The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034346	Paenibacillus sp. MBLB1234 chromosome, complete genome	6497679	992114	1003346	6497679		Mollivirus(25.0%)	9	NA	NA
AZS13756.1|992114_993416_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.8	1.2e-19
AZS13757.1|993518_994415_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	33.2	7.9e-39
AZS13758.1|994649_994895_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FJ99	Synechococcus_phage	33.8	5.3e-06
AZS13759.1|994898_995588_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AZS13760.1|995565_997812_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	43.4	5.2e-164
AZS13761.1|997796_999269_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.3	7.3e-50
AZS13762.1|1000020_1001064_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.7	1.2e-70
AZS13763.1|1001063_1001678_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.8	2.2e-24
AZS13764.1|1001798_1003346_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase PurH	NA	Q58MG4	Prochlorococcus_phage	51.3	9.1e-75
>prophage 2
CP034346	Paenibacillus sp. MBLB1234 chromosome, complete genome	6497679	1698775	1723673	6497679	tail,portal,plate	Brevibacillus_phage(30.43%)	31	NA	NA
AZS14221.1|1698775_1700104_+|tail	phage tail sheath protein	tail	A0A0A7RTT5	Clostridium_phage	44.4	1.7e-93
AZS14222.1|1700117_1700585_+|portal	phage portal protein	portal	A0A0A7RVP1	Clostridium_phage	52.0	1.8e-42
AZS14223.1|1700596_1701016_+|portal	phage portal protein	portal	X5JAB6	Clostridium_phage	43.2	1.0e-25
AZS14224.1|1701255_1702557_+	hypothetical protein	NA	S6AVU8	Thermus_phage	33.6	4.2e-41
AZS14225.1|1702684_1703353_+	hypothetical protein	NA	A0A0K2CP22	Brevibacillus_phage	45.7	1.2e-39
AZS14226.1|1703354_1704038_+	LysM peptidoglycan-binding domain-containing protein	NA	S5MUH0	Brevibacillus_phage	44.5	4.0e-51
AZS14227.1|1704053_1705007_+	hypothetical protein	NA	S5MNC9	Brevibacillus_phage	51.6	1.5e-96
AZS14228.1|1705006_1705348_+	DUF2577 domain-containing protein	NA	A0A0A7RTJ2	Clostridium_phage	49.5	8.8e-23
AZS14229.1|1705344_1705743_+	DUF2634 domain-containing protein	NA	A0A0K2CP95	Brevibacillus_phage	48.4	9.9e-26
AZS14230.1|1705735_1706815_+|plate	baseplate J/gp47 family protein	plate	A0A0K2CP27	Brevibacillus_phage	48.3	1.7e-96
AZS14231.1|1706807_1707392_+	DUF2313 domain-containing protein	NA	S5MA71	Brevibacillus_phage	49.7	6.7e-39
AZS14232.1|1707388_1707676_+	ketopantoate hydroxymethyltransferase	NA	NA	NA	NA	NA
AZS14233.1|1707675_1710594_+	hypothetical protein	NA	L0L861	Bacillus_phage	30.9	1.9e-17
AZS14234.1|1710603_1710921_+|portal	phage portal protein	portal	NA	NA	NA	NA
AZS14235.1|1710920_1711064_+	XkdX family protein	NA	NA	NA	NA	NA
AZS14236.1|1711605_1712430_+	hypothetical protein	NA	NA	NA	NA	NA
AZS14237.1|1712435_1712642_+	hypothetical protein	NA	NA	NA	NA	NA
AZS14238.1|1712643_1714107_+|tail	phage tail sheath protein	tail	X5JAJ1	Clostridium_phage	25.7	8.1e-25
AZS14239.1|1714131_1714548_+|portal	phage portal protein	portal	A0A2H4J032	uncultured_Caudovirales_phage	59.5	2.8e-39
AZS14240.1|1714596_1715058_+	hypothetical protein	NA	A0A2H4J883	uncultured_Caudovirales_phage	38.5	6.5e-21
AZS14241.1|1715257_1716913_+	hypothetical protein	NA	NA	NA	NA	NA
AZS14242.1|1716927_1717560_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0N7ACF7	Bacillus_phage	52.6	3.3e-47
AZS18173.1|1717559_1718537_+|portal	phage portal protein	portal	A0A0N6W8H4	Bacillus_phage	47.9	1.0e-79
AZS14243.1|1718526_1718904_+	hypothetical protein	NA	A0A0N7ACD3	Bacillus_phage	28.8	1.1e-05
AZS14244.1|1718896_1719352_+	DUF2634 domain-containing protein	NA	A0A0N7ACH4	Bacillus_phage	43.9	3.9e-26
AZS14245.1|1719351_1720470_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	36.7	4.3e-50
AZS18174.1|1720486_1721050_+	DUF2313 domain-containing protein	NA	A0A0A7RUW8	Clostridium_phage	36.4	4.1e-25
AZS18175.1|1721120_1722290_+	hypothetical protein	NA	NA	NA	NA	NA
AZS14246.1|1722324_1722570_+	hypothetical protein	NA	NA	NA	NA	NA
AZS14247.1|1722587_1723253_+	hypothetical protein	NA	S5MNY5	Brevibacillus_phage	59.4	6.1e-12
AZS14248.1|1723268_1723673_+	hypothetical protein	NA	S6C455	Thermus_phage	63.1	2.5e-37
>prophage 3
CP034346	Paenibacillus sp. MBLB1234 chromosome, complete genome	6497679	1923749	1932103	6497679		Bacillus_virus(83.33%)	6	NA	NA
AZS18188.1|1923749_1924562_+	NUDIX domain-containing protein	NA	G3MA14	Bacillus_virus	42.7	2.5e-36
AZS14379.1|1924777_1925338_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	44.0	4.3e-35
AZS14380.1|1925354_1926854_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	48.6	3.3e-114
AZS14381.1|1926926_1927541_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	45.7	6.8e-50
AZS14382.1|1927559_1928378_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	61.9	7.6e-89
AZS18189.1|1930762_1932103_+	hypothetical protein	NA	G1FGA4	Mycobacterium_phage	41.9	5.9e-06
>prophage 4
CP034346	Paenibacillus sp. MBLB1234 chromosome, complete genome	6497679	2410217	2420132	6497679		Staphylococcus_phage(50.0%)	11	NA	NA
AZS14774.1|2410217_2410652_+	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	46.4	2.0e-19
AZS14775.1|2410737_2410959_-	small acid-soluble spore protein Tlp	NA	NA	NA	NA	NA
AZS14776.1|2411594_2412698_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	39.4	4.5e-60
AZS14777.1|2412730_2413402_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	46.9	4.8e-41
AZS14778.1|2413500_2414733_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	52.0	3.0e-113
AZS14779.1|2414792_2415260_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.6	2.1e-43
AZS14780.1|2415339_2416152_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	30.6	4.2e-07
AZS14781.1|2416120_2416765_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	32.0	5.2e-16
AZS14782.1|2416895_2417603_+	DUF2953 domain-containing protein	NA	NA	NA	NA	NA
AZS14783.1|2417710_2418163_+	sporulation protein YtfJ	NA	NA	NA	NA	NA
AZS14784.1|2418962_2420132_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	31.6	1.8e-06
>prophage 5
CP034346	Paenibacillus sp. MBLB1234 chromosome, complete genome	6497679	3068717	3125794	6497679	portal,tRNA,integrase,tail,terminase,plate	Bacillus_phage(34.21%)	71	3064614:3064630	3119038:3119054
3064614:3064630	attL	ACCCTTGAAGAAATAGG	NA	NA	NA	NA
AZS18281.1|3068717_3069980_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	40.5	1.1e-83
AZS15311.1|3070028_3070733_+	replication protein	NA	NA	NA	NA	NA
AZS15312.1|3071517_3072924_+	amino acid permease	NA	NA	NA	NA	NA
AZS15313.1|3072989_3074864_+	tyrosine decarboxylase	NA	NA	NA	NA	NA
AZS15314.1|3074946_3075771_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AZS15315.1|3075860_3077234_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
AZS15316.1|3077456_3078689_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	38.8	4.4e-72
AZS15317.1|3078704_3079331_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	33.6	7.7e-17
AZS15318.1|3079416_3079707_-	hypothetical protein	NA	NA	NA	NA	NA
AZS15319.1|3079723_3080383_-	hypothetical protein	NA	NA	NA	NA	NA
AZS15320.1|3080427_3080832_-	XRE family transcriptional regulator	NA	S5MNZ4	Brevibacillus_phage	40.9	4.0e-14
AZS15321.1|3080996_3081251_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZS18282.1|3081431_3081746_+	DNA-binding protein	NA	NA	NA	NA	NA
AZS15322.1|3082035_3082344_+	XRE family transcriptional regulator	NA	S5MNZ7	Brevibacillus_phage	50.0	9.7e-13
AZS15323.1|3082349_3082628_+	hypothetical protein	NA	NA	NA	NA	NA
AZS15324.1|3082627_3082915_+	hypothetical protein	NA	NA	NA	NA	NA
AZS18283.1|3082936_3083191_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	59.5	8.2e-18
AZS15325.1|3083765_3084035_+	hypothetical protein	NA	NA	NA	NA	NA
AZS15326.1|3084031_3084361_+	hypothetical protein	NA	NA	NA	NA	NA
AZS15327.1|3084361_3085396_+	hypothetical protein	NA	A6M982	Geobacillus_virus	30.5	1.6e-14
AZS15328.1|3085392_3086580_+	hypothetical protein	NA	NA	NA	NA	NA
AZS15329.1|3086579_3087053_+	hypothetical protein	NA	NA	NA	NA	NA
AZS15330.1|3087004_3089584_+	SMC family ATPase	NA	G3MAB6	Bacillus_virus	20.3	1.6e-23
AZS15331.1|3089580_3089769_+	hypothetical protein	NA	NA	NA	NA	NA
AZS15332.1|3089771_3089999_+	hypothetical protein	NA	NA	NA	NA	NA
AZS15333.1|3089995_3090277_+	hypothetical protein	NA	NA	NA	NA	NA
AZS15334.1|3090290_3091247_+	MarR family transcriptional regulator	NA	S6BFM4	Thermus_phage	49.5	5.5e-22
AZS15335.1|3091224_3091563_+	hypothetical protein	NA	NA	NA	NA	NA
AZS15336.1|3091462_3092956_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	47.9	1.3e-99
AZS15337.1|3093133_3093325_+	hypothetical protein	NA	NA	NA	NA	NA
AZS15338.1|3093462_3093876_+	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	60.9	7.8e-42
AZS15339.1|3093902_3094694_+	hypothetical protein	NA	NA	NA	NA	NA
AZS15340.1|3094767_3095004_+	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	62.2	6.9e-19
AZS15341.1|3095003_3095792_+	HNH endonuclease	NA	A0A2H4JIA5	uncultured_Caudovirales_phage	33.5	7.7e-30
AZS15342.1|3095816_3096188_+	hypothetical protein	NA	NA	NA	NA	NA
AZS15343.1|3096184_3096646_+	ASCH domain-containing protein	NA	A0A068CCC0	Rhizobium_phage	32.1	2.6e-09
AZS15344.1|3096617_3096797_+	hypothetical protein	NA	NA	NA	NA	NA
AZS15345.1|3096892_3097384_+	hypothetical protein	NA	NA	NA	NA	NA
AZS15346.1|3097424_3097622_+	hypothetical protein	NA	NA	NA	NA	NA
AZS15347.1|3097877_3098600_+	hypothetical protein	NA	NA	NA	NA	NA
AZS15348.1|3099153_3099669_+	hypothetical protein	NA	NA	NA	NA	NA
AZS15349.1|3099859_3100396_+	transcriptional regulator	NA	A0A1B1P7B5	Bacillus_phage	54.0	1.7e-49
AZS15350.1|3100392_3101430_+	DNA cytosine methyltransferase	NA	A0A1B1P7C6	Bacillus_phage	60.3	5.6e-121
AZS15351.1|3101564_3101780_+	hypothetical protein	NA	NA	NA	NA	NA
AZS15352.1|3101780_3102416_-	DUF4145 domain-containing protein	NA	M1PSB6	Streptococcus_phage	36.5	1.7e-35
AZS15353.1|3102513_3103392_+|terminase	terminase	terminase	A0A1B1P7C9	Bacillus_phage	44.8	1.2e-34
AZS15354.1|3103384_3104833_+|terminase	terminase B	terminase	A0A1B1P7D5	Bacillus_phage	58.5	3.4e-148
AZS15355.1|3104825_3106322_+|portal	phage portal protein	portal	A0A0A8WI73	Clostridium_phage	51.7	4.0e-152
AZS15356.1|3106325_3107342_+	hypothetical protein	NA	A0A0N7ACI5	Bacillus_phage	45.0	1.3e-74
AZS15357.1|3107600_3108779_+	hypothetical protein	NA	A0A0N7ACY8	Bacillus_phage	43.1	1.6e-71
AZS15358.1|3108804_3109200_+	DUF2190 family protein	NA	A0A0A8WJN5	Clostridium_phage	60.0	5.7e-34
AZS15359.1|3109215_3110280_+	aspartate ammonia-lyase	NA	A0A0N7ACJ3	Bacillus_phage	63.0	1.1e-127
AZS15360.1|3110293_3110650_+	hypothetical protein	NA	A0A0N7ACH0	Bacillus_phage	51.6	1.7e-24
AZS15361.1|3110649_3111039_+	hypothetical protein	NA	NA	NA	NA	NA
AZS15362.1|3111040_3111547_+	hypothetical protein	NA	NA	NA	NA	NA
AZS15363.1|3111543_3112380_+	hypothetical protein	NA	A0A0N7ACG6	Bacillus_phage	45.3	1.7e-67
AZS15364.1|3112389_3112581_+	hypothetical protein	NA	NA	NA	NA	NA
AZS15365.1|3112581_3114039_+|tail	phage tail sheath protein	tail	A0A0N7AEC6	Bacillus_phage	38.6	6.3e-86
AZS15366.1|3114055_3114475_+|portal	phage portal protein	portal	A0A2H4J032	uncultured_Caudovirales_phage	55.6	2.6e-40
AZS15367.1|3114498_3114930_+	hypothetical protein	NA	A0A2H4J883	uncultured_Caudovirales_phage	42.4	8.5e-23
AZS15368.1|3115113_3117663_+	hypothetical protein	NA	NA	NA	NA	NA
AZS15369.1|3117679_3118330_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0N7ACF7	Bacillus_phage	49.7	1.7e-46
AZS15370.1|3118326_3119457_+|portal	phage portal protein	portal	A0A0N6W8H4	Bacillus_phage	45.6	4.1e-85
3119038:3119054	attR	ACCCTTGAAGAAATAGG	NA	NA	NA	NA
AZS15371.1|3119449_3119866_+	hypothetical protein	NA	A0A0A8WFG6	Clostridium_phage	34.1	5.3e-06
AZS15372.1|3119852_3120317_+	DUF2634 domain-containing protein	NA	A0A0N7ACH4	Bacillus_phage	42.3	1.4e-26
AZS15373.1|3120316_3121435_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	37.4	1.6e-49
AZS15374.1|3121427_3122006_+	DUF2313 domain-containing protein	NA	A0A0A7RUW8	Clostridium_phage	36.4	1.6e-24
AZS15375.1|3123362_3124043_+	hypothetical protein	NA	S5MNY5	Brevibacillus_phage	51.6	1.1e-13
AZS15376.1|3124055_3124460_+	hypothetical protein	NA	S6C455	Thermus_phage	65.3	5.7e-37
AZS15377.1|3124674_3124935_+	hypothetical protein	NA	NA	NA	NA	NA
AZS15378.1|3124936_3125794_+	glycoside hydrolase	NA	D0R7H8	Paenibacillus_phage	60.6	6.8e-72
>prophage 6
CP034346	Paenibacillus sp. MBLB1234 chromosome, complete genome	6497679	3859499	3866168	6497679		Bacillus_phage(83.33%)	6	NA	NA
AZS15954.1|3859499_3860594_-	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	32.2	1.4e-29
AZS15955.1|3860583_3861279_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	37.4	2.7e-39
AZS15956.1|3861385_3862447_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	46.7	5.4e-79
AZS15957.1|3862443_3863130_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	66.5	6.0e-79
AZS15958.1|3863155_3864928_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	62.2	5.7e-174
AZS15959.1|3865454_3866168_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	41.7	3.8e-20
>prophage 7
CP034346	Paenibacillus sp. MBLB1234 chromosome, complete genome	6497679	5653698	5686085	6497679	portal,capsid,protease,integrase,tail,holin,terminase,head	uncultured_Caudovirales_phage(29.41%)	39	5650928:5650949	5686090:5686111
5650928:5650949	attL	ATATGGTCAAAATATGGTCACG	NA	NA	NA	NA
AZS18464.1|5653698_5654118_-|holin	holin	holin	D0R7H7	Paenibacillus_phage	58.5	1.1e-35
AZS17380.1|5654170_5654383_-	hypothetical protein	NA	NA	NA	NA	NA
AZS17381.1|5654455_5655013_-	hypothetical protein	NA	NA	NA	NA	NA
AZS17382.1|5655069_5657235_-	hypothetical protein	NA	NA	NA	NA	NA
AZS17383.1|5657248_5657782_-	hypothetical protein	NA	NA	NA	NA	NA
AZS17384.1|5657823_5657967_-	XkdX family protein	NA	NA	NA	NA	NA
AZS17385.1|5658664_5660971_-	hypothetical protein	NA	R4JDZ8	Bacillus_phage	35.7	3.7e-24
AZS17386.1|5660976_5661402_-	hypothetical protein	NA	H6BJ44	Methylophilales_phage	40.8	1.9e-22
AZS17387.1|5661413_5661956_-|tail	phage tail protein	tail	NA	NA	NA	NA
AZS17388.1|5661956_5666480_-|tail	phage tail tape measure protein	tail	Q9G097	Lactococcus_phage	38.1	2.1e-63
AZS17389.1|5666482_5666743_-	hypothetical protein	NA	NA	NA	NA	NA
AZS17390.1|5666757_5667171_-	hypothetical protein	NA	NA	NA	NA	NA
AZS17391.1|5667256_5667784_-	hypothetical protein	NA	NA	NA	NA	NA
AZS17392.1|5667946_5668324_-	hypothetical protein	NA	NA	NA	NA	NA
AZS17393.1|5668316_5668721_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
AZS17394.1|5668720_5669035_-	hypothetical protein	NA	NA	NA	NA	NA
AZS17395.1|5669038_5669599_-	hypothetical protein	NA	NA	NA	NA	NA
AZS17396.1|5669546_5669813_-	hypothetical protein	NA	NA	NA	NA	NA
AZS17397.1|5669890_5671120_-|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
AZS17398.1|5671142_5671769_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	44.0	7.5e-28
AZS17399.1|5671722_5673036_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	47.4	2.5e-86
AZS17400.1|5673051_5674842_-|terminase	terminase large subunit	terminase	A6M948	Geobacillus_virus	39.8	1.7e-109
AZS17401.1|5674822_5675305_-|terminase	phage terminase small subunit P27 family	terminase	Q6DMU4	Streptococcus_phage	31.1	1.4e-10
AZS17402.1|5675436_5675808_-	HNH endonuclease	NA	Q38456	Bacillus_phage	56.2	5.0e-32
AZS17403.1|5675964_5676513_-|integrase	site-specific integrase	integrase	A0A1B0T6D2	Bacillus_phage	63.5	1.9e-59
AZS17404.1|5676847_5677219_-	hypothetical protein	NA	NA	NA	NA	NA
AZS17405.1|5677196_5677385_-	hypothetical protein	NA	NA	NA	NA	NA
AZS17406.1|5677581_5677824_-	hypothetical protein	NA	NA	NA	NA	NA
AZS17407.1|5677820_5678765_-	DUF3102 domain-containing protein	NA	A0A2H4J025	uncultured_Caudovirales_phage	41.6	2.4e-25
AZS17408.1|5678761_5680324_-	hypothetical protein	NA	A0A2H4J308	uncultured_Caudovirales_phage	44.0	9.6e-24
AZS17409.1|5680325_5680700_-	hypothetical protein	NA	A0A2H4J073	uncultured_Caudovirales_phage	44.6	1.2e-17
AZS17410.1|5680705_5681065_-	hypothetical protein	NA	NA	NA	NA	NA
AZS17411.1|5681057_5682044_-	hypothetical protein	NA	I1W658	Staphylococcus_phage	43.4	2.3e-23
AZS17412.1|5682467_5682635_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZS17413.1|5682732_5683047_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
AZS17414.1|5683036_5683252_-	XRE family transcriptional regulator	NA	A0A2H4JBV7	uncultured_Caudovirales_phage	46.2	2.3e-05
AZS17415.1|5683428_5683881_+	XRE family transcriptional regulator	NA	R9TNF4	Paenibacillus_phage	35.5	4.3e-09
AZS17416.1|5683957_5684854_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
AZS17417.1|5684867_5686085_+|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	37.7	4.1e-62
5686090:5686111	attR	ATATGGTCAAAATATGGTCACG	NA	NA	NA	NA
>prophage 8
CP034346	Paenibacillus sp. MBLB1234 chromosome, complete genome	6497679	5774939	5783268	6497679	coat	Escherichia_phage(28.57%)	9	NA	NA
AZS17502.1|5774939_5775812_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.7	2.1e-36
AZS17503.1|5775808_5776831_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	46.5	4.4e-78
AZS17504.1|5776850_5777399_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	46.2	1.8e-41
AZS17505.1|5777417_5778161_-|coat	spore coat protein	coat	G3MA50	Bacillus_virus	45.8	2.3e-52
AZS17506.1|5778181_5779141_-	glycosyltransferase	NA	B9UDL7	Salmonella_phage	35.2	3.4e-48
AZS17507.1|5779143_5780061_-	SDR family oxidoreductase	NA	A0A285PXI2	Cedratvirus	24.7	1.8e-09
AZS17508.1|5780072_5781158_-	CDP-glucose 4,6-dehydratase	NA	NA	NA	NA	NA
AZS17509.1|5781147_5781951_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AZS18467.1|5781963_5783268_-	lipopolysaccharide biosynthesis protein RfbH	NA	A0A218MN59	uncultured_virus	33.3	5.5e-65
