The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025334	Brevibacterium aurantiacum strain SMQ-1420 chromosome, complete genome	4328723	542552	626763	4328723	transposase	Bacillus_virus(25.0%)	57	NA	NA
AZT96002.1|542552_543827_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	70.5	8.9e-169
AZT96003.1|544026_546123_+	C4-dicarboxylate ABC transporter permease	NA	NA	NA	NA	NA
AZT96004.1|546139_547132_+	C4-dicarboxylate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZT96005.1|547266_549105_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
AZT96006.1|549313_549511_-	hypothetical protein	NA	NA	NA	NA	NA
AZT96007.1|549754_551116_-	M18 family aminopeptidase	NA	NA	NA	NA	NA
AZT96008.1|551274_552807_+	hypothetical protein	NA	NA	NA	NA	NA
AZT96009.1|552991_554938_-	peptidase M13	NA	E3T4I7	Cafeteria_roenbergensis_virus	31.8	5.8e-87
AZT96010.1|555044_555560_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
AZT96011.1|555593_556241_+	copper resistance protein CopC	NA	NA	NA	NA	NA
AZT96012.1|557749_558175_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZT96013.1|558374_559358_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
AZT96014.1|559386_560238_-	hypothetical protein	NA	NA	NA	NA	NA
AZT98996.1|560280_561234_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZT96015.1|561311_563069_+	succinate dehydrogenase	NA	NA	NA	NA	NA
AZT96016.1|563107_563482_-	hypothetical protein	NA	NA	NA	NA	NA
AZT96017.1|563584_563785_-	hypothetical protein	NA	NA	NA	NA	NA
AZT96018.1|563803_564442_+	hypothetical protein	NA	NA	NA	NA	NA
AZT96019.1|564498_565170_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZT96020.1|565319_566471_+	MFS transporter	NA	NA	NA	NA	NA
AZT96021.1|566578_567904_+	AAA family ATPase	NA	G3MBE0	Bacillus_virus	38.1	2.9e-74
AZT96022.1|567992_569702_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
AZT96023.1|570177_571365_+	chloramphenicol efflux pump	NA	NA	NA	NA	NA
AZT98997.1|571448_572687_-	MFS transporter	NA	NA	NA	NA	NA
AZT96024.1|572932_573979_+	transcriptional regulator	NA	NA	NA	NA	NA
AZT96025.1|574093_574552_-	hypothetical protein	NA	NA	NA	NA	NA
AZT96026.1|575054_575387_+	ferredoxin family protein	NA	NA	NA	NA	NA
AZT96027.1|575415_577056_-	phosphoglucomutase, alpha-D-glucose phosphate-specific	NA	NA	NA	NA	NA
AZT96028.1|577164_577491_-	sulfurtransferase	NA	NA	NA	NA	NA
AZT96029.1|577712_578513_+	general stress protein	NA	NA	NA	NA	NA
AZT96030.1|578586_579792_+	FAD-dependent pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
AZT96031.1|579862_580720_+	ABC transporter permease	NA	NA	NA	NA	NA
AZT96032.1|580712_581516_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AZT96033.1|581595_581802_+	hypothetical protein	NA	NA	NA	NA	NA
AZT96034.1|581988_582516_+	hypothetical protein	NA	NA	NA	NA	NA
AZT96035.1|582572_583664_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AZT96036.1|583898_585740_-	transcriptional regulator	NA	NA	NA	NA	NA
AZT96037.1|585957_587955_-	acetoacetate--CoA ligase	NA	NA	NA	NA	NA
AZT96038.1|588149_589409_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HFY9	Paramecium_bursaria_Chlorella_virus	25.9	1.0e-23
AZT98998.1|589795_590902_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	28.4	5.4e-29
AZT96039.1|590910_592794_-	glycosyltransferase	NA	NA	NA	NA	NA
AZT96040.1|593139_594975_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	28.9	2.0e-20
AZT96041.1|594974_596012_+	hypothetical protein	NA	NA	NA	NA	NA
AZT98999.1|595654_597268_+	hypothetical protein	NA	NA	NA	NA	NA
AZT96042.1|597264_599004_+	glycosyl transferase family 1	NA	NA	NA	NA	NA
AZT96043.1|599000_599882_+	phosphate ABC transporter permease	NA	NA	NA	NA	NA
AZT96044.1|599868_601176_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.5	9.9e-06
AZT96045.1|601954_604291_+	hypothetical protein	NA	NA	NA	NA	NA
AZT96046.1|604274_608099_+	hypothetical protein	NA	NA	NA	NA	NA
AZT96047.1|608674_609742_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZT99000.1|610592_612014_+|transposase	IS481 family transposase ISAar27	transposase	NA	NA	NA	NA
AZT96048.1|615657_616989_+	hypothetical protein	NA	NA	NA	NA	NA
AZT96049.1|619967_620186_+	hypothetical protein	NA	NA	NA	NA	NA
AZT96050.1|620732_620930_+	hypothetical protein	NA	NA	NA	NA	NA
AZT96051.1|621281_623063_+	hypothetical protein	NA	NA	NA	NA	NA
AZT96052.1|623758_625345_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
AZT96053.1|625437_626763_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	67.3	4.1e-169
>prophage 2
CP025334	Brevibacterium aurantiacum strain SMQ-1420 chromosome, complete genome	4328723	1222103	1256654	4328723	transposase	Mycobacterium_phage(20.0%)	32	NA	NA
AZT96532.1|1222103_1223414_-|transposase	ISL3 family transposase ISBli1	transposase	A0A2H4PDF8	Mycobacterium_phage	67.8	3.5e-168
AZT96533.1|1223547_1224615_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZT96534.1|1225157_1226432_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	70.5	8.9e-169
AZT96535.1|1226585_1227152_+	hypothetical protein	NA	NA	NA	NA	NA
AZT96536.1|1227406_1227808_-	heme-binding protein	NA	NA	NA	NA	NA
AZT96537.1|1227837_1228614_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AZT96538.1|1228714_1229329_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZT96539.1|1229458_1229815_-	hypothetical protein	NA	NA	NA	NA	NA
AZT96540.1|1230185_1231364_+	hypothetical protein	NA	NA	NA	NA	NA
AZT96541.1|1231554_1232136_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	38.8	5.7e-22
AZT96542.1|1232538_1233333_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZT96543.1|1233535_1234927_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
AZT96544.1|1235822_1236248_+	hypothetical protein	NA	NA	NA	NA	NA
AZT96545.1|1236498_1237053_+	copper resistance protein CopC	NA	NA	NA	NA	NA
AZT96546.1|1237108_1237696_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
AZT96547.1|1237692_1238913_+	peroxidase	NA	NA	NA	NA	NA
AZT96548.1|1238935_1240369_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
AZT96549.1|1241053_1241875_-	hypothetical protein	NA	G3M9Y6	Bacillus_virus	27.7	1.2e-06
AZT96550.1|1241894_1242371_+	hypothetical protein	NA	A0A1B3AZE5	Gordonia_phage	59.0	4.5e-17
AZT99051.1|1242444_1243857_-	hypothetical protein	NA	A0A1V0SK38	Klosneuvirus	30.6	1.0e-48
AZT96551.1|1244061_1244634_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
AZT96552.1|1244677_1245703_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	66.6	4.7e-120
AZT96553.1|1245733_1247890_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	49.5	8.7e-201
AZT96554.1|1247886_1248372_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.5	5.1e-16
AZT96555.1|1248546_1248795_+	hypothetical protein	NA	NA	NA	NA	NA
AZT96556.1|1248910_1249840_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZT96557.1|1249836_1250577_+	metal ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	32.4	1.8e-17
AZT96558.1|1250573_1251467_+	metal ABC transporter permease	NA	NA	NA	NA	NA
AZT96559.1|1251430_1252114_+	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
AZT96560.1|1252132_1252819_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
AZT96561.1|1252893_1254435_-	hypothetical protein	NA	NA	NA	NA	NA
AZT96562.1|1254974_1256654_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
>prophage 3
CP025334	Brevibacterium aurantiacum strain SMQ-1420 chromosome, complete genome	4328723	1262700	1294836	4328723	transposase,integrase	Corynebacterium_phage(16.67%)	26	1271161:1271185	1275873:1275897
AZT96569.1|1262700_1263975_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	70.5	8.9e-169
AZT99052.1|1265329_1266724_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
AZT96570.1|1267941_1268688_+	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	29.2	2.1e-05
AZT96571.1|1269258_1269978_+	hypothetical protein	NA	NA	NA	NA	NA
AZT96572.1|1269955_1270498_+	hypothetical protein	NA	NA	NA	NA	NA
1271161:1271185	attL	GGGACTGCTGAAGGTTTGGTTGACT	NA	NA	NA	NA
AZT96573.1|1271220_1271523_+	hypothetical protein	NA	NA	NA	NA	NA
AZT96574.1|1271519_1272260_+	hypothetical protein	NA	A0A1B1P773	Bacillus_phage	31.2	1.7e-15
AZT99053.1|1272289_1273378_+|integrase	integrase	integrase	NA	NA	NA	NA
AZT96575.1|1273340_1275314_+|integrase	integrase	integrase	K7P7R5	Enterobacteria_phage	27.5	5.5e-08
AZT96576.1|1275310_1275601_+	hypothetical protein	NA	NA	NA	NA	NA
AZT96577.1|1276255_1276750_-	hypothetical protein	NA	NA	NA	NA	NA
1275873:1275897	attR	AGTCAACCAAACCTTCAGCAGTCCC	NA	NA	NA	NA
AZT99054.1|1276838_1277417_-	resolvase	NA	M9Q1K0	Clostridium_phage	36.1	1.4e-20
AZT96578.1|1278098_1278557_+	hypothetical protein	NA	NA	NA	NA	NA
AZT96579.1|1278538_1279411_+	hypothetical protein	NA	NA	NA	NA	NA
AZT99055.1|1279496_1280630_+	hypothetical protein	NA	NA	NA	NA	NA
AZT96580.1|1280641_1281316_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	4.4e-26
AZT96581.1|1281308_1282505_+	ABC transporter permease	NA	NA	NA	NA	NA
AZT96582.1|1282903_1283194_-	hypothetical protein	NA	NA	NA	NA	NA
AZT96583.1|1284440_1285991_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AZT96584.1|1285987_1286734_+	ATP-binding protein	NA	NA	NA	NA	NA
AZT96585.1|1286845_1287166_-	hypothetical protein	NA	NA	NA	NA	NA
AZT96586.1|1287425_1287872_+	hypothetical protein	NA	NA	NA	NA	NA
AZT96587.1|1288641_1289298_-	hypothetical protein	NA	NA	NA	NA	NA
AZT96588.1|1290483_1290906_-	hypothetical protein	NA	NA	NA	NA	NA
AZT96589.1|1291755_1292280_+	hypothetical protein	NA	NA	NA	NA	NA
AZT96590.1|1293282_1294836_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
>prophage 4
CP025334	Brevibacterium aurantiacum strain SMQ-1420 chromosome, complete genome	4328723	1751298	1762955	4328723	transposase,integrase	Mycobacterium_phage(50.0%)	10	1752757:1752784	1756148:1756175
AZT96954.1|1751298_1752600_-|transposase	ISL3-like element ISAar42 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	71.7	4.9e-183
1752757:1752784	attL	GATTATGCCGAGGTTTTCGTTAACCCGA	NA	NA	NA	NA
AZT96955.1|1752903_1754106_+|integrase	integrase	integrase	NA	NA	NA	NA
AZT96956.1|1754102_1755059_+|integrase	integrase	integrase	NA	NA	NA	NA
AZT96957.1|1755055_1756081_+|integrase	integrase	integrase	NA	NA	NA	NA
AZT96958.1|1756551_1757717_-|transposase	IS3-like element ISAar24 family transposase	transposase	U5P429	Shigella_phage	37.2	5.5e-40
1756148:1756175	attR	TCGGGTTAACGAAAACCTCGGCATAATC	NA	NA	NA	NA
AZT96959.1|1757905_1758748_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZT96960.1|1758762_1759794_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZT96961.1|1759783_1760848_+	iron ABC transporter permease	NA	NA	NA	NA	NA
AZT96962.1|1760844_1761621_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	33.0	4.8e-16
AZT96963.1|1761644_1762955_-|transposase	ISL3 family transposase ISAar39	transposase	A0A2H4PDF8	Mycobacterium_phage	64.8	7.2e-166
>prophage 5
CP025334	Brevibacterium aurantiacum strain SMQ-1420 chromosome, complete genome	4328723	3363838	3409641	4328723	transposase,tRNA,protease	Klosneuvirus(25.0%)	43	NA	NA
AZT98219.1|3363838_3365560_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	40.3	1.2e-96
AZT98220.1|3365784_3366846_-	hypothetical protein	NA	NA	NA	NA	NA
AZT98221.1|3367192_3368173_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	39.6	1.1e-44
AZT98222.1|3368172_3368637_-	DUF4190 domain-containing protein	NA	NA	NA	NA	NA
AZT98223.1|3368725_3369190_-	DUF4190 domain-containing protein	NA	NA	NA	NA	NA
AZT98224.1|3369367_3370009_-	DUF4190 domain-containing protein	NA	NA	NA	NA	NA
AZT99217.1|3370358_3372110_+	phospholipid carrier-dependent glycosyltransferase	NA	NA	NA	NA	NA
AZT98225.1|3372241_3373612_+	acylneuraminate cytidylyltransferase	NA	NA	NA	NA	NA
AZT98226.1|3373608_3374496_+	N-acetylneuraminate synthase	NA	NA	NA	NA	NA
AZT98227.1|3375898_3377230_+	hypothetical protein	NA	NA	NA	NA	NA
AZT98228.1|3377233_3377743_+	hypothetical protein	NA	NA	NA	NA	NA
AZT98229.1|3378643_3378835_+	hypothetical protein	NA	NA	NA	NA	NA
AZT98230.1|3379320_3381063_-	hypothetical protein	NA	NA	NA	NA	NA
AZT98231.1|3381232_3382204_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AZT98232.1|3382203_3383622_+	hypothetical protein	NA	NA	NA	NA	NA
AZT99218.1|3383792_3384776_+	hypothetical protein	NA	NA	NA	NA	NA
AZT99219.1|3384843_3386070_+	hypothetical protein	NA	NA	NA	NA	NA
AZT98233.1|3386122_3386749_-	hypothetical protein	NA	NA	NA	NA	NA
AZT98234.1|3386778_3387990_-	MFS transporter	NA	NA	NA	NA	NA
AZT98235.1|3388053_3388728_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AZT98236.1|3388947_3389860_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AZT98237.1|3390086_3390689_-	recombinase family protein	NA	A0A219YB42	Aeromonas_phage	45.4	2.5e-33
AZT98238.1|3390822_3391395_-	NUDIX hydrolase	NA	A0A1S6L1P8	Vibrio_phage	28.1	2.4e-09
AZT98239.1|3391375_3392065_-	DUF402 domain-containing protein	NA	NA	NA	NA	NA
AZT98240.1|3392170_3392608_+	N-acetyltransferase	NA	NA	NA	NA	NA
AZT98241.1|3393078_3394462_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AZT98242.1|3394422_3394644_-	hypothetical protein	NA	NA	NA	NA	NA
AZT98243.1|3394674_3396252_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
AZT98244.1|3396305_3396806_-	hypothetical protein	NA	NA	NA	NA	NA
AZT98245.1|3396802_3397009_-	hypothetical protein	NA	NA	NA	NA	NA
AZT98246.1|3397356_3398277_+	hypothetical protein	NA	NA	NA	NA	NA
AZT98247.1|3398385_3398856_-	hypothetical protein	NA	NA	NA	NA	NA
AZT98248.1|3399091_3399685_+	hypothetical protein	NA	NA	NA	NA	NA
AZT98249.1|3399950_3400487_-	hypothetical protein	NA	NA	NA	NA	NA
AZT98250.1|3400458_3400614_-	hypothetical protein	NA	NA	NA	NA	NA
AZT98251.1|3400656_3401301_-	hypothetical protein	NA	NA	NA	NA	NA
AZT98252.1|3401285_3402149_-	hypothetical protein	NA	NA	NA	NA	NA
AZT98253.1|3402652_3403144_+	SRPBCC family protein	NA	NA	NA	NA	NA
AZT98254.1|3403334_3404719_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AZT98255.1|3405081_3405501_-	hypothetical protein	NA	NA	NA	NA	NA
AZT98256.1|3406904_3407771_-	hypothetical protein	NA	NA	NA	NA	NA
AZT98257.1|3407843_3408755_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AZT98258.1|3408768_3409641_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 6
CP025334	Brevibacterium aurantiacum strain SMQ-1420 chromosome, complete genome	4328723	4124736	4144987	4328723	transposase	Mycobacterium_phage(66.67%)	12	NA	NA
AZT98813.1|4124736_4126047_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	66.1	1.8e-169
AZT98814.1|4126219_4126990_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	35.2	6.6e-26
AZT98815.1|4126986_4128609_-|transposase	transposase	transposase	NA	NA	NA	NA
AZT98816.1|4128724_4129060_+	hypothetical protein	NA	NA	NA	NA	NA
AZT98817.1|4129056_4129434_+	hypothetical protein	NA	NA	NA	NA	NA
AZT98818.1|4129561_4129807_+	hypothetical protein	NA	NA	NA	NA	NA
AZT98819.1|4129825_4131403_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
AZT98820.1|4131907_4132975_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZT99281.1|4134841_4136233_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
AZT98821.1|4137992_4138943_-	class C sortase	NA	NA	NA	NA	NA
AZT98822.1|4139060_4140455_-	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
AZT98823.1|4143676_4144987_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	67.1	2.0e-168
