntB	NA	NA	NA	NA	NA
AZR90121.1|3526031_3527642_-	(2,3-dihydroxybenzoyl)adenylate synthase	NA	NA	NA	NA	NA
AZR90122.1|3527651_3528827_-	isochorismate synthase EntC	NA	NA	NA	NA	NA
AZR90123.1|3529015_3529972_+	Fe2+-enterobactin ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR90124.1|3529975_3531226_-	MFS transporter	NA	NA	NA	NA	NA
AZR90125.1|3531336_3532341_+	Fe(3+)-siderophore ABC transporter permease	NA	NA	NA	NA	NA
AZR90126.1|3532337_3533330_+	ferric anguibactin ABC transporter permease	NA	NA	NA	NA	NA
AZR90127.1|3533326_3534142_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.5	4.3e-07
AZR90128.1|3534138_3535272_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
AZR90129.1|3535486_3539368_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.6	1.7e-61
AZR90130.1|3539364_3539583_-	MbtH family protein	NA	NA	NA	NA	NA
AZR90131.1|3539585_3540788_-	enterochelin esterase	NA	NA	NA	NA	NA
AZR90132.1|3541030_3543271_+	siderophore enterobactin receptor FepA	NA	NA	NA	NA	NA
AZR90133.1|3543320_3543941_+	enterobactin synthase subunit EntD	NA	NA	NA	NA	NA
AZR90134.1|3544062_3544215_-	protein HokE	NA	NA	NA	NA	NA
AZR90135.1|3544665_3545784_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AZR90136.1|3545849_3546098_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
AZR90137.1|3546162_3546546_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
AZR90138.1|3546624_3547278_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
AZR90139.1|3547385_3548633_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
AZR90140.1|3548713_3550090_-	phenylalanine transporter	NA	NA	NA	NA	NA
AZR90141.1|3550191_3553335_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	9.8e-60
AZR90142.1|3553346_3554570_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
AZR90143.1|3554585_3554918_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone	NA	NA	NA	NA	NA
AZR90144.1|3554941_3556324_-	Cu(I)/Ag(I) efflux RND transporter outer membrane protein	NA	NA	NA	NA	NA
AZR90145.1|3556278_3556434_-	copper transporter	NA	NA	NA	NA	NA
AZR90146.1|3556480_3557164_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
AZR90147.1|3557153_3558596_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	3.0e-11
AZR90148.1|3558745_3560983_+	bacteriophage N4 adsorption protein B	NA	NA	NA	NA	NA
AZR90149.1|3560969_3563942_+	phage receptor	NA	NA	NA	NA	NA
AZR90150.1|3563942_3564833_+	DUF4434 family protein	NA	NA	NA	NA	NA
AZR90151.1|3564746_3564959_-	hypothetical protein	NA	NA	NA	NA	NA
AZR90152.1|3565015_3565777_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZR90153.1|3565770_3565887_+	hypothetical protein	NA	NA	NA	NA	NA
3565821:3565867	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
AZR90154.1|3566072_3566264_-	hypothetical protein	NA	NA	NA	NA	NA
AZR90155.1|3566289_3567243_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
AZR90156.1|3567429_3568914_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZR91592.1|3569494_3570121_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZR90157.1|3570065_3570203_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AZR90158.1|3570313_3570607_-	hypothetical protein	NA	NA	NA	NA	NA
AZR90159.1|3570617_3571322_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	62.3	5.4e-59
AZR90160.1|3571331_3571613_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	2.7e-17
AZR90161.1|3571612_3573985_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	68.8	7.9e-163
AZR91593.1|3574049_3574649_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	92.5	3.4e-102
AZR90162.1|3574716_3578196_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
AZR90163.1|3578256_3578898_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.0	8.6e-96
AZR90164.1|3578795_3579539_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	1.8e-145
AZR90165.1|3579543_3580242_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	9.9e-130
AZR90166.1|3580241_3580571_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
AZR90167.1|3580567_3583129_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	99.2	0.0e+00
AZR90168.1|3583121_3583511_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.1	3.4e-55
AZR90169.1|3583537_3583960_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.0	7.7e-69
AZR91594.1|3583975_3584716_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.5	2.4e-126
AZR90170.1|3584723_3585119_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
AZR90171.1|3585115_3585694_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
AZR90172.1|3585705_3586059_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
AZR90173.1|3586070_3586469_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	84.1	5.2e-51
AZR90174.1|3586510_3587536_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	99.1	3.9e-191
AZR90175.1|3587591_3587924_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
AZR90176.1|3587933_3589253_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	98.6	4.8e-234
AZR90177.1|3589233_3590835_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	1.1e-309
AZR90178.1|3590831_3591038_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AZR90179.1|3591034_3592960_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
AZR90180.1|3592934_3593480_-	DNA-packaging protein NU1	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
AZR90181.1|3593619_3593721_-	hypothetical protein	NA	NA	NA	NA	NA
AZR90182.1|3593868_3594063_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
AZR90183.1|3594425_3594719_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
AZR90184.1|3594750_3595212_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	98.7	4.1e-76
AZR90185.1|3595208_3595685_-	lysozyme	NA	K7PKX1	Enterobacterial_phage	96.1	9.5e-84
AZR90186.1|3595688_3596015_-|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
AZR90187.1|3597483_3598698_+	hypothetical protein	NA	NA	NA	NA	NA
AZR90188.1|3598677_3599034_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	92.0	2.3e-58
AZR90189.1|3599118_3599259_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
AZR90190.1|3599255_3599618_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
AZR90191.1|3599614_3599905_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
AZR90192.1|3599897_3600068_-	NinE family protein	NA	NA	NA	NA	NA
AZR90193.1|3600067_3600523_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	67.5	3.7e-61
AZR90194.1|3600519_3600621_-	hypothetical protein	NA	NA	NA	NA	NA
AZR90195.1|3600719_3601649_-	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	40.0	3.0e-57
AZR90196.1|3601853_3602171_-	hypothetical protein	NA	NA	NA	NA	NA
AZR90197.1|3602282_3603809_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.7	6.1e-31
AZR90198.1|3604065_3604398_-	multidrug SMR transporter	NA	NA	NA	NA	NA
AZR90199.1|3604465_3604768_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	94.6	2.6e-42
AZR90200.1|3604764_3605466_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	97.0	7.9e-127
AZR90201.1|3605462_3606482_-	Replication protein O	NA	A0A0K2FJ31	Enterobacteria_phage	68.4	6.7e-111
AZR90202.1|3606478_3607018_-	regulator	NA	M9NZI6	Enterobacteria_phage	65.6	7.5e-61
AZR90203.1|3607099_3607330_-	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	68.0	8.5e-22
AZR90204.1|3607368_3608124_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.4	4.7e-93
AZR90205.1|3608204_3608474_+	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	75.3	4.8e-32
AZR90206.1|3608605_3608923_+	hypothetical protein	NA	NA	NA	NA	NA
AZR90207.1|3609478_3609685_+	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	4.2e-28
AZR90208.1|3609760_3610057_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
AZR90209.1|3610062_3610848_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	2.4e-148
AZR90210.1|3610844_3611525_+	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
AZR90211.1|3611521_3611680_+	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.1	1.8e-23
AZR90212.1|3611676_3612234_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.9	3.2e-62
AZR90213.1|3612244_3612526_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
AZR90214.1|3612624_3612843_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
AZR90215.1|3612890_3613169_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
AZR90216.1|3613140_3613512_+	DNA-binding protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
AZR90217.1|3613367_3614531_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.0	3.7e-198
3614545:3614591	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 8
CP031293	Escherichia coli strain EC17GD31 chromosome, complete genome	4975832	3885736	3906962	4975832	holin	Morganella_phage(17.65%)	25	NA	NA
AZR90472.1|3885736_3886192_+	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	66.4	2.9e-45
AZR90473.1|3886271_3886493_+	hypothetical protein	NA	H6WRV2	Salmonella_phage	41.5	1.4e-05
AZR90474.1|3887036_3887735_-	hypothetical protein	NA	NA	NA	NA	NA
AZR90475.1|3887885_3890606_-	lytic transglycosylase domain-containing protein	NA	A5VW64	Enterobacteria_phage	60.9	7.5e-149
AZR90476.1|3890602_3891922_-	DNA transfer protein p33	NA	B6SCW4	Bacteriophage	43.2	1.2e-35
AZR90477.1|3891921_3892599_-	DNA transfer protein	NA	Q2A0B2	Sodalis_phage	71.6	7.0e-56
AZR90478.1|3892592_3893054_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	72.2	2.9e-61
AZR90479.1|3893499_3893751_-	hypothetical protein	NA	NA	NA	NA	NA
AZR90480.1|3893817_3896574_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.2	8.9e-299
AZR90481.1|3896560_3896932_-	hypothetical protein	NA	NA	NA	NA	NA
AZR90482.1|3896924_3897266_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	61.5	2.5e-33
AZR90483.1|3897276_3897879_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.8	1.5e-25
AZR90484.1|3897871_3898093_-	hypothetical protein	NA	NA	NA	NA	NA
AZR90485.1|3898089_3898353_-|holin	nicotinic acetylcholine receptor subunit beta	holin	NA	NA	NA	NA
AZR90486.1|3898349_3898544_-	hypothetical protein	NA	NA	NA	NA	NA
AZR90487.1|3898536_3899604_-	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	36.8	8.9e-13
AZR90488.1|3899597_3899780_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AZR90489.1|3899772_3900606_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
AZR90490.1|3900618_3901050_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	3.9e-28
AZR90491.1|3901049_3901253_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
AZR90492.1|3901300_3901516_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AZR90493.1|3901680_3902895_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	56.2	2.2e-132
AZR90494.1|3903250_3904504_-	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
AZR90495.1|3904515_3905619_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.1	2.4e-61
AZR90496.1|3905906_3906962_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	2.9e-117
>prophage 9
CP031293	Escherichia coli strain EC17GD31 chromosome, complete genome	4975832	3965958	4020656	4975832	tail,protease,tRNA,transposase	Flavobacterium_phage(12.5%)	51	NA	NA
AZR90550.1|3965958_3967311_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
AZR90551.1|3967322_3968180_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AZR90552.1|3968192_3968951_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
AZR90553.1|3969139_3970336_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
AZR90554.1|3970427_3970985_-	ribosome-recycling factor	NA	NA	NA	NA	NA
AZR90555.1|3971134_3971860_-	UMP kinase	NA	NA	NA	NA	NA
AZR90556.1|3972006_3972858_-	elongation factor Ts	NA	NA	NA	NA	NA
AZR90557.1|3972992_3973718_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
AZR90558.1|3974085_3974880_+	methionine aminopeptidase	NA	NA	NA	NA	NA
AZR90559.1|3974941_3977614_+	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
AZR90560.1|3977644_3978469_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
AZR90561.1|3978778_3979165_+	DUF3461 family protein	NA	NA	NA	NA	NA
AZR90562.1|3979218_3980376_-	CdaR family transcriptional regulator	NA	NA	NA	NA	NA
AZR90563.1|3980530_3981955_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
AZR90564.1|3982084_3983602_-	deoxyguanosinetriphosphate triphosphohydrolase	NA	NA	NA	NA	NA
AZR90565.1|3983685_3984384_+	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
AZR90566.1|3984376_3985177_+	cobalamin-binding protein	NA	NA	NA	NA	NA
AZR90567.1|3985214_3985838_+	hypothetical protein	NA	NA	NA	NA	NA
AZR90568.1|3985884_3986229_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
AZR90569.1|3986310_3987732_-	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
AZR90570.1|3987956_3989237_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
AZR90571.1|3989271_3991254_-	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
AZR90572.1|3991250_3992141_-	Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD	NA	NA	NA	NA	NA
AZR90573.1|3992140_3992938_-	iron(3+)-hydroxamate import ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
AZR90574.1|3992988_3995232_-	ferrichrome porin FhuA	NA	NA	NA	NA	NA
AZR90575.1|3995451_3997986_-	penicillin-binding protein 1B	NA	NA	NA	NA	NA
AZR90576.1|3998079_4000509_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	28.9	3.5e-41
AZR90577.1|4000582_4001113_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
AZR90578.1|4001127_4001832_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AZR90579.1|4002009_4002465_+	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
AZR90580.1|4002501_4003428_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AZR90581.1|4003466_4004885_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
AZR90582.1|4004881_4005361_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AZR90583.1|4005731_4006316_+	fimbrial protein	NA	NA	NA	NA	NA
AZR90584.1|4006413_4007154_+	fimbrial chaperone	NA	NA	NA	NA	NA
AZR90585.1|4007188_4009789_+	outer membrane usher protein	NA	NA	NA	NA	NA
AZR90586.1|4009808_4010375_+	fimbrial protein	NA	NA	NA	NA	NA
AZR90587.1|4010389_4010995_+	fimbrial-like protein YadL	NA	NA	NA	NA	NA
AZR90588.1|4011640_4012951_+	fimbrial-like adhesin	NA	NA	NA	NA	NA
AZR90589.1|4013063_4013858_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
AZR90590.1|4013869_4014721_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
AZR90591.1|4014802_4015030_-|transposase	transposase	transposase	NA	NA	NA	NA
AZR90592.1|4015098_4016031_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	48.8	1.7e-60
AZR90593.1|4016011_4016212_+	hypothetical protein	NA	NA	NA	NA	NA
AZR90594.1|4016151_4016355_-	hypothetical protein	NA	NA	NA	NA	NA
AZR90595.1|4016304_4016685_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
AZR90596.1|4016688_4017918_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AZR90597.1|4017981_4018422_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AZR90598.1|4018526_4019297_-	ABC transporter permease	NA	NA	NA	NA	NA
AZR90599.1|4019293_4019719_-|tail	phage tail protein	tail	NA	NA	NA	NA
AZR91609.1|4019681_4020656_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
>prophage 10
CP031293	Escherichia coli strain EC17GD31 chromosome, complete genome	4975832	4515407	4573287	4975832	tail,plate,integrase,tRNA	Burkholderia_phage(25.0%)	62	4511482:4511496	4524227:4524241
4511482:4511496	attL	CAGCAGAATGCCACC	NA	NA	NA	NA
AZR91047.1|4515407_4515584_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR91048.1|4515542_4515824_+	hypothetical protein	NA	NA	NA	NA	NA
AZR91049.1|4515922_4516459_-	ssDNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
AZR91050.1|4516713_4519536_+	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
AZR91051.1|4519570_4519927_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
AZR91052.1|4519930_4520347_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
AZR91053.1|4520457_4521171_-	acid phosphatase AphA	NA	NA	NA	NA	NA
AZR91054.1|4521532_4522075_+	hypothetical protein	NA	NA	NA	NA	NA
AZR91055.1|4522297_4523491_-	aromatic amino acid transaminase	NA	NA	NA	NA	NA
AZR91056.1|4523743_4524823_-	alanine racemase biosynthetic	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
4524227:4524241	attR	CAGCAGAATGCCACC	NA	NA	NA	NA
AZR91057.1|4524875_4526291_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
AZR91058.1|4526373_4527357_+	quinone oxidoreductase	NA	NA	NA	NA	NA
AZR91059.1|4527522_4527765_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
AZR91060.1|4527898_4528936_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AZR91061.1|4529297_4530302_-	DUF2713 family protein	NA	NA	NA	NA	NA
AZR91062.1|4530619_4531135_+	transcriptional regulator Zur	NA	NA	NA	NA	NA
AZR91063.1|4531176_4531386_-	CsbD family protein	NA	NA	NA	NA	NA
AZR91064.1|4531501_4532881_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
AZR91065.1|4532899_4533508_-	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
AZR91066.1|4533617_4533986_-	diacylglycerol kinase	NA	NA	NA	NA	NA
AZR91635.1|4534156_4536580_+	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
AZR91067.1|4536734_4537607_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
AZR91068.1|4537619_4538117_-	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
AZR91069.1|4538130_4538223_-	chorismate lyase	NA	NA	NA	NA	NA
AZR91070.1|4538339_4539920_-	SopA family protein	NA	NA	NA	NA	NA
AZR91071.1|4540147_4541068_-	maltose operon protein MalM	NA	NA	NA	NA	NA
AZR91072.1|4541310_4542651_-	maltoporin	NA	NA	NA	NA	NA
AZR91073.1|4542722_4543838_-	maltose/maltodextrin import ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
AZR91074.1|4544014_4544110_+	sugar ABC transporter	NA	NA	NA	NA	NA
AZR91075.1|4544202_4545393_+	maltose-binding periplasmic protein	NA	NA	NA	NA	NA
AZR91076.1|4545546_4547091_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
AZR91077.1|4547105_4547996_+	maltose ABC transporter permease	NA	NA	NA	NA	NA
AZR91078.1|4548089_4548500_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
AZR91079.1|4548714_4548993_+	hypothetical protein	NA	NA	NA	NA	NA
AZR91080.1|4549039_4551136_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
AZR91081.1|4551135_4551873_-	hypothetical protein	NA	NA	NA	NA	NA
AZR91082.1|4551869_4552508_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
AZR91083.1|4552621_4552864_-	hypothetical protein	NA	NA	NA	NA	NA
AZR91084.1|4553217_4554867_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AZR91085.1|4555391_4556741_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
AZR91086.1|4556795_4557143_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	49.0	2.2e-21
AZR91087.1|4557680_4557968_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.1	1.5e-15
AZR91088.1|4557970_4558576_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.1	3.3e-57
AZR91089.1|4558588_4558903_+	hypothetical protein	NA	Q5ZQY8	Pseudomonas_phage	43.2	9.2e-19
AZR91090.1|4559047_4559503_+	hypothetical protein	NA	NA	NA	NA	NA
AZR91091.1|4559499_4559697_+	hypothetical protein	NA	NA	NA	NA	NA
AZR91092.1|4559686_4561111_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.4	3.2e-191
AZR91093.1|4561110_4561635_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	9.5e-69
AZR91094.1|4561685_4562003_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AZR91095.1|4561962_4562091_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AZR91096.1|4562192_4564568_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	26.1	5.9e-57
AZR91097.1|4564567_4565521_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	3.3e-35
AZR91098.1|4565520_4565730_+	hypothetical protein	NA	A4JWL2	Burkholderia_virus	60.3	1.3e-16
AZR91099.1|4565717_4566758_+	phage protein D	NA	A4JWL3	Burkholderia_virus	44.8	4.4e-73
AZR91100.1|4566767_4567469_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	36.3	4.9e-12
AZR91101.1|4567567_4567927_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	4.7e-35
AZR91102.1|4567917_4569033_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	51.4	6.9e-101
AZR91103.1|4569025_4569742_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	37.2	1.8e-22
AZR91104.1|4569744_4571325_+	short-chain fatty acid transporter	NA	A0A0M3ULH6	Salmonella_phage	40.8	1.3e-84
AZR91105.1|4571321_4572029_+	DUF4376 domain-containing protein	NA	A0A0E3JQ06	Enterobacteria_phage	42.4	4.1e-14
AZR91106.1|4572025_4572481_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	42.7	2.3e-26
AZR91107.1|4572495_4573287_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	2.0e-46
>prophage 1
CP031295	Escherichia coli strain EC17GD31 plasmid pGD31-F1928, complete sequence	245305	1949	77067	245305	transposase,integrase	Escherichia_phage(21.88%)	70	NA	NA
AZR91772.1|1949_2726_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
AZR91773.1|2722_3466_-	hypothetical protein	NA	NA	NA	NA	NA
AZR91774.1|3516_3867_-	hypothetical protein	NA	NA	NA	NA	NA
AZR91775.1|4434_5409_-	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
AZR91776.1|7341_7692_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	54.3	1.9e-20
AZR91777.1|7835_8267_-	silver-binding protein SilE	NA	NA	NA	NA	NA
AZR91778.1|8517_9993_-	Cu(+)/Ag(+) sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
AZR91779.1|9985_10666_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.0	1.2e-31
AZR91780.1|10667_10793_+	outer-membrane efflux lipo domain protein	NA	NA	NA	NA	NA
AZR91781.1|10855_12241_+	Cu(I)/Ag(I) efflux RND transporter outer membrane protein	NA	NA	NA	NA	NA
AZR91782.1|12268_12622_+	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR91783.1|12735_14028_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AZR91784.1|14038_17185_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.4	1.2e-60
AZR91785.1|17271_17712_+	hypothetical protein	NA	NA	NA	NA	NA
AZR91786.1|17838_20286_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.4	2.9e-83
AZR91787.1|20326_20524_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AZR91788.1|20557_21289_-	peptidase M23	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	31.9	1.3e-10
AZR91789.1|25096_25474_-	ribosomal subunit interface protein	NA	NA	NA	NA	NA
AZR91790.1|26869_27574_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZR91998.1|27646_27886_+	macrolide transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	46.2	9.5e-08
AZR91791.1|28031_28895_+	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
AZR91792.1|28932_29178_+	hypothetical protein	NA	NA	NA	NA	NA
AZR91793.1|29646_30438_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
AZR91794.1|31292_31478_-	hypothetical protein	NA	NA	NA	NA	NA
AZR91795.1|31773_32745_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	38.1	2.4e-49
AZR91796.1|34060_34186_-	ABC transporter	NA	NA	NA	NA	NA
AZR91797.1|34790_35006_+	hypothetical protein	NA	NA	NA	NA	NA
AZR91798.1|35204_35564_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
AZR91799.1|37683_38388_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZR91800.1|38443_38923_+	phenol hydroxylase	NA	NA	NA	NA	NA
AZR91801.1|39119_40210_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
AZR91802.1|40299_41115_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AZR91803.1|41201_41504_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AZR91804.1|41397_41649_-	hypothetical protein	NA	NA	NA	NA	NA
AZR91805.1|41679_43173_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AZR91806.1|43284_43590_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR91807.1|43617_44832_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
AZR91808.1|45048_45933_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AZR91809.1|46857_47562_+|transposase	IS6 family transposase IS1006	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
AZR91999.1|47646_48048_-	hypothetical protein	NA	NA	NA	NA	NA
AZR91810.1|48056_51008_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
AZR91811.1|51010_51571_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AZR91812.1|51696_52311_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AZR91813.1|52249_53263_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AZR91814.1|53407_53905_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
AZR91815.1|54016_54307_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
AZR91816.1|54312_55104_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AZR91817.1|55365_56625_+	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
AZR91818.1|56717_57509_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AZR91819.1|57678_58011_+	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
AZR91820.1|58150_58336_+	hypothetical protein	NA	NA	NA	NA	NA
AZR91821.1|59150_59318_-	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	68.0	1.6e-14
AZR91822.1|59436_61356_-	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A2K5B2A5	Erysipelothrix_phage	96.4	0.0e+00
AZR91823.1|61371_61458_-	tetracycline resistance protein	NA	NA	NA	NA	NA
AZR91824.1|62253_62958_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZR91825.1|64323_64530_-|transposase	transposase	transposase	NA	NA	NA	NA
AZR91826.1|65429_65711_+	hypothetical protein	NA	NA	NA	NA	NA
AZR91827.1|66617_67943_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	3.2e-113
AZR91828.1|68091_68796_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	1.7e-137
AZR92000.1|68861_69293_+	hypothetical protein	NA	NA	NA	NA	NA
AZR91829.1|70217_70493_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AZR91830.1|70486_71131_-	chromosome partitioning protein ParA	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
AZR91831.1|71352_72324_+	plasmid segregation protein parM	NA	A0A222YXF2	Escherichia_phage	42.9	7.4e-67
AZR91832.1|72292_72721_+	plasmid stability protein	NA	NA	NA	NA	NA
AZR91833.1|72725_73997_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.5	1.9e-142
AZR91834.1|73996_74434_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
AZR91835.1|74430_74679_-	protein ImpC	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
AZR91836.1|74789_75059_+	hypothetical protein	NA	NA	NA	NA	NA
AZR92001.1|75096_75999_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AZR91837.1|76383_77067_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
>prophage 2
CP031295	Escherichia coli strain EC17GD31 plasmid pGD31-F1928, complete sequence	245305	130129	166194	245305	transposase,bacteriocin,integrase,protease	Escherichia_phage(33.33%)	35	148244:148256	169029:169041
AZR91896.1|130129_130780_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AZR91897.1|130999_131464_+	mRNA interferase PemK	NA	NA	NA	NA	NA
AZR91898.1|131460_131565_+	hypothetical protein	NA	NA	NA	NA	NA
AZR91899.1|132774_133479_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZR91900.1|135100_135343_+	relaxase	NA	NA	NA	NA	NA
AZR91901.1|135374_136052_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZR91902.1|136130_137330_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AZR92012.1|138382_138775_-	cysteine hydrolase	NA	NA	NA	NA	NA
AZR91903.1|141616_142432_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
AZR91904.1|142582_143287_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
AZR91905.1|143177_143660_-	hypothetical protein	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.5	2.9e-40
AZR91906.1|143820_144144_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AZR91907.1|144248_145328_+	permease	NA	NA	NA	NA	NA
AZR91908.1|145620_146238_-	proQ/FINO family protein	NA	NA	NA	NA	NA
148244:148256	attL	TGTTTTTACGGGG	NA	NA	NA	NA
AZR91909.1|148248_148839_-	hypothetical protein	NA	NA	NA	NA	NA
AZR91910.1|148838_149096_-	hypothetical protein	NA	NA	NA	NA	NA
AZR91911.1|149449_151588_+	AAA family ATPase	NA	NA	NA	NA	NA
AZR91912.1|151749_152166_-	PIN domain-containing protein	NA	NA	NA	NA	NA
AZR91913.1|152162_152393_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AZR92013.1|152334_152508_-	toxin-antitoxin system, antitoxin component, AbrB family protein	NA	NA	NA	NA	NA
AZR91914.1|152688_152979_+	hypothetical protein	NA	NA	NA	NA	NA
AZR91915.1|152968_153868_+	hypothetical protein	NA	NA	NA	NA	NA
AZR91916.1|153917_156143_-	phage T7 exclusion protein	NA	NA	NA	NA	NA
AZR91917.1|156144_157233_-	transcriptional regulator	NA	NA	NA	NA	NA
AZR91918.1|157777_158128_+	hypothetical protein	NA	NA	NA	NA	NA
AZR91919.1|158171_158861_+	hypothetical protein	NA	NA	NA	NA	NA
AZR91920.1|158857_159649_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	9.4e-52
AZR92014.1|159826_160180_+	colicin M immunity protein	NA	NA	NA	NA	NA
AZR91921.1|160229_161045_-|bacteriocin	lipid II-degrading bacteriocin colicin M	bacteriocin	NA	NA	NA	NA
AZR91922.1|161288_161816_+	colicin B immunity protein	NA	NA	NA	NA	NA
AZR91923.1|162173_162455_+	hypothetical protein	NA	NA	NA	NA	NA
AZR91924.1|162761_163037_-	hypothetical protein	NA	NA	NA	NA	NA
AZR91925.1|163132_163336_+	hypothetical protein	NA	NA	NA	NA	NA
AZR91926.1|165144_165333_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
AZR91927.1|165453_166194_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
169029:169041	attR	CCCCGTAAAAACA	NA	NA	NA	NA
>prophage 3
CP031295	Escherichia coli strain EC17GD31 plasmid pGD31-F1928, complete sequence	245305	235464	244301	245305	transposase	Enterobacteria_phage(42.86%)	8	NA	NA
AZR91990.1|235464_236022_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
AZR91991.1|236204_237065_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AZR91992.1|238616_239321_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZR91993.1|239395_239782_+	hypothetical protein	NA	NA	NA	NA	NA
AZR91994.1|239921_240845_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.4	4.0e-171
AZR92022.1|241338_242040_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.5	2.2e-81
AZR91995.1|242121_243099_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
AZR91996.1|243095_244301_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
>prophage 1
CP031294	Escherichia coli strain EC17GD31 plasmid pGD31-F25, complete sequence	110686	0	75139	110686	terminase,tail,integrase,capsid	Salmonella_phage(94.52%)	83	11336:11351	19267:19282
AZR91650.1|0_1056_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	91.0	5.4e-172
AZR91651.1|1545_1758_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	3.4e-33
AZR91652.1|1757_2093_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	73.9	6.6e-39
AZR91653.1|2089_2269_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	67.8	4.0e-11
AZR91654.1|2308_2584_-	hypothetical protein	NA	J9Q738	Salmonella_phage	74.7	2.0e-33
AZR91762.1|2639_3056_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	76.1	1.3e-60
AZR91655.1|3156_3987_-	SPFH/Band 7/PHB domain protein	NA	J9Q7Z4	Salmonella_phage	94.9	3.1e-122
AZR91656.1|3990_4191_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	59.1	7.2e-09
AZR91657.1|4283_5357_-	recombinase	NA	J9Q736	Salmonella_phage	95.2	1.4e-196
AZR91658.1|5359_5626_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	77.3	2.6e-30
AZR91659.1|5625_6570_-	exonuclease	NA	J9Q7S6	Salmonella_phage	88.9	1.0e-161
AZR91660.1|6630_7659_-	regulator	NA	J9Q7Z3	Salmonella_phage	87.3	9.4e-145
AZR91661.1|7776_8208_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	86.7	9.0e-65
AZR91662.1|8452_9043_+	hypothetical protein	NA	NA	NA	NA	NA
AZR91663.1|9261_12780_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	94.4	0.0e+00
11336:11351	attL	ACGTTCTTCAGTTCTT	NA	NA	NA	NA
AZR91664.1|12754_12958_-	hypothetical protein	NA	J9Q6I7	Salmonella_phage	92.5	5.2e-31
AZR91665.1|12960_14196_-	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	81.0	3.3e-197
AZR91666.1|14291_16400_-	cobalamin biosynthesis protein CobT	NA	J9Q7G6	Salmonella_phage	66.7	5.7e-229
AZR91667.1|16498_16711_-	hypothetical protein	NA	NA	NA	NA	NA
AZR91668.1|16962_17349_+	transcriptional regulator	NA	NA	NA	NA	NA
AZR91669.1|17343_18447_-|integrase	integrase	integrase	A0A1P8DTG6	Proteus_phage	33.8	1.3e-27
AZR91670.1|18620_19031_-	toxin YafO	NA	NA	NA	NA	NA
AZR91763.1|19040_19493_-	hypothetical protein	NA	NA	NA	NA	NA
19267:19282	attR	ACGTTCTTCAGTTCTT	NA	NA	NA	NA
AZR91671.1|19744_19990_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	44.9	2.6e-13
AZR91672.1|20163_21072_+	hypothetical protein	NA	NA	NA	NA	NA
AZR91673.1|22584_22875_-	C-type natriuretic protein	NA	J9Q7S1	Salmonella_phage	79.2	2.4e-37
AZR91674.1|23020_23236_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	72.1	9.7e-20
AZR91764.1|23219_23396_-	hypothetical protein	NA	J9Q729	Salmonella_phage	72.4	1.1e-16
AZR91675.1|23395_24718_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	91.4	4.0e-241
AZR91676.1|24714_24972_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	59.0	3.9e-15
AZR91677.1|25252_26029_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	41.1	4.1e-52
AZR91678.1|26154_26568_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	47.7	1.5e-24
AZR91679.1|26800_27946_+	sel1 repeat family protein	NA	NA	NA	NA	NA
AZR91680.1|27937_29119_-	DNA primase	NA	J9Q720	Salmonella_phage	91.1	2.7e-204
AZR91681.1|29200_30541_-	DNA helicase	NA	J9Q7G4	Salmonella_phage	93.3	5.7e-235
AZR91682.1|30584_31325_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	89.2	3.7e-127
AZR91683.1|31503_33198_-	hypothetical protein	NA	X2KLG0	Campylobacter_phage	24.9	4.1e-12
AZR91684.1|33249_33609_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.5e-44
AZR91685.1|33608_34277_-	plasmid stability protein	NA	J9Q7R7	Salmonella_phage	91.4	3.7e-110
AZR91686.1|34453_35206_-	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	31.1	7.9e-16
AZR91687.1|35190_35574_-	hypothetical protein	NA	A0A077SLR3	Escherichia_phage	43.3	1.3e-11
AZR91688.1|35946_36198_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	81.9	1.9e-27
AZR91689.1|36199_36892_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	93.9	1.4e-123
AZR91690.1|36905_37229_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	88.8	2.9e-44
AZR91691.1|37431_40098_-|tail	phage tail protein	tail	J9Q6E3	Salmonella_phage	39.2	7.5e-69
AZR91692.1|41553_46281_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	74.1	0.0e+00
AZR91693.1|46298_46892_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	90.9	2.0e-99
AZR91694.1|46879_47677_-|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	94.0	1.3e-154
AZR91695.1|47669_48401_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	97.0	5.3e-134
AZR91696.1|48450_48786_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	87.3	8.0e-53
AZR91697.1|48828_53400_-|tail	phage tail tape measure protein	tail	J9Q712	Salmonella_phage	85.3	0.0e+00
AZR91698.1|53407_53677_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	94.8	1.7e-34
AZR91699.1|53757_54075_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	96.2	8.6e-49
AZR91700.1|54130_54877_-	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	93.5	2.8e-122
AZR91701.1|54951_55335_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	81.9	4.7e-57
AZR91702.1|55336_55810_-	hypothetical protein	NA	J9Q711	Salmonella_phage	90.4	3.3e-76
AZR91703.1|55800_56145_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	95.6	2.3e-55
AZR91704.1|56224_57058_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	92.1	1.3e-141
AZR91705.1|57057_57492_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	82.6	1.1e-59
AZR91706.1|57536_58457_-	hypothetical protein	NA	J9Q6D6	Salmonella_phage	80.2	2.4e-123
AZR91707.1|58530_59406_-|capsid	phage major capsid protein	capsid	J9Q710	Salmonella_phage	93.8	4.2e-154
AZR91708.1|59431_60319_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	89.3	7.1e-133
AZR91709.1|60340_61915_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	93.1	2.2e-286
AZR91710.1|61941_63198_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	96.4	7.5e-245
AZR91711.1|63197_63830_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	83.8	1.8e-90
AZR91712.1|64025_64292_-	hypothetical protein	NA	J9Q757	Salmonella_phage	88.6	1.4e-36
AZR91713.1|64301_65192_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	98.6	2.6e-167
AZR91714.1|65188_65854_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.6	2.8e-110
AZR91715.1|65850_66519_-	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	89.6	5.6e-106
AZR91716.1|66518_67217_-	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	87.1	5.1e-110
AZR91717.1|67281_68841_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.9	4.4e-279
AZR91718.1|68843_69122_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	62.6	2.9e-24
AZR91765.1|69190_69613_+	hypothetical protein	NA	J9Q806	Salmonella_phage	75.7	7.0e-54
AZR91719.1|69617_70142_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	82.4	2.8e-68
AZR91766.1|70274_70454_+	hypothetical protein	NA	NA	NA	NA	NA
AZR91720.1|70738_71389_+	hypothetical protein	NA	J9Q754	Salmonella_phage	84.7	6.4e-99
AZR91721.1|71437_71641_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	91.0	5.9e-27
AZR91722.1|71661_71892_+	hypothetical protein	NA	NA	NA	NA	NA
AZR91723.1|72509_72992_-	hypothetical protein	NA	J9Q805	Salmonella_phage	69.8	7.9e-62
AZR91724.1|73196_73484_-	ABC transporter	NA	J9Q753	Salmonella_phage	79.6	2.1e-38
AZR91725.1|73813_74224_-	hypothetical protein	NA	NA	NA	NA	NA
AZR91726.1|74305_74701_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	54.6	3.1e-32
AZR91727.1|74827_75139_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	63.1	1.3e-28
>prophage 2
CP031294	Escherichia coli strain EC17GD31 plasmid pGD31-F25, complete sequence	110686	82843	109943	110686		Salmonella_phage(81.48%)	29	NA	NA
AZR91768.1|82843_84400_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	1.9e-104
AZR91735.1|84396_85656_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AZR91736.1|85777_88894_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.2	1.3e-27
AZR91737.1|89546_90161_-	hypothetical protein	NA	A0A0E3GMH9	Enterobacteria_phage	82.8	1.2e-99
AZR91738.1|90163_90445_-	hypothetical protein	NA	A0A0E3JPT1	Enterobacteria_phage	76.3	3.2e-39
AZR91739.1|90499_91069_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	61.4	1.8e-52
AZR91740.1|91208_91367_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
AZR91741.1|91366_91792_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	78.7	5.7e-56
AZR91742.1|91885_92074_-	hypothetical protein	NA	J9Q800	Salmonella_phage	53.2	7.2e-11
AZR91743.1|92083_92578_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	51.2	9.1e-29
AZR91744.1|92723_93317_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	83.2	1.4e-92
AZR91745.1|93900_94131_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.2	5.9e-31
AZR91746.1|94317_94911_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	86.3	2.0e-99
AZR91747.1|95094_95904_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	53.6	6.8e-66
AZR91748.1|96064_96619_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	77.6	5.3e-78
AZR91749.1|96628_97048_-	hypothetical protein	NA	J9Q743	Salmonella_phage	70.5	2.1e-50
AZR91750.1|97109_97754_-	hypothetical protein	NA	J9Q7H4	Salmonella_phage	81.8	4.6e-97
AZR91751.1|97753_98230_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	90.5	2.0e-81
AZR91752.1|98226_98640_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	87.6	2.5e-64
AZR91753.1|98641_99769_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	87.2	5.0e-192
AZR91754.1|99915_100785_-	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	80.6	5.3e-133
AZR91755.1|100862_102005_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	88.7	2.6e-196
AZR91756.1|102111_104427_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	84.3	0.0e+00
AZR91757.1|104500_105070_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	86.8	1.1e-91
AZR91758.1|105079_105823_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	46.8	1.5e-51
AZR91759.1|105812_107729_-	exonuclease	NA	J9Q741	Salmonella_phage	72.9	1.4e-247
AZR91769.1|107725_107917_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	76.2	3.7e-23
AZR91760.1|107958_109044_-	exonuclease SbcCD subunit D	NA	J9Q7S9	Salmonella_phage	87.3	6.8e-186
AZR91761.1|109298_109943_-	hypothetical protein	NA	J9Q739	Salmonella_phage	85.8	1.4e-106
>prophage 1
CP031297	Escherichia coli strain EC17GD31 plasmid pGD31-NDM, complete sequence	188230	100142	155217	188230	integrase,transposase	Pandoravirus(20.0%)	60	106069:106128	157859:157874
AZR92225.1|100142_101147_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AZR92226.1|101225_104198_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
AZR92227.1|104200_104758_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
AZR92228.1|104795_105116_-|transposase	transposase	transposase	NA	NA	NA	NA
AZR92229.1|105054_106068_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
106069:106128	attL	GGCTTGTTATGACTGTTTTTTTGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCG	NA	NA	NA	NA
AZR92317.1|106274_107105_+	OXA-1 family oxacillin-hydrolyzing class D beta-lactamase OXA-4	NA	NA	NA	NA	NA
106069:106128	attL	GGCTTGTTATGACTGTTTTTTTGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCG	NA	NA	NA	NA
AZR92230.1|107217_108009_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AZR92318.1|108038_108842_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AZR92231.1|108841_109678_+	APH(6)-I family aminoglycoside O-phosphotransferase	NA	NA	NA	NA	NA
AZR92232.1|109649_110000_-	hypothetical protein	NA	NA	NA	NA	NA
AZR92233.1|109938_110952_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AZR92319.1|111097_111631_+	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
110953:111090	attR	GGCTTGTTATGACTGTTTTTTTGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTT	NA	NA	NA	NA
AZR92234.1|111787_112135_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
110953:111090	attR	GGCTTGTTATGACTGTTTTTTTGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTT	NA	NA	NA	NA
AZR92235.1|112128_112968_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AZR92236.1|113372_114914_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AZR92237.1|115664_116273_+	hypothetical protein	NA	NA	NA	NA	NA
AZR92238.1|116851_117136_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZR92239.1|117138_117495_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZR92240.1|117587_119150_+|transposase	IS66-like element ISAba24 family transposase	transposase	S5VTD3	Leptospira_phage	33.6	2.0e-69
AZR92241.1|120055_120340_+	hypothetical protein	NA	NA	NA	NA	NA
AZR92242.1|120395_120590_+	hypothetical protein	NA	NA	NA	NA	NA
AZR92243.1|120550_122080_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AZR92244.1|122268_123909_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	62.1	8.2e-175
AZR92245.1|123964_124255_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
AZR92246.1|124448_124772_+	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
AZR92247.1|124776_125808_+	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
AZR92248.1|125818_126457_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
AZR92249.1|126461_126827_-	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
AZR92250.1|126830_127643_-	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
AZR92251.1|127743_128769_-|transposase	IS30-like element ISAba125 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.1	1.2e-51
AZR92252.1|128848_129628_-	aminoglycoside O-phosphotransferase APH(3')-VIa	NA	E4ZFP6	Streptococcus_phage	35.1	1.5e-30
AZR92253.1|130126_130966_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AZR92254.1|131370_132912_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AZR92255.1|133242_133899_+	quinolone resistance pentapeptide repeat protein QnrA1	NA	NA	NA	NA	NA
AZR92256.1|134366_135206_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AZR92257.1|135135_135315_-	hypothetical protein	NA	NA	NA	NA	NA
AZR92258.1|135333_135606_+	hypothetical protein	NA	NA	NA	NA	NA
AZR92259.1|135787_136792_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AZR92260.1|137019_138225_+	chromate transporter	NA	NA	NA	NA	NA
AZR92261.1|138235_138541_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AZR92262.1|138573_139563_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AZR92263.1|139559_139796_-	mercury resistance protein	NA	NA	NA	NA	NA
AZR92264.1|139792_140158_-	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
AZR92265.1|140269_140908_-	organomercurial lyase MerB	NA	NA	NA	NA	NA
AZR92266.1|140922_142608_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.9	1.1e-38
AZR92267.1|142679_142955_-	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AZR92268.1|142970_143321_-	mercuric transporter	NA	NA	NA	NA	NA
AZR92269.1|143392_143827_+	mercuric resistance operon regulatory protein	NA	NA	NA	NA	NA
AZR92270.1|143926_144931_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AZR92271.1|145546_145948_+	hypothetical protein	NA	NA	NA	NA	NA
AZR92272.1|146061_146787_+	hypothetical protein	NA	NA	NA	NA	NA
AZR92273.1|146761_146965_-	hypothetical protein	NA	NA	NA	NA	NA
AZR92274.1|146919_151173_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	47.6	1.1e-18
AZR92275.1|151144_151585_+	hypothetical protein	NA	NA	NA	NA	NA
AZR92276.1|151755_152208_+	hypothetical protein	NA	NA	NA	NA	NA
AZR92277.1|152223_152826_-	hypothetical protein	NA	NA	NA	NA	NA
AZR92278.1|153048_153369_+	hypothetical protein	NA	NA	NA	NA	NA
AZR92279.1|153387_153675_+	hypothetical protein	NA	NA	NA	NA	NA
AZR92280.1|153667_154204_+	hypothetical protein	NA	NA	NA	NA	NA
AZR92281.1|154206_155217_+|integrase	integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
157859:157874	attR	TAATTATGATAATTAC	NA	NA	NA	NA
