The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034707	Salmonella enterica subsp. enterica serovar Waycross strain RSE24 chromosome, complete genome	4650096	635607	649794	4650096	portal,head,capsid,protease,terminase,tail	uncultured_Caudovirales_phage(90.0%)	15	NA	NA
AZT71109.1|635607_637026_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	67.5	1.9e-132
AZT71110.1|637464_637956_+	hypothetical protein	NA	NA	NA	NA	NA
AZT71111.1|638522_638783_+	hypothetical protein	NA	NA	NA	NA	NA
AZT71112.1|638819_639293_-	hypothetical protein	NA	NA	NA	NA	NA
AZT71113.1|639566_640721_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	67.5	2.1e-148
AZT71114.1|640765_641326_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	84.7	2.2e-87
AZT71115.1|641327_642557_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	86.2	4.8e-212
AZT71116.1|642553_642892_+|head,tail	head-tail adaptor	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	46.8	6.6e-23
AZT71117.1|642884_643175_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	57.7	6.9e-29
AZT71118.1|643175_643619_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	63.9	1.2e-51
AZT71119.1|643759_644116_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	93.2	3.3e-57
AZT71120.1|644099_645761_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	94.6	0.0e+00
AZT71121.1|645848_646697_+	hypothetical protein	NA	NA	NA	NA	NA
AZT71122.1|647316_647823_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
AZT71123.1|647946_649794_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
>prophage 2
CP034707	Salmonella enterica subsp. enterica serovar Waycross strain RSE24 chromosome, complete genome	4650096	1651924	1661096	4650096	tRNA	Enterobacteria_phage(71.43%)	10	NA	NA
AZT71941.1|1651924_1652872_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.0	3.7e-10
AZT71942.1|1652855_1653587_+	ABC transporter permease	NA	NA	NA	NA	NA
AZT71943.1|1653567_1653675_-	protein YohO	NA	NA	NA	NA	NA
AZT71944.1|1653734_1654466_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AZT71945.1|1654688_1656374_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	90.6	2.9e-276
AZT71946.1|1656370_1657090_+	two-component system response regulator YehT	NA	NA	NA	NA	NA
AZT71947.1|1657136_1657604_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	1.8e-74
AZT71948.1|1657660_1658191_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	33.1	5.5e-16
AZT71949.1|1658362_1658821_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	73.2	7.6e-54
AZT71950.1|1659062_1661096_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	4.7e-55
>prophage 3
CP034707	Salmonella enterica subsp. enterica serovar Waycross strain RSE24 chromosome, complete genome	4650096	1819425	1826642	4650096		Morganella_phage(33.33%)	8	NA	NA
AZT72070.1|1819425_1819845_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.7	1.9e-35
AZT72071.1|1819847_1821116_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	5.4e-227
AZT72072.1|1821571_1821784_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
AZT74514.1|1821794_1821983_+	cold-shock protein	NA	NA	NA	NA	NA
AZT72073.1|1822241_1823402_-	porin	NA	Q1MVN1	Enterobacteria_phage	57.1	1.7e-110
AZT72074.1|1824051_1824351_+	hypothetical protein	NA	NA	NA	NA	NA
AZT72075.1|1824442_1825138_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
AZT72076.1|1825211_1826642_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
>prophage 4
CP034707	Salmonella enterica subsp. enterica serovar Waycross strain RSE24 chromosome, complete genome	4650096	2572742	2635113	4650096	integrase,head,portal,holin,tRNA,terminase,tail	Salmonella_phage(31.03%)	73	2579695:2579754	2631066:2631231
AZT72750.1|2572742_2572982_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
AZT72751.1|2573861_2574671_+	cytolethal distending toxin subunit B family protein	NA	A5LH53	Enterobacteria_phage	49.6	7.8e-62
AZT72752.1|2574743_2575121_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AZT72753.1|2575268_2575811_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AZT72754.1|2576003_2576732_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.5	1.2e-61
AZT72755.1|2576748_2577162_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	37.7	5.5e-19
AZT72756.1|2578112_2579237_-	DUF3626 domain-containing protein	NA	NA	NA	NA	NA
2579695:2579754	attL	ATTACATGTTTTCGATGATCGCGTCACCAAACTCTGAACATTTCAGCAGCTTAGCGCCTT	NA	NA	NA	NA
AZT72757.1|2579695_2579908_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	8.7e-21
AZT72758.1|2580161_2580833_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	1.8e-80
AZT72759.1|2580825_2582094_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	96.2	3.6e-239
AZT72760.1|2582096_2582516_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.1	5.0e-36
AZT72761.1|2582687_2582906_-	recombinase family protein	NA	S4TTF2	Salmonella_phage	97.1	6.8e-29
AZT72762.1|2583118_2583841_+	type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
AZT74536.1|2584037_2584340_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	86.6	1.7e-41
AZT72763.1|2584632_2586264_+	DUF302 domain-containing protein	NA	NA	NA	NA	NA
AZT72764.1|2586353_2587466_-	hypothetical protein	NA	NA	NA	NA	NA
AZT72765.1|2587467_2587725_-	hypothetical protein	NA	NA	NA	NA	NA
AZT72766.1|2587785_2588811_-	hypothetical protein	NA	A0A2D2W685	Pectobacterium_phage	46.8	4.7e-19
AZT72767.1|2588915_2592278_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	80.4	0.0e+00
AZT72768.1|2592339_2592987_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.1	9.3e-90
AZT72769.1|2592884_2593622_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	84.6	1.2e-128
AZT72770.1|2593628_2594327_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	75.4	7.9e-103
AZT72771.1|2594336_2594666_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	71.3	7.3e-43
AZT72772.1|2594668_2597764_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.1	1.5e-270
AZT72773.1|2597735_2598074_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
AZT72774.1|2598070_2598466_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	57.3	7.8e-31
AZT72775.1|2598516_2599263_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
AZT72776.1|2599270_2599672_-|tail	phage tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
AZT72777.1|2599668_2600247_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	79.7	8.3e-82
AZT72778.1|2600233_2600611_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	2.0e-28
AZT72779.1|2600621_2600981_-	DNA packaging protein	NA	NA	NA	NA	NA
AZT72780.1|2602120_2602468_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
AZT72781.1|2602480_2603977_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.7	4.3e-98
AZT72782.1|2603966_2605547_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.6	6.2e-188
AZT72783.1|2605543_2605747_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
AZT72784.1|2605730_2607662_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	4.8e-259
AZT72785.1|2607633_2608170_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.7	1.0e-54
AZT72786.1|2608465_2608867_+	inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
AZT72787.1|2609123_2609627_-	hypothetical protein	NA	NA	NA	NA	NA
AZT72788.1|2609729_2610272_-	DUF2514 family protein	NA	NA	NA	NA	NA
AZT72789.1|2610268_2610883_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	92.6	5.5e-108
AZT72790.1|2610882_2611164_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AZT72791.1|2611150_2611540_-	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	69.5	4.5e-39
AZT72792.1|2612548_2612974_-	pertussis toxin	NA	NA	NA	NA	NA
AZT74537.1|2613448_2613811_-	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	69.1	2.4e-31
AZT72793.1|2613956_2615486_+	DUF4041 domain-containing protein	NA	Q5G8X0	Enterobacteria_phage	96.7	2.4e-160
AZT72794.1|2615946_2616507_-	ORF6N domain-containing protein	NA	A0A0P0ZDQ5	Stx2-converting_phage	86.2	8.9e-57
AZT72795.1|2616774_2617446_-	antiterminator	NA	I6PDF8	Cronobacter_phage	57.1	1.2e-63
AZT74538.1|2617629_2617836_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	97.1	2.3e-34
AZT72796.1|2617835_2618438_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
AZT72797.1|2618472_2618721_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
AZT72798.1|2618837_2619071_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
AZT72799.1|2619226_2619493_-	hypothetical protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AZT72800.1|2619591_2620401_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	99.3	2.2e-157
AZT72801.1|2620431_2621181_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	1.6e-138
AZT72802.1|2621183_2622239_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	53.2	4.9e-40
AZT72803.1|2622512_2622887_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	97.6	1.6e-62
AZT72804.1|2622852_2623089_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	98.7	6.7e-38
AZT72805.1|2623192_2623576_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	100.0	1.3e-62
AZT72806.1|2623603_2624005_+	helix-turn-helix domain-containing protein	NA	A0A0M4REM4	Salmonella_phage	100.0	3.1e-67
AZT72807.1|2624615_2624966_+	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	96.6	5.4e-60
AZT72808.1|2625092_2627531_+	exonuclease VIII	NA	H6WRX1	Salmonella_phage	68.1	5.1e-258
AZT72809.1|2627523_2628354_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.0e-104
AZT72810.1|2628389_2628710_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	59.2	1.8e-33
AZT72811.1|2628702_2629035_+	hypothetical protein	NA	S4TNP2	Salmonella_phage	81.8	8.8e-20
AZT72812.1|2629031_2629535_+	Eaa protein	NA	A0A075B8H2	Enterobacteria_phage	92.3	6.0e-36
AZT72813.1|2629584_2629821_+	excisionase	NA	NA	NA	NA	NA
AZT72814.1|2629810_2630953_+|integrase	integrase	integrase	O21929	Phage_21	80.3	8.2e-174
AZT72815.1|2631066_2632317_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
2631066:2631231	attR	ATTACATGTTTTCGATGATCGCGTCACCAAACTCTGAACATTTCAGCAGCTTAGCGCCTTCCATCAGGCGTTCAAAGTCATAGGTCACGGTCTTCGCGGCAATCGCGCCTTCCATACCTTTAACAATCAGATCCGCCGCTTCGAACCACTGCATGTGGCGCAGCAT	NA	NA	NA	NA
AZT72816.1|2632488_2633154_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AZT72817.1|2633150_2633480_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
AZT72818.1|2633491_2633953_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AZT72819.1|2634006_2635113_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 5
CP034707	Salmonella enterica subsp. enterica serovar Waycross strain RSE24 chromosome, complete genome	4650096	4212694	4257185	4650096	tRNA,tail,plate	Burkholderia_phage(42.11%)	43	NA	NA
AZT74103.1|4212694_4213693_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AZT74104.1|4215336_4215852_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
AZT74594.1|4215951_4216161_-	CsbD family protein	NA	NA	NA	NA	NA
AZT74105.1|4216182_4216296_-	hypothetical protein	NA	NA	NA	NA	NA
AZT74106.1|4216292_4217618_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
AZT74107.1|4217796_4218405_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
AZT74108.1|4218513_4218882_-	diacylglycerol kinase	NA	NA	NA	NA	NA
AZT74109.1|4219052_4221473_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
AZT74110.1|4221571_4222444_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
AZT74111.1|4222457_4222955_-	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
AZT74112.1|4223136_4224054_-	maltose operon protein MalM	NA	NA	NA	NA	NA
AZT74113.1|4224217_4225576_-	maltoporin	NA	NA	NA	NA	NA
AZT74114.1|4225664_4226774_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
AZT74115.1|4227135_4228326_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
AZT74116.1|4228457_4230002_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
AZT74117.1|4231225_4232701_+	D-xylose transporter XylE	NA	NA	NA	NA	NA
AZT74118.1|4232745_4233156_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
AZT74119.1|4233298_4235395_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
AZT74120.1|4236127_4236766_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
AZT74595.1|4236829_4237072_-	outer membrane protein	NA	NA	NA	NA	NA
AZT74121.1|4237515_4239165_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AZT74122.1|4239552_4240902_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
AZT74123.1|4241032_4241380_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
AZT74124.1|4241955_4242243_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
AZT74125.1|4242245_4242851_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.4	4.6e-59
AZT74126.1|4242863_4243178_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.2	8.3e-20
AZT74127.1|4243337_4243793_+	hypothetical protein	NA	NA	NA	NA	NA
AZT74128.1|4243789_4243987_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
AZT74129.1|4243976_4245401_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	68.3	3.5e-182
AZT74130.1|4245400_4245925_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.1e-68
AZT74131.1|4245976_4246294_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AZT74132.1|4246253_4246382_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AZT74133.1|4248844_4249798_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	3.9e-36
AZT74134.1|4249797_4250007_+	hypothetical protein	NA	A4JWL2	Burkholderia_virus	60.3	4.4e-17
AZT74135.1|4249994_4251038_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.9	1.0e-77
AZT74136.1|4251047_4251770_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	8.7e-12
AZT74137.1|4251778_4252021_+	hypothetical protein	NA	NA	NA	NA	NA
AZT74138.1|4252096_4252459_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
AZT74139.1|4252455_4253376_+	glycosyltransferase	NA	S5FKN0	Shigella_phage	84.1	7.9e-151
AZT74140.1|4253383_4254931_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	2.9e-49
AZT74141.1|4255094_4255454_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
AZT74142.1|4255444_4256560_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	2.4e-101
AZT74143.1|4256552_4257185_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
>prophage 6
CP034707	Salmonella enterica subsp. enterica serovar Waycross strain RSE24 chromosome, complete genome	4650096	4368249	4420629	4650096	head,holin,capsid,protease,terminase,tail	Cronobacter_phage(72.0%)	58	NA	NA
AZT74214.1|4368249_4368780_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
AZT74215.1|4368789_4370121_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
AZT74216.1|4370187_4371117_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AZT74217.1|4371209_4371695_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AZT74218.1|4371916_4372156_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
AZT74219.1|4372554_4373400_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
AZT74220.1|4373424_4374930_+	glycerol kinase	NA	NA	NA	NA	NA
AZT74221.1|4375041_4376052_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
AZT74222.1|4376148_4376895_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AZT74223.1|4377532_4378129_+	DUF1454 family protein	NA	NA	NA	NA	NA
AZT74224.1|4378241_4379009_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
AZT74225.1|4379100_4379865_-	epimerase	NA	NA	NA	NA	NA
AZT74226.1|4379874_4380204_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
AZT74227.1|4380247_4381123_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
AZT74228.1|4381151_4382174_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
AZT74229.1|4382202_4383204_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
AZT74230.1|4383200_4384244_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
AZT74231.1|4384237_4385773_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
AZT74232.1|4386028_4386988_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
AZT74233.1|4387074_4388667_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
AZT74234.1|4388680_4389031_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AZT74235.1|4389120_4389252_-	CDP-diacylglycerol pyrophosphatase	NA	NA	NA	NA	NA
AZT74236.1|4389267_4389390_-	hypothetical protein	NA	NA	NA	NA	NA
AZT74237.1|4389530_4390253_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZT74238.1|4390315_4391356_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
AZT74239.1|4391365_4392325_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
AZT74240.1|4392335_4393670_-	MFS transporter	NA	NA	NA	NA	NA
AZT74241.1|4393932_4394688_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
AZT74242.1|4394788_4395778_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZT74243.1|4395981_4396944_-	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
AZT74244.1|4397128_4398031_-	cation-efflux pump FieF	NA	NA	NA	NA	NA
AZT74245.1|4398874_4400599_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	62.6	2.5e-174
AZT74246.1|4400606_4401149_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	56.0	7.1e-43
AZT74247.1|4401120_4401843_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	40.3	1.5e-40
AZT74248.1|4401832_4402420_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	56.0	5.9e-59
AZT74249.1|4402419_4404366_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	69.3	2.4e-125
AZT74250.1|4404377_4404971_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	64.3	1.6e-72
AZT74251.1|4404963_4406148_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	69.2	1.5e-154
AZT74252.1|4406140_4406476_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	59.6	5.6e-30
AZT74253.1|4406472_4408587_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	42.0	4.0e-142
AZT74254.1|4408588_4408768_-	hypothetical protein	NA	A5X9I8	Aeromonas_virus	63.0	6.4e-09
AZT74255.1|4408776_4409046_-	hypothetical protein	NA	NA	NA	NA	NA
AZT74256.1|4409042_4409240_-	hypothetical protein	NA	NA	NA	NA	NA
AZT74257.1|4409148_4409532_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	38.5	1.2e-12
AZT74258.1|4409531_4409870_-	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	85.1	2.3e-44
AZT74259.1|4409856_4410168_-|holin	holin	holin	NA	NA	NA	NA
AZT74260.1|4410172_4410628_-	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	52.3	1.5e-38
AZT74261.1|4410631_4411774_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	61.6	1.1e-130
AZT74599.1|4411776_4412433_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	58.9	8.6e-67
AZT74262.1|4412468_4412945_-|tail	phage tail protein	tail	NA	NA	NA	NA
AZT74263.1|4412941_4413415_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	54.3	1.2e-30
AZT74264.1|4413519_4413687_-	hypothetical protein	NA	NA	NA	NA	NA
AZT74265.1|4413725_4414427_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	57.5	6.8e-70
AZT74266.1|4414429_4415452_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	55.4	1.9e-97
AZT74267.1|4415480_4416542_-|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	44.3	2.9e-32
AZT74268.1|4416719_4418531_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	54.5	1.9e-185
AZT74269.1|4419634_4419910_+	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	57.3	4.0e-26
AZT74270.1|4419936_4420629_-	DNA adenine methylase	NA	A0A0M4S5U3	Salmonella_phage	69.5	1.3e-86
>prophage 7
CP034707	Salmonella enterica subsp. enterica serovar Waycross strain RSE24 chromosome, complete genome	4650096	4424623	4432120	4650096	integrase	Salmonella_phage(33.33%)	11	4427153:4427170	4439644:4439661
AZT74274.1|4424623_4425607_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	60.7	1.5e-102
AZT74275.1|4425677_4426067_-	hypothetical protein	NA	NA	NA	NA	NA
AZT74276.1|4426082_4426304_-	hypothetical protein	NA	A0A0M4S6M9	Salmonella_phage	61.2	3.8e-11
AZT74277.1|4426441_4426720_+	hypothetical protein	NA	NA	NA	NA	NA
AZT74278.1|4426941_4427412_-	hypothetical protein	NA	NA	NA	NA	NA
4427153:4427170	attL	TTTCCCGCGTGAACACCA	NA	NA	NA	NA
AZT74279.1|4427428_4427713_-	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	48.9	1.3e-19
AZT74280.1|4427826_4428147_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZT74281.1|4428231_4429215_+|integrase	site-specific integrase	integrase	U5N0A8	Enterobacteria_phage	67.3	1.3e-119
AZT74282.1|4429400_4429901_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
AZT74283.1|4430051_4430750_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
AZT74284.1|4430746_4432120_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
4439644:4439661	attR	TTTCCCGCGTGAACACCA	NA	NA	NA	NA
