The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025736	Salmonella enterica strain FORC_079 chromosome, complete genome	4867164	374323	394743	4867164	plate,tail	Burkholderia_phage(45.0%)	26	NA	NA
AZU05746.1|374323_375052_-	putative cytoplasmic protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
AZU05747.1|375248_375539_-	hypothetical protein	NA	NA	NA	NA	NA
AZU05748.1|375411_375600_-	putative inner membrane protein	NA	NA	NA	NA	NA
AZU05749.1|375787_376243_-	putative cytoplasmic protein	NA	NA	NA	NA	NA
AZU05750.1|376239_376704_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
AZU05751.1|376849_378595_-|tail	putative phage tail fiber protein H	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
AZU05752.1|378597_379230_-|tail	Putative phage tail protein	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
AZU05753.1|379222_380338_-|plate	Phage baseplate	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
AZU05754.1|380328_380688_-|plate	putative bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
AZU05755.1|380851_382390_-	putative inner membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
AZU05756.1|382398_383328_-	Polymyxin resistance protein ArnC, glycosyl transferase	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
AZU05757.1|383324_383687_-	putative phage glucose translocase	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
AZU05758.1|384014_384737_-|plate	Putative phage baseplate component	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
AZU05759.1|384746_385790_-	phage protein D	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
AZU05760.1|385777_385987_-	Putative inner membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
AZU05761.1|385986_386940_-	hypothetical protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
AZU05762.1|386939_389294_-|tail	Phage tail length tape-measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
AZU05763.1|389478_389796_-	hypothetical protein	NA	NA	NA	NA	NA
AZU05764.1|389847_390372_-|tail	Putative phage tail core protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
AZU05765.1|390371_391799_-|tail	Phage tail sheath monomer	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
AZU05766.1|391788_391986_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
AZU05767.1|391982_392438_-	Phage protein	NA	NA	NA	NA	NA
AZU05768.1|392597_392912_-	Putative inner membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
AZU05769.1|392924_393530_-	Phage lysin	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
AZU05770.1|393532_393820_-	Putative inner membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
AZU05771.1|394395_394743_+	putative cytoplasmic protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 2
CP025736	Salmonella enterica strain FORC_079 chromosome, complete genome	4867164	1428613	1437625	4867164		Salmonella_phage(57.14%)	11	NA	NA
AZU06716.1|1428613_1429117_+	Mobile element protein	NA	Q71TF0	Escherichia_phage	100.0	1.5e-95
AZU06717.1|1429127_1429274_-	Fimbriae W protein	NA	NA	NA	NA	NA
AZU06718.1|1430170_1430389_-	Mobile element protein	NA	U5P4I9	Shigella_phage	76.7	2.3e-16
AZU06719.1|1430560_1430719_+	hypothetical protein	NA	A0A1W5PUZ7	Salmonella_phage	67.3	8.4e-13
AZU06720.1|1430775_1432416_-	Putative inner membrane protein	NA	B9UDL6	Salmonella_phage	37.9	8.7e-84
AZU06721.1|1432408_1433335_-	Polymyxin resistance protein ArnC, glycosyl transferase	NA	I1TED8	Salmonella_phage	97.7	3.8e-169
AZU06722.1|1433331_1433607_-	Bactoprenol-linked glucose translocase	NA	I1TED9	Salmonella_phage	100.0	1.2e-43
AZU06723.1|1434561_1434891_-	sensor histidine kinase	NA	NA	NA	NA	NA
AZU06724.1|1435014_1435179_+	cation efflux system protein CusA	NA	NA	NA	NA	NA
AZU06725.1|1435229_1436084_-	Putative HTH-type transcriptional regulator ykgD	NA	NA	NA	NA	NA
AZU06726.1|1436299_1437625_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.5	1.0e-103
>prophage 3
CP025736	Salmonella enterica strain FORC_079 chromosome, complete genome	4867164	1791702	1799861	4867164	protease	Dickeya_phage(14.29%)	7	NA	NA
AZU07058.1|1791702_1792821_+	Macrolide-specific efflux protein MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
AZU07059.1|1792817_1794764_+	Macrolide export ATP-binding/permease protein MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
AZU07060.1|1794893_1795115_-	Cold shock protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AZU07061.1|1795438_1795759_+|protease	ATP-dependent Clp protease adaptor protein ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AZU07062.1|1795789_1798066_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
AZU07063.1|1798206_1798716_+	Mobile element protein	NA	A0A1S5RHE3	Helicobacter_phage	33.9	5.7e-10
AZU07064.1|1799177_1799861_-	Mobile element protein	NA	Q6H9S3	Enterobacteria_phage	33.9	2.9e-17
>prophage 4
CP025736	Salmonella enterica strain FORC_079 chromosome, complete genome	4867164	1850496	1947256	4867164	portal,tail,protease,terminase,lysis,tRNA,holin	Salmonella_phage(43.64%)	103	NA	NA
AZU07107.1|1850496_1851300_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AZU07108.1|1851292_1852615_+	Chromosome partition protein MukF	NA	NA	NA	NA	NA
AZU07109.1|1852595_1853300_+	Chromosome partition protein MukE	NA	NA	NA	NA	NA
AZU07110.1|1853299_1857766_+	Chromosome partition protein MukB	NA	NA	NA	NA	NA
AZU07111.1|1858110_1859952_+	L,D-transpeptidase YcbB	NA	NA	NA	NA	NA
AZU07112.1|1860211_1860760_+	exported protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
AZU07113.1|1860787_1861435_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AZU07114.1|1861496_1862687_-	Aspartate aminotransferase	NA	NA	NA	NA	NA
AZU07115.1|1862871_1863963_-	Outer membrane protein F precursor	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
AZU07116.1|1864252_1864405_+	hypothetical protein	NA	NA	NA	NA	NA
AZU07117.1|1864493_1864613_-|tRNA	Asparaginyl-tRNA synthetase	tRNA	NA	NA	NA	NA
AZU07118.1|1864569_1865970_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
AZU07119.1|1866170_1866632_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AZU07120.1|1866628_1866850_-	hypothetical protein	NA	NA	NA	NA	NA
AZU07121.1|1866948_1868163_+	Threonine dehydratase	NA	NA	NA	NA	NA
AZU07122.1|1868235_1868394_+	hypothetical protein	NA	NA	NA	NA	NA
AZU07123.1|1868407_1869844_+	Putative ion:amino acid symporter	NA	NA	NA	NA	NA
AZU07124.1|1869921_1871124_-	Nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AZU07125.1|1871318_1872611_-	Integrase	NA	S4TSP2	Salmonella_phage	99.8	1.0e-252
AZU07126.1|1872655_1872904_-	Phage excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AZU07127.1|1872944_1873184_-	hypothetical protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
AZU07128.1|1873226_1874336_-	Gifsy-2 prophage RecT	NA	H6WRX0	Salmonella_phage	100.0	7.1e-207
AZU07129.1|1874346_1877232_-	Exodeoxyribonuclease VIII	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
AZU07130.1|1877358_1877595_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	81.1	1.5e-34
AZU07131.1|1877679_1877838_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
AZU07132.1|1878140_1878347_-	Phage CI-like repressor	NA	NA	NA	NA	NA
AZU07133.1|1878670_1878910_+	hypothetical protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
AZU07134.1|1879100_1879250_+	putative DNA-binding protein	NA	H6WRX6	Salmonella_phage	100.0	2.0e-19
AZU07135.1|1879403_1880318_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	2.3e-163
AZU07136.1|1880320_1881070_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AZU07137.1|1881080_1881428_+	putative DNA-binding protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
AZU07138.1|1881424_1881736_+	hypothetical protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
AZU07139.1|1881951_1882104_+	hypothetical protein	NA	NA	NA	NA	NA
AZU07140.1|1882395_1882629_+	DNA-damage-inducible protein I	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
AZU07141.1|1883044_1883647_+	Phage protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
AZU07142.1|1883646_1883853_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
AZU07143.1|1883855_1884467_+	Protein NinG	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
AZU07144.1|1884599_1885397_+	Putative prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
AZU07145.1|1885562_1885781_+	hypothetical protein	NA	NA	NA	NA	NA
AZU07146.1|1886215_1886665_-	hypothetical protein	NA	NA	NA	NA	NA
AZU07147.1|1887025_1887499_-	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	100.0	9.1e-87
AZU07148.1|1887390_1887663_-	hypothetical protein	NA	NA	NA	NA	NA
AZU07149.1|1887981_1888317_+|holin	Phage holin	holin	A0A0M3ULK9	Salmonella_phage	100.0	4.1e-57
AZU07150.1|1888303_1888753_+	Phage lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
AZU07151.1|1888749_1889250_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	76.7	2.3e-56
AZU07152.1|1889457_1889991_+	hypothetical protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
AZU07153.1|1890082_1892086_+|terminase	phage terminase large subunit	terminase	A5LH27	Enterobacteria_phage	73.3	2.1e-281
AZU07154.1|1892082_1892289_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
AZU07155.1|1892285_1893833_+|portal	Phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
AZU07156.1|1893783_1895838_+|protease	Prophage Clp protease-like protein	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
AZU07157.1|1895928_1896252_+	putative RecA/RadA recombinase	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
AZU07158.1|1896244_1896544_+	ATP-binding sugar transporter-like protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
AZU07159.1|1896524_1897091_+|tail	Phage tail completion protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
AZU07160.1|1897087_1897489_+|tail	Phage minor tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
AZU07161.1|1897500_1898250_+|tail	Phage tail assembly	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
AZU07162.1|1898295_1898694_+|tail	Phage minor tail protein	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
AZU07163.1|1898756_1899020_+|tail	Phage minor tail protein	tail	A5LH37	Enterobacteria_phage	46.6	6.8e-15
AZU07164.1|1899000_1902087_+|tail	Phage tail length tape-measure protein 1	tail	A0A291AWX1	Escherichia_phage	62.1	5.0e-266
AZU07165.1|1902083_1902416_+|tail	Phage minor tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
AZU07166.1|1902514_1903012_+	Ail/OmpX	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
AZU07167.1|1903128_1903425_-	superoxide dismutase	NA	Q9MC02	Salmonella_phage	72.2	1.6e-36
AZU07168.1|1903751_1904447_+|tail	Phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
AZU07169.1|1904456_1905194_+|tail	Phage tail assembly protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
AZU07170.1|1905253_1905796_+|tail	Phage tail assembly protein I	tail	K7PH50	Enterobacteria_phage	63.1	6.2e-47
AZU07171.1|1905867_1908315_+|tail	Phage tail fiber protein	tail	Q687E8	Enterobacteria_phage	68.0	0.0e+00
AZU07172.1|1908341_1909217_+|tail	Phage tail fiber protein	tail	K7PKJ2	Enterobacteria_phage	77.1	1.1e-48
AZU07173.1|1909255_1909498_+	hypothetical protein	NA	NA	NA	NA	NA
AZU07174.1|1909551_1911990_+|tail	Phage tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
AZU07175.1|1911989_1912571_+|tail	Phage tail fiber protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
AZU07176.1|1913046_1914015_+	Secreted effector protein	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
AZU07177.1|1914282_1914531_+	Transposase	NA	A0A0P0ZBS5	Stx2-converting_phage	66.7	5.2e-25
AZU07178.1|1914662_1915289_-	Gifsy-2 prophage protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
AZU07179.1|1915270_1915420_+	hypothetical protein	NA	NA	NA	NA	NA
AZU07180.1|1915641_1916328_-	hypothetical protein	NA	NA	NA	NA	NA
AZU07181.1|1916598_1916790_-	Virulence protein msgA	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
AZU07182.1|1917216_1919829_+	Membrane alanine aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
AZU07183.1|1920036_1920834_+	Dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AZU07184.1|1920812_1921046_+	Dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AZU07185.1|1921211_1921754_+	hypothetical protein	NA	NA	NA	NA	NA
AZU07186.1|1921750_1922860_-	Flavodoxin reductases (ferredoxin-NADPH reductases) family 1	NA	NA	NA	NA	NA
AZU07187.1|1922958_1925067_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
AZU07188.1|1925079_1926987_+	ATPase components of ABC transporters with duplicated ATPase domains	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
AZU07189.1|1927052_1928255_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AZU07190.1|1928259_1929900_+	Paraquat-inducible protein B	NA	NA	NA	NA	NA
AZU07191.1|1929896_1930460_+	Paraquat-inducible protein B	NA	NA	NA	NA	NA
AZU07192.1|1930982_1931501_-	3-hydroxyacyl-[acyl-carrier-protein] dehydratase, FabA form	NA	NA	NA	NA	NA
AZU07193.1|1931569_1933330_-|protease	ATP-dependent protease La Type II	protease	NA	NA	NA	NA
AZU07194.1|1933515_1933968_+	Macrodomain Ter protein YcbG	NA	NA	NA	NA	NA
AZU07195.1|1934039_1935116_-	Outer membrane protein A precursor	NA	NA	NA	NA	NA
AZU07196.1|1935448_1935958_-	Cell division inhibitor	NA	NA	NA	NA	NA
AZU07197.1|1936174_1936780_+	DNA transformation protein TfoX	NA	NA	NA	NA	NA
AZU07198.1|1936766_1938920_-	Putative efflux (PET) family inner membrane protein YccS	NA	NA	NA	NA	NA
AZU07199.1|1938938_1939385_-	Inner membrane protein YccF	NA	NA	NA	NA	NA
AZU07200.1|1939508_1941563_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
AZU07201.1|1941598_1942057_-	Methylglyoxal synthase	NA	NA	NA	NA	NA
AZU07202.1|1942151_1942814_-	hypothetical protein	NA	NA	NA	NA	NA
AZU07203.1|1942987_1943401_+	CoA-binding protein	NA	NA	NA	NA	NA
AZU07204.1|1943445_1943763_-	hemimethylated DNA binding protein YccV	NA	NA	NA	NA	NA
AZU07205.1|1943820_1945032_-	LSU m5C1962 methyltransferase RlmI	NA	NA	NA	NA	NA
AZU07206.1|1945246_1945795_+	Protein ybcL precursor	NA	NA	NA	NA	NA
AZU07207.1|1945820_1946600_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZU07208.1|1946648_1946930_+	Acylphosphate phosphohydrolase putative	NA	NA	NA	NA	NA
AZU07209.1|1946926_1947256_-|tRNA	tRNA 2-thiouridine synthesizing protein E	tRNA	NA	NA	NA	NA
>prophage 5
CP025736	Salmonella enterica strain FORC_079 chromosome, complete genome	4867164	2737373	2744182	4867164	tail	Salmonella_phage(28.57%)	12	NA	NA
AZU08000.1|2737373_2738255_-|tail	Phage tail fiber protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
AZU08001.1|2738409_2738673_-	Phage protein	NA	Q9EYD0	Enterobacteria_phage	59.8	9.1e-20
AZU08002.1|2738727_2738916_+	hypothetical protein	NA	NA	NA	NA	NA
AZU08003.1|2738980_2739148_+	lytic enzyme	NA	NA	NA	NA	NA
AZU08004.1|2739404_2739938_-|tail	phage-tail assembly-like protein	tail	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
AZU08005.1|2739991_2740222_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
AZU08006.1|2740252_2740906_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	67.7	7.8e-28
AZU08007.1|2740965_2741820_+	Mobile element protein	NA	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
AZU08008.1|2742193_2742547_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AZU08009.1|2742563_2743439_-	Copper resistance protein D	NA	NA	NA	NA	NA
AZU08010.1|2743439_2743814_-	Copper resistance protein CopC	NA	NA	NA	NA	NA
AZU08011.1|2743951_2744182_+	DNA polymerase III theta subunit	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 6
CP025736	Salmonella enterica strain FORC_079 chromosome, complete genome	4867164	2849002	2856076	4867164		Salmonella_phage(33.33%)	7	NA	NA
AZU08123.1|2849002_2850433_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AZU08124.1|2850506_2851202_-	metal-dependent phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
AZU08125.1|2851293_2851560_-	hypothetical protein	NA	NA	NA	NA	NA
AZU08126.1|2852242_2853439_+	Outer membrane protein C precursor	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
AZU08127.1|2853898_2854111_-	Cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
AZU08128.1|2854565_2855834_-	Error-prone, lesion bypass DNA polymerase V (UmuC)	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
AZU08129.1|2855836_2856076_-	Error-prone repair protein UmuD	NA	I6S1S3	Salmonella_phage	82.3	1.2e-29
>prophage 7
CP025736	Salmonella enterica strain FORC_079 chromosome, complete genome	4867164	2946938	2956104	4867164		Enterobacteria_phage(42.86%)	9	NA	NA
AZU08220.1|2946938_2948018_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
AZU08221.1|2948022_2948796_-	Glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AZU08222.1|2948792_2949785_-	CDP-6-deoxy-delta-3,4-glucoseen reductase-like	NA	NA	NA	NA	NA
AZU08223.1|2949790_2950339_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
AZU08224.1|2950342_2951221_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
AZU08225.1|2951268_2952168_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
AZU08226.1|2952167_2953253_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
AZU08227.1|2953629_2954523_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AZU08228.1|2954700_2956104_-	Colanic acid biosynthesis protein wcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 8
CP025736	Salmonella enterica strain FORC_079 chromosome, complete genome	4867164	3024412	3033583	4867164	tRNA,lysis	Enterobacteria_phage(66.67%)	10	NA	NA
AZU08286.1|3024412_3026446_+|tRNA	Methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
AZU08287.1|3026686_3027145_+	putative lipoprotein yehR	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AZU08288.1|3027424_3027847_+	hypothetical protein	NA	NA	NA	NA	NA
AZU08289.1|3027903_3028371_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AZU08290.1|3028417_3029137_-	Two-component response-regulatory protein YehT	NA	NA	NA	NA	NA
AZU08291.1|3029133_3030819_-|lysis	Autolysis histidine kinase LytS	lysis	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
AZU08292.1|3031041_3031773_+	HTH-type transcriptional regulator mlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AZU08293.1|3031832_3031940_+	membrane protein	NA	NA	NA	NA	NA
AZU08294.1|3031920_3032652_-	Osmoprotectant ABC transporter inner membrane protein YehW	NA	NA	NA	NA	NA
AZU08295.1|3032635_3033583_-	Osmoprotectant ABC transporter ATP-binding subunit YehX	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 9
CP025736	Salmonella enterica strain FORC_079 chromosome, complete genome	4867164	3102925	3120145	4867164	portal,tail	Salmonella_phage(31.25%)	20	NA	NA
AZU08357.1|3102925_3103933_-	Nucleoid-associated protein NdpA	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
AZU08358.1|3104112_3104340_+	hypothetical protein	NA	NA	NA	NA	NA
AZU08359.1|3104371_3106132_+	hydrolase of alkaline phosphatase superfamily	NA	NA	NA	NA	NA
AZU08360.1|3106412_3107084_-|tail	Phage tail fiber assembly protein	tail	Q1MVE7	Enterobacteria_phage	71.3	1.3e-49
AZU08361.1|3107120_3107234_+	virulence protein	NA	S4TND2	Salmonella_phage	83.8	4.7e-10
AZU08362.1|3107572_3108019_+	acyltransferase	NA	A0A193GZ69	Enterobacter_phage	54.1	1.2e-32
AZU08363.1|3107994_3109395_+	O-antigen acetylase	NA	A0A193GZ69	Enterobacter_phage	34.5	2.9e-19
AZU08364.1|3109448_3109814_-	hypothetical protein	NA	A0A0F7LDZ0	Escherichia_phage	50.0	9.1e-26
AZU08365.1|3110269_3110797_-	hypothetical protein	NA	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
AZU08366.1|3110799_3112041_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
AZU08367.1|3112101_3112620_-	Membrane protein related to metalloendopeptidase	NA	Q8SBH9	Shigella_phage	88.0	5.2e-75
AZU08368.1|3112633_3112963_-|portal	Phage portal protein	portal	Q8SBE1	Shigella_phage	94.6	3.9e-36
AZU08369.1|3113259_3114591_+	hypothetical protein	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
AZU08370.1|3114619_3114985_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
AZU08371.1|3115002_3115920_-	Phage antitermination protein Q	NA	A0A1C9IHZ5	Salmonella_phage	97.0	2.0e-175
AZU08372.1|3115999_3116230_-	Phage-related protein	NA	Q8HA92	Salmonella_phage	100.0	5.0e-38
AZU08373.1|3116320_3116917_-	Secreted effector protein	NA	NA	NA	NA	NA
AZU08374.1|3117078_3118578_-	Secreted effector protein	NA	Q9MBL9	Phage_Gifsy-2	85.8	2.2e-49
AZU08375.1|3119002_3119122_-|tail	Phage tail fiber protein	tail	NA	NA	NA	NA
AZU08376.1|3119353_3120145_-|tail	Phage tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 10
CP025736	Salmonella enterica strain FORC_079 chromosome, complete genome	4867164	3471919	3574153	4867164	integrase,portal,tail,terminase,lysis,head,transposase,tRNA,holin,capsid	Salmonella_phage(32.2%)	105	3498775:3498790	3569173:3569188
AZU08693.1|3471919_3472651_-|tRNA	tRNA:Cm32/Um32 methyltransferase	tRNA	NA	NA	NA	NA
AZU08694.1|3472769_3473573_+	Inositol-1-monophosphatase	NA	NA	NA	NA	NA
AZU08695.1|3473717_3474596_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
AZU08696.1|3474777_3475821_+	Anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
AZU08697.1|3475824_3476643_+	Anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
AZU08698.1|3476653_3477667_+	Anaerobic sulfite reductase subunit C	NA	NA	NA	NA	NA
AZU08699.1|3477667_3478654_-	putative membrane protein	NA	NA	NA	NA	NA
AZU08700.1|3478644_3479313_-	DUF1007 domain-containing protein	NA	NA	NA	NA	NA
AZU08701.1|3479408_3480686_+	Stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
AZU08702.1|3480680_3481820_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
AZU08703.1|3482015_3483269_-	Serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
AZU08704.1|3483593_3484784_+	Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase)	NA	NA	NA	NA	NA
AZU08705.1|3484965_3486510_+	Transcriptional activator of cad operon	NA	NA	NA	NA	NA
AZU08706.1|3486870_3488202_+	Lysine/cadaverine antiporter membrane protein CadB	NA	NA	NA	NA	NA
AZU08707.1|3488284_3490429_+	Lysine decarboxylase, inducible	NA	NA	NA	NA	NA
AZU08708.1|3490484_3491945_+	Di/tripeptide permease YjdL	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
AZU08709.1|3491993_3492332_-	Nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
AZU08710.1|3492408_3493746_-	Putative sensory histidine kinase YfhA	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
AZU08711.1|3493742_3494429_-	putative alpha helix protein	NA	NA	NA	NA	NA
AZU08712.1|3494508_3495894_-	Putative sensor-like histidine kinase YfhK	NA	W8CYF6	Bacillus_phage	26.1	1.9e-15
AZU08713.1|3496654_3497164_-	Mobile element protein	NA	A0A1S5RHE3	Helicobacter_phage	33.9	5.7e-10
AZU08714.1|3497300_3501188_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
3498775:3498790	attL	AACGCGGAAATCACCA	NA	NA	NA	NA
AZU08715.1|3501443_3502988_+	Transglycosylase, Slt family	NA	NA	NA	NA	NA
AZU08716.1|3503038_3503590_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
AZU08717.1|3503614_3504250_-	acid phosphatase AphA	NA	NA	NA	NA	NA
AZU08718.1|3504253_3505615_-	PTS system, IIB component / PTS system, IIC component	NA	NA	NA	NA	NA
AZU08719.1|3505625_3506519_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
AZU08720.1|3506634_3507483_+	Sialic acid utilization regulator, RpiR family	NA	NA	NA	NA	NA
AZU08721.1|3507521_3508439_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AZU08722.1|3508460_3509657_-	Putative transmembrane transport protein	NA	NA	NA	NA	NA
AZU08723.1|3509985_3510699_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZU08724.1|3510736_3510997_+	4Fe-4S ferredoxin, iron-sulfur binding	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
AZU08725.1|3511108_3511489_-	Holo-[acyl-carrier protein] synthase	NA	NA	NA	NA	NA
AZU08726.1|3511488_3512220_-	Pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AZU08727.1|3512231_3512960_-	DNA recombination and repair protein RecO	NA	NA	NA	NA	NA
AZU08728.1|3512971_3513877_-	GTP-binding protein Era	NA	NA	NA	NA	NA
AZU08729.1|3513873_3514611_-	Ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	8.0e-21
AZU08730.1|3514827_3515802_-	Signal peptidase I	NA	NA	NA	NA	NA
AZU08731.1|3515818_3517618_-	Translation elongation factor LepA	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
AZU08732.1|3518046_3519054_+	leucine-rich repeat protein	NA	Q9MBM1	Phage_Gifsy-1	98.5	6.3e-162
AZU08733.1|3519086_3519515_+	leucine-rich repeat protein	NA	Q9MBM1	Phage_Gifsy-1	99.3	9.2e-78
AZU08734.1|3521067_3521211_+	Transposase	NA	NA	NA	NA	NA
AZU08735.1|3522346_3522925_-|tail	Phage tail fiber protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
AZU08736.1|3522914_3523739_-|tail	Phage tail fiber protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
AZU08737.1|3523735_3525061_-|tail	Phage tail fiber protein	tail	E5G6P0	Salmonella_phage	49.8	6.4e-69
AZU08738.1|3525176_3525692_+	Hypothetical protein	NA	NA	NA	NA	NA
AZU08739.1|3525660_3526110_-|tail	Phage tail fiber protein	tail	Q687E6	Enterobacteria_phage	83.9	3.6e-48
AZU08740.1|3526163_3526406_-	hypothetical protein	NA	NA	NA	NA	NA
AZU08741.1|3526444_3529807_-|tail	Phage tail fiber protein	tail	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
AZU08742.1|3529868_3530375_-|tail	Phage tail assembly protein I	tail	A5LH42	Enterobacteria_phage	78.6	7.0e-69
AZU08743.1|3530413_3531049_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	84.6	1.9e-111
AZU08744.1|3531157_3531856_-|tail	Phage minor tail protein	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
AZU08745.1|3531865_3532195_-|tail	Phage minor tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
AZU08746.1|3532197_3535293_-|tail	Phage tail length tape-measure protein 1	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
AZU08747.1|3535264_3535537_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	59.3	5.3e-23
AZU08748.1|3535599_3535995_-|tail	Phage minor tail protein	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
AZU08749.1|3536045_3536789_-|tail	Phage tail assembly	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
AZU08750.1|3536799_3537201_-|tail	Phage minor tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
AZU08751.1|3537309_3538440_+|transposase	transposase	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
AZU08752.1|3538488_3539067_-|tail	Phage tail completion protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
AZU08753.1|3539094_3539478_-|capsid	Phage capsid and scaffold	capsid	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
AZU08754.1|3539488_3539848_-|capsid	Phage capsid and scaffold	capsid	NA	NA	NA	NA
AZU08755.1|3539905_3540934_-|capsid	Phage major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
AZU08756.1|3540988_3541336_-	Head decoration protein	NA	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
AZU08757.1|3541348_3542845_-|capsid	Phage capsid and scaffold	capsid	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
AZU08758.1|3542834_3544415_-|portal	Phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
AZU08759.1|3544411_3544615_-|head,tail	Phage head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
AZU08760.1|3544598_3546530_-|terminase	Phage terminase, large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
AZU08761.1|3546501_3547047_-	Terminase small subunit	NA	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
AZU08762.1|3547411_3547735_+	hypothetical protein	NA	NA	NA	NA	NA
AZU08763.1|3547970_3548444_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	93.0	3.2e-71
AZU08764.1|3548440_3548890_-	Phage lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
AZU08765.1|3548876_3549212_-|holin	Phage holin	holin	A0A0M3ULK9	Salmonella_phage	100.0	4.1e-57
AZU08766.1|3549530_3549803_+	hypothetical protein	NA	NA	NA	NA	NA
AZU08767.1|3549802_3550168_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM2	Phage_Gifsy-1	100.0	3.1e-66
AZU08768.1|3550382_3550571_-	hypothetical protein	NA	NA	NA	NA	NA
AZU08769.1|3551077_3551641_-	antirepressor-like protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
AZU08770.1|3551913_3552591_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
AZU08771.1|3552724_3553336_-	Protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
AZU08772.1|3553338_3553545_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	97.1	1.7e-34
AZU08773.1|3553544_3554147_-	Phage protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
AZU08774.1|3554181_3554298_-	Putative bacteriophage protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	7.8e-16
AZU08775.1|3554546_3554780_-	DNA-damage-inducible protein I	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
AZU08776.1|3555022_3555655_-	hypothetical protein	NA	NA	NA	NA	NA
AZU08777.1|3555762_3556461_-	Phage EaA protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
AZU08778.1|3556474_3557170_-	replication protein P	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
AZU08779.1|3557166_3557988_-	hypothetical protein	NA	K7PGT1	Enterobacteria_phage	47.1	5.9e-41
AZU08780.1|3558142_3558292_-	putative DNA-binding protein	NA	H6WRX6	Salmonella_phage	100.0	2.0e-19
AZU08781.1|3558636_3558822_+	hypothetical protein	NA	NA	NA	NA	NA
AZU08782.1|3558818_3559214_+	transcriptional regulator	NA	K7PM35	Enterobacteria_phage	61.4	1.9e-37
AZU08783.1|3559272_3560112_+	Chromosome (plasmid) partitioning protein ParA	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
AZU08784.1|3560622_3561153_+	hypothetical protein	NA	NA	NA	NA	NA
AZU08785.1|3561500_3561617_+	Phage protein	NA	NA	NA	NA	NA
AZU08786.1|3561609_3561768_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
AZU08787.1|3561852_3562140_+	DNA breaking-rejoining protein	NA	H6WRX2	Salmonella_phage	98.9	8.6e-48
AZU08788.1|3562266_3565194_+	Exodeoxyribonuclease VIII	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
AZU08789.1|3565204_3566314_+	Gifsy-2 prophage RecT	NA	H6WRX0	Salmonella_phage	99.5	1.8e-205
AZU08790.1|3566356_3566596_+	hypothetical protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
AZU08791.1|3566898_3568128_-|integrase	Phage integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
AZU08792.1|3568625_3569105_-	Sigma factor RpoE regulatory protein RseC	NA	NA	NA	NA	NA
AZU08793.1|3569101_3570058_-	Sigma factor RpoE negative regulatory protein RseB precursor	NA	NA	NA	NA	NA
3569173:3569188	attR	TGGTGATTTCCGCGTT	NA	NA	NA	NA
AZU08794.1|3570057_3570708_-	Sigma factor RpoE negative regulatory protein RseA	NA	NA	NA	NA	NA
AZU08795.1|3570739_3571315_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
AZU08796.1|3571742_3573362_+	L-aspartate oxidase	NA	NA	NA	NA	NA
AZU08797.1|3573346_3574153_-|tRNA	tRNA (adenine37-N(6))-methyltransferase TrmN6	tRNA	NA	NA	NA	NA
>prophage 11
CP025736	Salmonella enterica strain FORC_079 chromosome, complete genome	4867164	3578724	3636717	4867164	integrase,plate,tail,terminase,head,tRNA,capsid	Cronobacter_phage(61.76%)	54	3599348:3599363	3628725:3628740
AZU08803.1|3578724_3579762_-|tRNA	putative tRNA/rRNA methyltransferase yfiF	tRNA	NA	NA	NA	NA
AZU08804.1|3579965_3580385_+	Thioredoxin 2	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
AZU08805.1|3580457_3581138_+	hypothetical protein	NA	NA	NA	NA	NA
AZU08806.1|3581191_3583852_+	Protein acetyltransferase	NA	NA	NA	NA	NA
AZU08807.1|3583966_3585322_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AZU08808.1|3585366_3585690_+	Putative outer membrane lipoprotein	NA	NA	NA	NA	NA
AZU08809.1|3585686_3586988_-	Alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	30.4	6.9e-44
AZU08810.1|3587091_3587547_-	hypothetical protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
AZU08811.1|3593427_3596001_-	ClpB protein	NA	H6X3M6	Enterobacteria_phage	35.6	9.0e-128
AZU08812.1|3596130_3596862_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AZU08813.1|3596858_3597839_-	Ribosomal large subunit pseudouridine synthase D	NA	NA	NA	NA	NA
AZU08814.1|3597970_3598708_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AZU08815.1|3598979_3599318_+	Ribosome hibernation protein YfiA	NA	NA	NA	NA	NA
3599348:3599363	attL	CCTTCGGGCGCGTTTT	NA	NA	NA	NA
AZU08816.1|3599688_3599862_+	hypothetical protein	NA	NA	NA	NA	NA
AZU08817.1|3599997_3601470_-	hypothetical protein	NA	NA	NA	NA	NA
AZU08818.1|3602587_3604291_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.9e-223
AZU08819.1|3604290_3604836_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
AZU08820.1|3604807_3605533_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
AZU08821.1|3605522_3606053_-	hypothetical protein	NA	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
AZU08822.1|3606055_3608068_-	hypothetical protein	NA	F1BUK3	Cronobacter_phage	81.2	2.1e-148
AZU08823.1|3608077_3608665_-|tail	Bacteriophage P2-related tail formation protein	tail	F1BUK5	Cronobacter_phage	82.1	1.1e-89
AZU08824.1|3608657_3609842_-|plate	Phage baseplate	plate	F1BUK6	Cronobacter_phage	78.4	1.1e-178
AZU08825.1|3609838_3610168_-	hypothetical protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
AZU08826.1|3610164_3612132_-|tail	Phage-related tail protein	tail	F1BUK9	Cronobacter_phage	70.7	4.3e-271
AZU08827.1|3612319_3612577_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.3e-20
AZU08828.1|3612723_3613056_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	69.1	9.7e-35
AZU08829.1|3613055_3613397_-	hypothetical protein	NA	F1BUL3	Cronobacter_phage	93.1	7.6e-51
AZU08830.1|3613393_3613690_-	Holin	NA	C7BGD7	Burkholderia_phage	48.2	2.4e-16
AZU08831.1|3613702_3614158_-	hypothetical protein	NA	F1BUL4	Cronobacter_phage	70.9	2.3e-58
AZU08832.1|3614154_3615282_-	Topoisomerase IA	NA	F1BUL5	Cronobacter_phage	83.5	2.1e-174
AZU08833.1|3615278_3615983_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.9	1.8e-70
AZU08834.1|3615979_3616462_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
AZU08835.1|3616458_3616911_-|head	phage head completion protein (GPL)	head	F1BUL8	Cronobacter_phage	64.7	1.2e-48
AZU08836.1|3617009_3617708_-|terminase	Phage terminase, endonuclease subunit	terminase	F1BUM0	Cronobacter_phage	52.6	3.6e-63
AZU08837.1|3617719_3618748_-|capsid	Phage major capsid protein	capsid	F1BUM2	Cronobacter_phage	71.6	3.7e-133
AZU08838.1|3618782_3619772_-|capsid	Phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.3	2.5e-46
AZU08839.1|3619829_3621614_+|terminase	Phage terminase, ATPase subunit	terminase	F1BUM5	Cronobacter_phage	69.5	1.9e-246
AZU08840.1|3621610_3622630_+	Membrane protein related to metalloendopeptidase	NA	F1BUM7	Cronobacter_phage	68.1	1.1e-134
AZU08841.1|3622683_3622953_+	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	78.4	5.1e-34
AZU08842.1|3622980_3625638_-	Phage-related protein	NA	A0A077K8T2	Ralstonia_phage	47.3	7.9e-244
AZU08843.1|3625676_3625841_-	hypothetical protein	NA	NA	NA	NA	NA
AZU08844.1|3625897_3626467_-	hypothetical protein	NA	K7PLW7	Enterobacteria_phage	46.3	3.4e-43
AZU08845.1|3626476_3626809_-	hypothetical protein	NA	NA	NA	NA	NA
AZU08846.1|3626834_3627173_-	phage regulatory protein	NA	NA	NA	NA	NA
AZU08847.1|3627270_3627576_+	XRE family transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	47.5	1.6e-15
AZU08848.1|3627615_3628635_+|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.2	1.4e-108
AZU08849.1|3628945_3630106_+	Chorismate mutase I / Prephenate dehydratase	NA	NA	NA	NA	NA
3628725:3628740	attR	CCTTCGGGCGCGTTTT	NA	NA	NA	NA
AZU08850.1|3630066_3630975_-	hypothetical protein	NA	NA	NA	NA	NA
AZU08851.1|3631032_3632154_-	Chorismate mutase I / Cyclohexadienyl dehydrogenase	NA	NA	NA	NA	NA
AZU08852.1|3632163_3633234_-	2-keto-3-deoxy-D-arabino-heptulosonate-7- phosphate synthase I alpha	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
AZU08853.1|3633673_3634192_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AZU08854.1|3634184_3635405_+	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
AZU08855.1|3635561_3635909_-	LSU ribosomal protein L19p	NA	NA	NA	NA	NA
AZU08856.1|3635949_3636717_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 12
CP025736	Salmonella enterica strain FORC_079 chromosome, complete genome	4867164	3665403	3699828	4867164	integrase,plate,tail,terminase,head,capsid	Salmonella_phage(95.12%)	42	3657623:3657637	3704401:3704415
3657623:3657637	attL	GTCACCGCCATCACC	NA	NA	NA	NA
AZU08878.1|3665403_3666504_-	late control protein D	NA	E5G6Q3	Salmonella_phage	100.0	2.6e-201
AZU08879.1|3666500_3666986_-|tail	Phage tail protein	tail	E5G6Q2	Salmonella_phage	100.0	6.7e-77
AZU08880.1|3666982_3669790_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.8	0.0e+00
AZU08881.1|3669916_3670219_-	Tail protein	NA	E5G6P9	Salmonella_phage	99.0	1.6e-44
AZU08882.1|3670273_3670789_-|tail	Phage major tail tube protein	tail	E5G6P8	Salmonella_phage	100.0	9.3e-93
AZU08883.1|3670798_3671971_-|tail	Phage tail sheath monomer	tail	E5G6P7	Salmonella_phage	100.0	8.9e-224
AZU08884.1|3672073_3672298_-	Hin recombinase	NA	E5G6P5	Salmonella_phage	100.0	1.5e-34
AZU08885.1|3673167_3673743_-|tail	Phage tail fiber protein	tail	E5G6P1	Salmonella_phage	100.0	4.3e-107
AZU08886.1|3673742_3675596_-|tail	Phage tail fiber protein	tail	E5G6P0	Salmonella_phage	99.8	0.0e+00
AZU08887.1|3675592_3676198_-|tail	Phage tail fiber protein	tail	E5G6N9	Salmonella_phage	99.5	1.1e-116
AZU08888.1|3676190_3677099_-|plate	Baseplate assembly protein J	plate	E5G6N8	Salmonella_phage	100.0	5.4e-160
AZU08889.1|3677085_3677445_-|plate	Phage baseplate assembly protein	plate	E5G6N7	Salmonella_phage	100.0	1.1e-60
AZU08890.1|3677441_3678020_-|plate	Baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	100.0	1.4e-108
AZU08891.1|3678097_3678949_+	hypothetical protein	NA	E5G6N5	Salmonella_phage	100.0	2.8e-163
AZU08892.1|3678950_3679397_-	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	99.3	2.3e-71
AZU08893.1|3679389_3679821_-|tail	Phage tail protein	tail	E5G6N3	Salmonella_phage	100.0	1.7e-76
AZU08894.1|3679916_3680345_-	Phage spanin Rz	NA	E5G6N2	Salmonella_phage	100.0	2.3e-68
AZU08895.1|3680341_3680857_-	Phage lysin	NA	E5G6N1	Salmonella_phage	99.4	1.2e-95
AZU08896.1|3680837_3681053_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
AZU08897.1|3681056_3681260_-|tail	Phage tail X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AZU08898.1|3681259_3681724_-|head	Phage head completion-stabilization protein	head	E5G6M8	Salmonella_phage	99.4	3.8e-85
AZU08899.1|3681817_3682468_-|terminase	Phage terminase, endonuclease subunit	terminase	E5G6M7	Salmonella_phage	100.0	4.9e-115
AZU08900.1|3682471_3683533_-|capsid	Phage major capsid protein	capsid	E5G6M6	Salmonella_phage	100.0	2.1e-195
AZU08901.1|3683549_3684383_-|capsid	Phage capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
AZU08902.1|3684573_3686292_+|terminase	Phage terminase, ATPase subunit	terminase	E5G6M4	Salmonella_phage	100.0	0.0e+00
AZU08903.1|3686291_3687332_+|capsid	Phage capsid and scaffold	capsid	E5G6M3	Salmonella_phage	100.0	5.5e-201
AZU08904.1|3687435_3689100_-	abortive infection phage resistance protein	NA	E5G6M2	Salmonella_phage	99.8	0.0e+00
AZU08905.1|3689413_3689602_-	Phage protein	NA	NA	NA	NA	NA
AZU08906.1|3690204_3690438_-	hypothetical protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AZU08907.1|3690448_3690637_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
AZU08908.1|3690789_3693213_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	90.7	0.0e+00
AZU08909.1|3693209_3694070_-	Methyl-directed repair DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	4.5e-132
AZU08910.1|3694066_3694651_-	Putative exonuclease	NA	A0A1S6L012	Salmonella_phage	72.7	9.0e-76
AZU08911.1|3694647_3694875_-	putative Zinc-finger containing protein	NA	A0A1S6L007	Salmonella_phage	93.3	3.0e-35
AZU08912.1|3694874_3695108_-	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	97.4	1.1e-32
AZU08913.1|3695175_3695427_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	98.8	2.9e-39
AZU08914.1|3695688_3696198_-	Regulatory protein CII	NA	A0A1S6L008	Salmonella_phage	99.4	3.6e-89
AZU08915.1|3696230_3696473_-	Phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	100.0	1.1e-38
AZU08916.1|3696592_3697225_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	100.0	1.1e-116
AZU08917.1|3697354_3698254_+|integrase	integrase	integrase	A0A1S6L016	Salmonella_phage	100.0	4.5e-175
AZU08918.1|3698582_3699647_+|integrase	Phage integrase, Phage P4-associated	integrase	A0A1B5FPC6	Escherichia_phage	62.5	1.6e-118
AZU08919.1|3699660_3699828_+|integrase	integrase-like protein	integrase	A0A1B5FPC6	Escherichia_phage	61.9	1.1e-07
3704401:3704415	attR	GTCACCGCCATCACC	NA	NA	NA	NA
>prophage 1
CP025737	Salmonella enterica strain FORC_079 plasmid pFORC79_2, complete sequence	99333	52909	75206	99333	integrase,transposase	Escherichia_phage(18.18%)	22	63371:63430	70999:71201
AZU10111.1|52909_53392_+|transposase	TniA putative transposase	transposase	NA	NA	NA	NA
AZU10112.1|53394_54255_+	TniB NTP-binding protein	NA	NA	NA	NA	NA
AZU10113.1|54305_55850_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
AZU10114.1|55981_57496_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.4	1.2e-15
AZU10115.1|57482_58268_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	3.3e-33
AZU10116.1|58443_58944_-	acetyltransferase	NA	NA	NA	NA	NA
AZU10117.1|59071_59911_-	hypothetical protein	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AZU10118.1|59904_60252_-	hypothetical protein	NA	NA	NA	NA	NA
AZU10119.1|60415_61207_-	Spectinomycin 9-O-adenylyltransferase	NA	NA	NA	NA	NA
AZU10120.1|61319_62195_-	OXA-1 family class D beta-lactamase	NA	NA	NA	NA	NA
AZU10121.1|62356_63370_+	hypothetical protein	NA	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
63371:63430	attL	GGCAGCGCAAGTCAATCCTGGCGGATTCACTACCCCTGCGCGAAGGCCATCGGTGCCGCA	NA	NA	NA	NA
AZU10122.1|63972_64380_-	DfrA18/DfrA19 family trimethoprim-resistant dihydrofolate reductase	NA	NA	NA	NA	NA
AZU10123.1|64541_65042_-	hypothetical protein	NA	A0A1V0SB21	Catovirus	31.7	3.3e-10
AZU10124.1|65307_66849_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AZU10125.1|67253_68093_-	Dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AZU10126.1|68086_68434_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AZU10127.1|68590_69223_-	Acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
AZU10128.1|69305_69902_-	aminoglycoside-2''-adenylyltransferase	NA	NA	NA	NA	NA
AZU10129.1|69984_70998_+|integrase	integrase/recombinase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AZU10130.1|71350_71551_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
70999:71201	attR	GGCAGCGCAAGTCAATCCTGGCGGATTCACTACCCCTGCGCGAAGGCCATCGGTGCCGCATCGAACGGCCGGTTGCGGAAAGTCCTCCCTGCGTCCGCTGATGGCCGGCAGCAGCCCGTCGTTGCCTGATGGATCCAACCCCTCCGCTGCTATAGTGCAGTCGGCTTCTGACGTTCAGTGCAGCCGTCTTCTGAAAACGACAA	NA	NA	NA	NA
AZU10131.1|71676_72237_+	Transposon Tn21 resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AZU10132.1|72239_75206_+|transposase	TnpA transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
