The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP012060	Xanthomonas sp. ISO98C4, complete genome	5225327	14361	78240	5225327	transposase	Synechococcus_phage(12.5%)	53	NA	NA
AZU28294.1|14361_15189_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU28295.1|15182_15449_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU28296.1|15909_16677_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
AZU28297.1|16684_16954_-	membrane protein	NA	NA	NA	NA	NA
AZU28298.1|17028_18489_-	cardiolipin synthetase	NA	NA	NA	NA	NA
AZU28299.1|18813_19539_+	transcriptional regulator	NA	NA	NA	NA	NA
AZU28300.1|19588_19954_+	hypothetical protein	NA	NA	NA	NA	NA
AZU28301.1|20078_21206_-	DNA repair photolyase	NA	NA	NA	NA	NA
AZU28302.1|21391_22093_-	2OG-Fe(II) oxygenase	NA	A0A1D8KQ73	Synechococcus_phage	44.7	5.1e-17
AZU28303.1|22372_23713_-	membrane protein	NA	NA	NA	NA	NA
AZU28304.1|23936_24629_+	membrane protein	NA	NA	NA	NA	NA
AZU28305.1|24735_25056_+	hypothetical protein	NA	NA	NA	NA	NA
AZU28306.1|25055_26063_+	3-phosphoglycerate dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	29.6	2.5e-09
AZU28307.1|26210_27743_-	peptidase S41	NA	A0A0R6PIZ1	Moraxella_phage	29.5	4.5e-26
AZU28308.1|27846_29082_-	peptidase M23	NA	A0A2H4J5G2	uncultured_Caudovirales_phage	32.0	4.6e-05
AZU28309.1|29242_29899_+	hypothetical protein	NA	NA	NA	NA	NA
AZU28310.1|30060_31857_+	aminopeptidase	NA	NA	NA	NA	NA
AZU28311.1|32169_32613_-	peptidase propeptide and ypeb domain-containing protein	NA	NA	NA	NA	NA
AZU28312.1|32910_34044_-	cellulase	NA	NA	NA	NA	NA
AZU28313.1|34665_35718_-	cellulase	NA	NA	NA	NA	NA
AZU28314.1|35847_36255_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28315.1|36492_37566_-	cellulase	NA	NA	NA	NA	NA
AZU28316.1|37873_38932_+	hydroxyacid dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.4	3.0e-77
AZU28317.1|39039_39615_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28318.1|40026_41508_-	glutamate synthase	NA	NA	NA	NA	NA
AZU28319.1|41638_46111_-	glutamate synthase	NA	NA	NA	NA	NA
AZU28320.1|46313_46694_-	Elastase inhibitor AFLEI Flags: Precursor	NA	NA	NA	NA	NA
AZU28321.1|46750_48028_+	DNA topoisomerase	NA	A0A0U2TSJ7	Niemeyer_virus	35.5	2.4e-41
AZU28322.1|48245_48590_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28323.1|48968_49838_-	NmrA family transcriptional regulator	NA	NA	NA	NA	NA
AZU28324.1|50001_50877_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZU28325.1|51079_51466_+	methicillin resistance protein	NA	NA	NA	NA	NA
AZU28326.1|51469_53215_+	ankyrin	NA	NA	NA	NA	NA
AZU28327.1|54186_54366_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28328.1|54356_54923_+	hypothetical protein	NA	NA	NA	NA	NA
AZU28329.1|54959_56141_+	saccharopine dehydrogenase	NA	NA	NA	NA	NA
AZU28330.1|56279_57065_-	Tat pathway signal protein	NA	NA	NA	NA	NA
AZU28331.1|57075_59691_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AZU28332.1|59835_60993_+	XylR family transcriptional regulator	NA	NA	NA	NA	NA
AZU28333.1|61182_63327_+	avirulence protein	NA	NA	NA	NA	NA
AZU28334.1|63814_65272_-	exonuclease	NA	NA	NA	NA	NA
AZU28335.1|65268_67764_-	helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	35.1	9.0e-08
AZU28336.1|67941_68604_+	hemolysin III	NA	NA	NA	NA	NA
AZU28337.1|68670_68928_+	prevent-host-death protein	NA	NA	NA	NA	NA
AZU28338.1|69387_70287_-	oxidoreductase	NA	NA	NA	NA	NA
AZU28339.1|70346_71084_-	3-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
AZU28340.1|71209_72121_+	transcriptional regulator	NA	NA	NA	NA	NA
AZU28341.1|72334_73414_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28342.1|74729_74996_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU28343.1|75016_75817_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU28344.1|76159_76777_-	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
AZU28345.1|76852_76987_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU28346.1|77259_78240_-|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	62.3	4.7e-101
>prophage 2
CP012060	Xanthomonas sp. ISO98C4, complete genome	5225327	358598	424045	5225327	transposase,tRNA	uncultured_virus(20.0%)	58	NA	NA
AZU28577.1|358598_358865_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU28578.1|359522_360749_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU28579.1|360765_361023_+	hypothetical protein	NA	NA	NA	NA	NA
AZU28580.1|361130_361493_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28581.1|361479_361722_+	hypothetical protein	NA	NA	NA	NA	NA
AZU28582.1|361694_362129_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28583.1|362230_362575_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28584.1|362606_363023_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28585.1|363350_363614_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU28586.1|363607_364453_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	42.7	1.5e-44
AZU28587.1|365525_367364_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AZU28588.1|367747_369109_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU32499.1|369105_369237_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28589.1|369235_369424_+	proteinase inhibitor	NA	NA	NA	NA	NA
AZU28590.1|369481_370027_-	carbonic anhydrase	NA	NA	NA	NA	NA
AZU28591.1|370023_370248_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28592.1|370488_371799_+	MFS transporter	NA	NA	NA	NA	NA
AZU28593.1|371947_373207_+	phosphodiesterase	NA	NA	NA	NA	NA
AZU28594.1|373648_374179_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZU28595.1|375371_376139_+	3-alpha-hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
AZU28596.1|376169_377651_+	benzaldehyde dehydrogenase	NA	NA	NA	NA	NA
AZU28597.1|378193_379078_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZU28598.1|379174_380359_+	4-hydroxybenzoate 3-monooxygenase	NA	NA	NA	NA	NA
AZU28599.1|380809_381322_+	hypothetical protein	NA	NA	NA	NA	NA
AZU28600.1|381437_382937_-	glycerol kinase	NA	NA	NA	NA	NA
AZU28601.1|383076_383898_-	glycerol transporter	NA	NA	NA	NA	NA
AZU28602.1|384072_385587_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AZU28603.1|385809_386637_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AZU28604.1|387042_388026_-	diguanylate cyclase	NA	NA	NA	NA	NA
AZU28605.1|388126_389203_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AZU28606.1|389453_390317_+	3-oxoadipate:succinyl-CoA transferase	NA	NA	NA	NA	NA
AZU28607.1|391094_392303_+	beta-ketoadipyl CoA thiolase	NA	NA	NA	NA	NA
AZU28608.1|392381_393119_+	protocatechuate 3,4-dioxygenase	NA	NA	NA	NA	NA
AZU28609.1|393123_393687_+	protocatechuate 3,4-dioxygenase	NA	NA	NA	NA	NA
AZU28610.1|394041_395394_+	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
AZU28611.1|395404_396187_+	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
AZU28612.1|396213_396627_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AZU28613.1|396806_397733_+	hydrolase	NA	NA	NA	NA	NA
AZU28614.1|398070_398931_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AZU28615.1|399079_399940_+	kinase	NA	NA	NA	NA	NA
AZU28616.1|400215_401184_+	lipase	NA	A0A2L2DMU8	Acanthamoeba_polyphaga_mimivirus	28.3	1.9e-22
AZU28617.1|401482_402193_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28618.1|402401_404306_-|tRNA	tRNA uridine 5-carboxymethylaminomethyl modification protein	tRNA	NA	NA	NA	NA
AZU28619.1|404876_405350_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28620.1|405507_406467_+	serine dehydratase	NA	NA	NA	NA	NA
AZU28621.1|406451_407069_+	protein sanA-like protein	NA	NA	NA	NA	NA
AZU28622.1|407112_407532_+	isopropylmalate/homocitrate/citramalate synthase	NA	NA	NA	NA	NA
AZU28623.1|407736_408642_-	aspartyl beta-hydroxylase	NA	S4VR59	Pandoravirus	39.5	1.2e-37
AZU28624.1|408889_409774_-	malonyl-CoA O-methyltransferase	NA	NA	NA	NA	NA
AZU28625.1|410680_411442_-	pimelyl-ACP methyl ester esterase	NA	NA	NA	NA	NA
AZU28626.1|411544_411919_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28627.1|412110_413316_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
AZU28628.1|413407_414442_-	biotin synthase	NA	NA	NA	NA	NA
AZU28629.1|414485_415217_+	competence protein ComF	NA	NA	NA	NA	NA
AZU28630.1|415484_416390_-	4-hydroxybenzoate polyprenyltransferase	NA	NA	NA	NA	NA
AZU28631.1|417349_418801_-	HpaF protein	NA	NA	NA	NA	NA
AZU28632.1|419850_422280_-	serine kinase	NA	NA	NA	NA	NA
AZU28633.1|423061_424045_+|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
>prophage 3
CP012060	Xanthomonas sp. ISO98C4, complete genome	5225327	651167	717933	5225327	transposase	uncultured_virus(14.29%)	47	NA	NA
AZU28817.1|651167_652394_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU28818.1|653513_654248_-	oxidoreductase	NA	NA	NA	NA	NA
AZU28819.1|654298_655243_+	cupin	NA	NA	NA	NA	NA
AZU28820.1|655797_657294_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28821.1|657596_657908_+	hypothetical protein	NA	NA	NA	NA	NA
AZU28822.1|657980_659567_-	oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
AZU28823.1|659925_660705_+	hypothetical protein	NA	A0A2D2W2L0	Stenotrophomonas_phage	66.9	2.4e-92
AZU28824.1|660864_661839_+	glutathionyl-hydroquinone reductase YqjG	NA	NA	NA	NA	NA
AZU28825.1|661912_662308_+	glyoxalase	NA	NA	NA	NA	NA
AZU28826.1|662454_662916_-	membrane protein	NA	NA	NA	NA	NA
AZU28827.1|663416_664244_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU28828.1|664237_664504_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU28829.1|664701_665337_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28830.1|665784_666024_+	membrane protein	NA	NA	NA	NA	NA
AZU28831.1|666425_668753_-	peptidase S9	NA	NA	NA	NA	NA
AZU28832.1|669152_670586_+	hypothetical protein	NA	NA	NA	NA	NA
AZU28833.1|670627_671719_-	lipoprotein	NA	NA	NA	NA	NA
AZU28834.1|672221_674096_+	histidine kinase	NA	A0A127AWB9	Bacillus_phage	31.5	2.2e-14
AZU28835.1|674157_674679_+	BadM/Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AZU28836.1|674781_675681_+	thioredoxin reductase	NA	NA	NA	NA	NA
AZU28837.1|676041_676233_+	membrane protein	NA	NA	NA	NA	NA
AZU28838.1|676457_677009_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28839.1|677214_678099_-	methyltransferase	NA	NA	NA	NA	NA
AZU28840.1|678297_679173_+	membrane protein	NA	NA	NA	NA	NA
AZU28841.1|679448_681221_-	cellulase	NA	NA	NA	NA	NA
AZU32504.1|681414_681522_+	hypothetical protein	NA	NA	NA	NA	NA
AZU28842.1|681628_683329_-	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
AZU28843.1|683476_683770_+	hypothetical protein	NA	NA	NA	NA	NA
AZU28844.1|684230_684464_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28845.1|684482_685859_+	amino acid permease	NA	NA	NA	NA	NA
AZU28846.1|685944_687066_-	type III secretion system effector protein	NA	NA	NA	NA	NA
AZU28847.1|687309_688221_+	magnesium transporter	NA	NA	NA	NA	NA
AZU28848.1|688423_689119_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28849.1|689700_691374_-	trehalase	NA	NA	NA	NA	NA
AZU28850.1|691647_692418_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28851.1|692522_693275_+	endonuclease	NA	NA	NA	NA	NA
AZU28852.1|693804_694797_+	hypothetical protein	NA	NA	NA	NA	NA
AZU28853.1|695153_696083_-	histidine kinase	NA	NA	NA	NA	NA
AZU28854.1|696649_699529_-	peptidase M16	NA	NA	NA	NA	NA
AZU28855.1|699830_702428_+	histidine kinase	NA	G3MA91	Bacillus_virus	31.2	9.7e-13
AZU28856.1|702607_703705_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU28857.1|704049_707340_+	ATPase	NA	A0A1V0SGX0	Hokovirus	36.8	1.4e-32
AZU28858.1|707366_708005_-	chemotaxis protein CheY	NA	NA	NA	NA	NA
AZU28859.1|710297_716336_+	hypothetical protein	NA	A0A2L1IV18	Escherichia_phage	25.6	2.6e-53
AZU28860.1|716449_716797_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28861.1|716845_717583_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU28862.1|717666_717933_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
CP012060	Xanthomonas sp. ISO98C4, complete genome	5225327	852278	937680	5225327	transposase,tRNA,protease	Staphylococcus_phage(20.0%)	60	NA	NA
AZU28968.1|852278_855113_-|tRNA	valyl-tRNA synthetase	tRNA	A0A1V0S951	Catovirus	34.3	3.9e-132
AZU28969.1|855320_855746_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AZU28970.1|855745_856117_-	membrane protein	NA	NA	NA	NA	NA
AZU28971.1|856116_857589_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.5	9.0e-48
AZU28972.1|857696_858779_+	membrane protein	NA	NA	NA	NA	NA
AZU28973.1|858775_859882_+	membrane protein	NA	NA	NA	NA	NA
AZU28974.1|859983_860181_+	hypothetical protein	NA	NA	NA	NA	NA
AZU28975.1|860440_860902_-	membrane protein	NA	NA	NA	NA	NA
AZU28976.1|861289_862261_+	recombinase XerD	NA	G1JX48	Mycobacterium_phage	27.5	3.5e-16
AZU28977.1|862743_863541_+	chitinase	NA	NA	NA	NA	NA
AZU28978.1|864058_868111_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	56.9	9.8e-121
AZU28979.1|868780_871927_+	adhesin	NA	NA	NA	NA	NA
AZU28980.1|872029_873913_+|protease	protease	protease	A0A217EQY2	Bacillus_phage	31.7	3.6e-17
AZU28981.1|874452_881523_+	membrane protein	NA	NA	NA	NA	NA
AZU28982.1|881746_883627_+|protease	protease	protease	A0A1B0T6A2	Bacillus_phage	33.2	2.3e-24
AZU28983.1|883756_885484_+	general secretion pathway protein GspE	NA	NA	NA	NA	NA
AZU28984.1|885659_886877_+	general secretion pathway protein GspF	NA	NA	NA	NA	NA
AZU28985.1|887147_887579_+	general secretion pathway protein GspG	NA	NA	NA	NA	NA
AZU28986.1|887588_888098_+	general secretion pathway protein GspH	NA	NA	NA	NA	NA
AZU28987.1|888094_888511_+	general secretion pathway protein GspI	NA	NA	NA	NA	NA
AZU28988.1|888507_889143_+	general secretion pathway protein GspJ	NA	NA	NA	NA	NA
AZU28989.1|889139_889991_+	general secretion pathway protein GspK	NA	NA	NA	NA	NA
AZU28990.1|889987_891109_+	general secretion pathway protein GspL	NA	NA	NA	NA	NA
AZU28991.1|891092_891746_+	general secretion pathway protein GspM	NA	NA	NA	NA	NA
AZU28992.1|891735_892527_+	general secretion pathway protein GspN	NA	NA	NA	NA	NA
AZU28993.1|892523_894824_+	general secretion pathway protein GspD	NA	A7BJX1	Enterobacteria_phage	24.5	3.4e-09
AZU28994.1|894820_895660_+	glycosyltransferase	NA	NA	NA	NA	NA
AZU28995.1|896073_896802_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZU28996.1|896907_897483_-	aminotransferase	NA	NA	NA	NA	NA
AZU28997.1|897706_899869_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AZU28998.1|899900_901058_-	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
AZU28999.1|901658_902498_+	glycosyl transferase	NA	NA	NA	NA	NA
AZU29000.1|902509_903067_-	hypothetical protein	NA	NA	NA	NA	NA
AZU29001.1|903317_903662_+	hypothetical protein	NA	NA	NA	NA	NA
AZU29002.1|903672_905580_+	glycosyltransferase	NA	NA	NA	NA	NA
AZU29003.1|905629_906925_+	membrane protein	NA	NA	NA	NA	NA
AZU29004.1|906906_907875_+	glycosidase-like protein	NA	NA	NA	NA	NA
AZU29005.1|909238_909505_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU29006.1|909525_910326_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU29007.1|910375_910648_+	hypothetical protein	NA	NA	NA	NA	NA
AZU29008.1|910853_911309_+	hypothetical protein	NA	NA	NA	NA	NA
AZU29009.1|911337_911814_+	hypothetical protein	NA	NA	NA	NA	NA
AZU29010.1|911899_914044_+	cellulose synthase	NA	NA	NA	NA	NA
AZU29011.1|914088_916416_+	cation tolerance protein CutA	NA	NA	NA	NA	NA
AZU29012.1|916412_917594_+	1,4-D-glucanase	NA	NA	NA	NA	NA
AZU29013.1|922386_924045_-|protease	serine protease	protease	NA	NA	NA	NA
AZU29014.1|924037_924463_-	hypothetical protein	NA	NA	NA	NA	NA
AZU29015.1|924827_925250_+	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	63.0	3.0e-41
AZU29016.1|925586_926102_+	peptide deformylase	NA	NA	NA	NA	NA
AZU29017.1|926334_927996_-	ABC transporter ATP-binding protein	NA	A0A1B0RXA0	Streptococcus_phage	28.8	5.4e-41
AZU29018.1|928220_928715_+	hypothetical protein	NA	NA	NA	NA	NA
AZU29019.1|928912_930166_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	3.5e-101
AZU29020.1|930268_930793_+	NrdR family transcriptional regulator	NA	NA	NA	NA	NA
AZU29021.1|930789_931278_+	acetyltransferase	NA	NA	NA	NA	NA
AZU29022.1|931270_932386_+	riboflavin biosynthesis protein RibD	NA	A0A1V0SE20	Indivirus	35.3	4.1e-45
AZU29023.1|933154_934381_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU29024.1|934562_934970_-	hypothetical protein	NA	NA	NA	NA	NA
AZU29025.1|935139_935742_+	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	38.0	6.1e-27
AZU29026.1|935738_936878_+	3,4-dihydroxy-2-butanone 4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	34.3	2.1e-52
AZU29027.1|937215_937680_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	40.9	1.7e-24
>prophage 5
CP012060	Xanthomonas sp. ISO98C4, complete genome	5225327	1193025	1248017	5225327	transposase,protease	uncultured_virus(25.0%)	43	NA	NA
AZU29255.1|1193025_1194252_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU29256.1|1194331_1195315_-|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
AZU29257.1|1195630_1196728_+	membrane protein	NA	NA	NA	NA	NA
AZU29258.1|1196919_1197435_+	hypothetical protein	NA	NA	NA	NA	NA
AZU29259.1|1197454_1198315_+	pseudouridylate synthase	NA	NA	NA	NA	NA
AZU29260.1|1198265_1198658_-	HNH endonuclease	NA	NA	NA	NA	NA
AZU29261.1|1198660_1199869_-	2-amino-3-ketobutyrate CoA ligase	NA	V5LQ39	Emiliania_huxleyi_virus	26.2	1.3e-20
AZU29262.1|1199959_1201057_+	sulfate transporter subunit	NA	NA	NA	NA	NA
AZU29263.1|1201060_1201921_+	sulfate/thiosulfate transporter subunit	NA	NA	NA	NA	NA
AZU29264.1|1201917_1202871_+	sulfate/thiosulfate transporter permease subunit	NA	NA	NA	NA	NA
AZU29265.1|1202878_1203925_+	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	1.2e-25
AZU29266.1|1204191_1204908_+	hypothetical protein	NA	NA	NA	NA	NA
AZU29267.1|1205708_1206935_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU29268.1|1206996_1208019_-	L-threonine 3-dehydrogenase	NA	NA	NA	NA	NA
AZU29269.1|1208583_1210917_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AZU29270.1|1211116_1213198_+	phospholipase C	NA	NA	NA	NA	NA
AZU29271.1|1213358_1215518_+	dipeptidyl-peptidase 7	NA	NA	NA	NA	NA
AZU29272.1|1215609_1216254_+	phosphoglycerate mutase	NA	NA	NA	NA	NA
AZU29273.1|1216470_1217019_+	hypothetical protein	NA	NA	NA	NA	NA
AZU29274.1|1217247_1218567_+	folylpolyglutamate synthase	NA	NA	NA	NA	NA
AZU29275.1|1218634_1219717_+	sporulation protein	NA	NA	NA	NA	NA
AZU29276.1|1219930_1220677_+	colicin V synthesis protein	NA	NA	NA	NA	NA
AZU29277.1|1220707_1222174_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	39.9	4.1e-85
AZU29278.1|1222369_1223194_+	hypothetical protein	NA	NA	NA	NA	NA
AZU29279.1|1225158_1225578_+	lipoprotein	NA	NA	NA	NA	NA
AZU29280.1|1225766_1226510_-	UDP-2,3-diacylglucosamine hydrolase	NA	NA	NA	NA	NA
AZU29281.1|1227070_1227613_-	phosphoesterase	NA	NA	NA	NA	NA
AZU29282.1|1227593_1228730_-	glycosyl transferase	NA	NA	NA	NA	NA
AZU29283.1|1228974_1230501_-	exopolyphosphatase	NA	NA	NA	NA	NA
AZU29284.1|1230673_1232776_-	polyphosphate kinase	NA	NA	NA	NA	NA
AZU29285.1|1232888_1234217_-	histidine kinase	NA	W8CYF6	Bacillus_phage	33.3	6.4e-29
AZU29286.1|1234289_1234979_-	transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
AZU29287.1|1235161_1236868_-	peptidase	NA	NA	NA	NA	NA
AZU29288.1|1236957_1237266_+	glutaredoxin	NA	A0A2L0UZG6	Agrobacterium_phage	43.2	2.1e-07
AZU29289.1|1237262_1237658_+	alkylhydroperoxidase	NA	NA	NA	NA	NA
AZU29290.1|1238019_1239027_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
AZU29291.1|1239165_1239927_-	membrane protein	NA	NA	NA	NA	NA
AZU29292.1|1241106_1241751_+	hypothetical protein	NA	NA	NA	NA	NA
AZU29293.1|1242097_1243324_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU29294.1|1243812_1244073_+	hypothetical protein	NA	NA	NA	NA	NA
AZU29295.1|1244593_1245886_+	trigger factor	NA	NA	NA	NA	NA
AZU29296.1|1245978_1246605_+|protease	Clp protease ClpP	protease	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
AZU29297.1|1246730_1248017_+|protease	Clp protease ATP-binding protein	protease	G3M9Z9	Bacillus_virus	59.9	5.3e-137
>prophage 6
CP012060	Xanthomonas sp. ISO98C4, complete genome	5225327	1321779	1390272	5225327	transposase,protease	Brazilian_cedratvirus(16.67%)	50	NA	NA
AZU29358.1|1321779_1322643_+|protease	membrane protease HflC	protease	NA	NA	NA	NA
AZU29359.1|1323267_1323732_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU29360.1|1324211_1325504_+	adenylosuccinate synthetase	NA	A0A2R8FF47	Brazilian_cedratvirus	38.2	2.9e-74
AZU29361.1|1325871_1328544_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	28.6	8.6e-81
AZU29362.1|1328796_1328982_-	hypothetical protein	NA	NA	NA	NA	NA
AZU29363.1|1329236_1329950_-	oxidoreductase	NA	NA	NA	NA	NA
AZU29364.1|1330021_1330612_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZU29365.1|1331388_1332024_+	hypothetical protein	NA	NA	NA	NA	NA
AZU29366.1|1333329_1333713_+	hypothetical protein	NA	NA	NA	NA	NA
AZU29367.1|1334356_1335931_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
AZU29368.1|1336339_1337092_+	hypothetical protein	NA	NA	NA	NA	NA
AZU29369.1|1337442_1338198_+	hypothetical protein	NA	NA	NA	NA	NA
AZU29370.1|1338264_1338894_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZU29371.1|1339888_1340758_+	ADP-dependent (S)-NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
AZU29372.1|1341177_1342656_+	glycosyl hydrolase	NA	NA	NA	NA	NA
AZU29373.1|1342787_1344593_-	glycoside hydrolase family 15	NA	NA	NA	NA	NA
AZU29374.1|1345914_1348269_-	sugar hydrolase	NA	NA	NA	NA	NA
AZU32509.1|1348343_1348472_+	hypothetical protein	NA	NA	NA	NA	NA
AZU32510.1|1348688_1348868_+	hypothetical protein	NA	NA	NA	NA	NA
AZU29375.1|1348899_1349529_+	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
AZU29376.1|1349873_1351583_+	thioredoxin reductase	NA	NA	NA	NA	NA
AZU29377.1|1351579_1351885_+	zinc finger UbP-type protein	NA	NA	NA	NA	NA
AZU29378.1|1352081_1352828_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AZU29379.1|1352976_1353615_+	guanosine polyphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
AZU32511.1|1353698_1353806_-	hypothetical protein	NA	NA	NA	NA	NA
AZU29380.1|1353872_1356395_+	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	34.5	1.0e-152
AZU29381.1|1357080_1363086_+	transducer protein car	NA	NA	NA	NA	NA
AZU29382.1|1364178_1366476_-	aldehyde oxidase	NA	NA	NA	NA	NA
AZU29383.1|1366472_1367561_-	FAD-binding molybdopterin dehydrogenase	NA	NA	NA	NA	NA
AZU29384.1|1367533_1368112_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
AZU29385.1|1368409_1369741_+	hypothetical protein	NA	NA	NA	NA	NA
AZU29386.1|1369737_1370331_+	hypothetical protein	NA	NA	NA	NA	NA
AZU29387.1|1370393_1370738_+	cupin	NA	NA	NA	NA	NA
AZU29388.1|1370897_1371401_+	DNA-binding protein	NA	NA	NA	NA	NA
AZU29389.1|1371509_1371935_-	death-on-curing protein	NA	A0A1B3AYM0	Gordonia_phage	54.7	3.1e-09
AZU29390.1|1371943_1372165_-	transcriptional regulator	NA	NA	NA	NA	NA
AZU29391.1|1372315_1372921_+	LexA family transcriptional regulator	NA	A0A1W6JNS2	Morganella_phage	38.5	2.5e-12
AZU29392.1|1372922_1373576_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
AZU29393.1|1373585_1375004_+	DNA repair nucleotidyltransferase	NA	NA	NA	NA	NA
AZU32512.1|1375049_1375193_+	hypothetical protein	NA	NA	NA	NA	NA
AZU29394.1|1375179_1378431_+	DNA polymerase	NA	A0A1B1PA77	Streptomyces_phage	24.9	2.7e-81
AZU29395.1|1378863_1380456_+	peptidase S9	NA	NA	NA	NA	NA
AZU29396.1|1380665_1381484_+	histidine kinase	NA	NA	NA	NA	NA
AZU29397.1|1381911_1383864_+	peptide transporter	NA	NA	NA	NA	NA
AZU29398.1|1384740_1385007_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU29399.1|1385000_1385828_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU29400.1|1385852_1386611_+	hypothetical protein	NA	NA	NA	NA	NA
AZU29401.1|1386905_1389026_+	peptidase S9	NA	NA	NA	NA	NA
AZU29402.1|1389184_1390012_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU29403.1|1390005_1390272_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
CP012060	Xanthomonas sp. ISO98C4, complete genome	5225327	1394353	1457188	5225327	transposase,tRNA	Bacillus_phage(20.0%)	56	NA	NA
AZU29406.1|1394353_1395091_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU29407.1|1395174_1395441_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU29408.1|1395864_1397091_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU29409.1|1397071_1398778_-	hypothetical protein	NA	NA	NA	NA	NA
AZU29410.1|1399184_1401293_-	catalase	NA	A0A2K9L0T1	Tupanvirus	47.9	7.3e-136
AZU29411.1|1401497_1402352_-	hypothetical protein	NA	A0A2H4PQR8	Staphylococcus_phage	30.0	5.8e-23
AZU29412.1|1402409_1404044_-	carboxylesterase	NA	A0A0M4JT58	Mollivirus	29.7	3.6e-37
AZU29413.1|1404211_1407076_-	glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.9	1.5e-261
AZU29414.1|1407542_1407722_-	hypothetical protein	NA	NA	NA	NA	NA
AZU29415.1|1408144_1408948_+	sulfotransferase	NA	NA	NA	NA	NA
AZU29416.1|1409033_1410272_+	hemolysin D	NA	NA	NA	NA	NA
AZU29417.1|1410268_1412425_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.2	4.5e-32
AZU29418.1|1412703_1413957_+	MFS transporter	NA	NA	NA	NA	NA
AZU29419.1|1413973_1414336_+	hypothetical protein	NA	NA	NA	NA	NA
AZU29420.1|1414340_1415195_-|transposase	transposase	transposase	U5P429	Shigella_phage	59.9	1.9e-90
AZU29421.1|1415423_1416161_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU29422.1|1416244_1416511_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU29423.1|1418807_1420475_-	membrane protein	NA	NA	NA	NA	NA
AZU29424.1|1420471_1421236_-	membrane protein	NA	NA	NA	NA	NA
AZU29425.1|1421335_1423069_-	membrane protein	NA	NA	NA	NA	NA
AZU29426.1|1423285_1424002_+	chemotaxis protein CheY	NA	W8CYM9	Bacillus_phage	34.8	1.3e-23
AZU29427.1|1423967_1425284_+	histidine kinase	NA	NA	NA	NA	NA
AZU29428.1|1425468_1425960_-	hypothetical protein	NA	NA	NA	NA	NA
AZU29429.1|1426028_1426286_-	cell division topological specificity factor	NA	NA	NA	NA	NA
AZU29430.1|1426288_1427098_-	cell division inhibitor MinD	NA	NA	NA	NA	NA
AZU29431.1|1427133_1427877_-	septum formation inhibitor	NA	NA	NA	NA	NA
AZU29432.1|1427880_1428480_-	acetyltransferase	NA	NA	NA	NA	NA
AZU29433.1|1428714_1429911_+	histidine kinase	NA	NA	NA	NA	NA
AZU29434.1|1429910_1430552_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AZU29435.1|1430460_1430826_-	hypothetical protein	NA	NA	NA	NA	NA
AZU29436.1|1430902_1432084_+	polyketide cyclase	NA	NA	NA	NA	NA
AZU29437.1|1432165_1432552_+	membrane protein	NA	NA	NA	NA	NA
AZU29438.1|1432554_1433229_+	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
AZU29439.1|1433304_1434102_-	peptidase	NA	NA	NA	NA	NA
AZU29440.1|1434229_1434412_-	hypothetical protein	NA	NA	NA	NA	NA
AZU29441.1|1434408_1434693_-	membrane protein	NA	NA	NA	NA	NA
AZU29442.1|1434844_1435714_-	membrane protein	NA	NA	NA	NA	NA
AZU29443.1|1435838_1437041_+	phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
AZU29444.1|1437316_1438645_-	endonuclease	NA	NA	NA	NA	NA
AZU29445.1|1438598_1439513_-|tRNA	arginyl-tRNA-protein transferase	tRNA	NA	NA	NA	NA
AZU29446.1|1439553_1440162_+	calcium-binding protein	NA	NA	NA	NA	NA
AZU29447.1|1440328_1440784_-	hypothetical protein	NA	NA	NA	NA	NA
AZU29448.1|1441094_1442288_-	RNA polymerase sigma70	NA	NA	NA	NA	NA
AZU29449.1|1442397_1442910_-	pathogenicity-like protein	NA	NA	NA	NA	NA
AZU29450.1|1443141_1444047_-	palmitoyl-CoA hydrolase	NA	NA	NA	NA	NA
AZU29451.1|1444117_1444888_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AZU29452.1|1444953_1445382_+	hypothetical protein	NA	NA	NA	NA	NA
AZU29453.1|1445498_1445903_-	thioesterase	NA	NA	NA	NA	NA
AZU29454.1|1445902_1448869_-	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.0	4.3e-307
AZU29455.1|1449161_1449482_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
AZU29456.1|1449494_1449755_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
AZU29457.1|1449987_1451040_+	GTPase CgtA	NA	NA	NA	NA	NA
AZU29458.1|1451131_1451401_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
AZU29459.1|1451517_1453110_+	membrane protein	NA	NA	NA	NA	NA
AZU29460.1|1453297_1454350_+	riboflavin kinase	NA	NA	NA	NA	NA
AZU29461.1|1454356_1457188_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SGW1	Hokovirus	22.3	7.5e-43
>prophage 8
CP012060	Xanthomonas sp. ISO98C4, complete genome	5225327	1461615	1495935	5225327	transposase	Pontimonas_phage(50.0%)	34	NA	NA
AZU29466.1|1461615_1462443_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU29467.1|1462436_1462703_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU32492.1|1462857_1463499_+	outer protein G, type III effector XopG	NA	NA	NA	NA	NA
AZU29468.1|1464235_1464865_+	hypothetical protein	NA	NA	NA	NA	NA
AZU29469.1|1465621_1466116_-	hypothetical protein	NA	NA	NA	NA	NA
AZU29470.1|1466432_1466873_-	hypothetical protein	NA	NA	NA	NA	NA
AZU29471.1|1466872_1468015_-	sugar ABC transporter permease	NA	A0A2K9VGT1	Pontimonas_phage	37.2	1.2e-07
AZU29472.1|1468011_1468554_-	hypothetical protein	NA	NA	NA	NA	NA
AZU29473.1|1468571_1469021_-	hypothetical protein	NA	NA	NA	NA	NA
AZU29474.1|1469026_1469317_-	hypothetical protein	NA	NA	NA	NA	NA
AZU29475.1|1469417_1471907_-	type IV secretion system protein DotA-like protein	NA	NA	NA	NA	NA
AZU29476.1|1471928_1472243_-	hypothetical protein	NA	NA	NA	NA	NA
AZU29477.1|1472246_1472699_-	hypothetical protein	NA	NA	NA	NA	NA
AZU29478.1|1473125_1473365_-	hypothetical protein	NA	NA	NA	NA	NA
AZU29479.1|1473447_1474185_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU29480.1|1474268_1474535_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU29481.1|1474669_1475587_+	hypothetical protein	NA	NA	NA	NA	NA
AZU29482.1|1475812_1479325_-	phospholipase	NA	NA	NA	NA	NA
AZU29483.1|1479339_1479600_-	hypothetical protein	NA	NA	NA	NA	NA
AZU29484.1|1479930_1480170_-	hypothetical protein	NA	NA	NA	NA	NA
AZU29485.1|1480260_1480506_+	hypothetical protein	NA	NA	NA	NA	NA
AZU29486.1|1481159_1481747_-	hypothetical protein	NA	NA	NA	NA	NA
AZU29487.1|1482082_1482646_-	hypothetical protein	NA	NA	NA	NA	NA
AZU29488.1|1482656_1483763_-	recombinase	NA	A0A0A1I5U0	Burkholderia_phage	35.4	2.4e-45
AZU29489.1|1484324_1485260_+	cytochrome C oxidase subunit II	NA	NA	NA	NA	NA
AZU29490.1|1485259_1487260_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AZU29491.1|1487262_1487889_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
AZU29492.1|1487888_1488224_+	cytochrome C oxidase	NA	NA	NA	NA	NA
AZU29493.1|1488575_1490273_+	peptidase M61	NA	NA	NA	NA	NA
AZU29494.1|1490514_1491906_+	DNA repair protein RadA	NA	NA	NA	NA	NA
AZU29495.1|1492319_1492706_+	membrane protein	NA	NA	NA	NA	NA
AZU29496.1|1493233_1494025_-	transcriptional regulator	NA	NA	NA	NA	NA
AZU29497.1|1494847_1495585_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU29498.1|1495668_1495935_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 9
CP012060	Xanthomonas sp. ISO98C4, complete genome	5225327	1530660	1548156	5225327	transposase,tRNA	Shigella_phage(40.0%)	16	NA	NA
AZU29525.1|1530660_1531419_+|tRNA	tRNA (guanine-N1)-methyltransferase	tRNA	NA	NA	NA	NA
AZU29526.1|1531563_1531971_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AZU29527.1|1532225_1533719_-	multidrug transporter MatE	NA	NA	NA	NA	NA
AZU32514.1|1533776_1533881_+	hypothetical protein	NA	NA	NA	NA	NA
AZU29528.1|1534244_1534940_+	DNA-binding protein	NA	NA	NA	NA	NA
AZU29529.1|1534998_1535655_+	glutathione S-transferase	NA	NA	NA	NA	NA
AZU29530.1|1535879_1536287_+|tRNA	tRNA synthetase RNA-binding protein	tRNA	NA	NA	NA	NA
AZU29531.1|1536408_1538655_-	hydroperoxidase	NA	NA	NA	NA	NA
AZU29532.1|1539083_1539698_-	calcium-binding protein	NA	NA	NA	NA	NA
AZU29533.1|1539997_1542619_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.3	2.0e-29
AZU29534.1|1542731_1543586_-|transposase	transposase	transposase	U5P429	Shigella_phage	59.9	1.9e-90
AZU29535.1|1543603_1543876_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	60.0	1.5e-20
AZU29536.1|1545940_1546204_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU29537.1|1546197_1547043_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	42.7	1.5e-44
AZU29538.1|1547056_1547806_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	37.0	7.8e-40
AZU29539.1|1547889_1548156_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 10
CP012060	Xanthomonas sp. ISO98C4, complete genome	5225327	1684259	1724767	5225327	coat,transposase,protease	Shigella_phage(33.33%)	31	NA	NA
AZU29654.1|1684259_1685606_-|protease	zinc metalloprotease	protease	NA	NA	NA	NA
AZU29655.1|1685632_1686823_-	1-deoxy-D-xylulose 5-phosphate reductoisomerase	NA	NA	NA	NA	NA
AZU29656.1|1686825_1687653_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AZU29657.1|1687649_1688408_-	UDP diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	32.6	1.0e-15
AZU29658.1|1688425_1688983_-	ribosome recycling factor	NA	NA	NA	NA	NA
AZU29659.1|1689184_1689907_-	uridylate kinase	NA	NA	NA	NA	NA
AZU29660.1|1690012_1691536_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.0	3.1e-19
AZU29661.1|1691810_1692689_-	elongation factor Ts	NA	NA	NA	NA	NA
AZU29662.1|1692858_1693656_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
AZU29663.1|1694111_1694825_-	pilus assembly protein	NA	NA	NA	NA	NA
AZU29664.1|1694827_1695160_-	hypothetical protein	NA	NA	NA	NA	NA
AZU29665.1|1695208_1696243_-|coat	spore coat protein U	coat	NA	NA	NA	NA
AZU29666.1|1696239_1698591_-	fimbriae usher protein	NA	NA	NA	NA	NA
AZU29667.1|1698607_1699378_-	pilus assembly protein	NA	NA	NA	NA	NA
AZU29668.1|1699386_1699911_-	sigma-fimbriae tip adhesin	NA	NA	NA	NA	NA
AZU29669.1|1700229_1701006_+	methionine aminopeptidase	NA	NA	NA	NA	NA
AZU29670.1|1701002_1703612_+	protein-PII uridylyltransferase	NA	NA	NA	NA	NA
AZU29671.1|1703633_1704830_+	2,3,4,5-tetrahydropyridine-2,6-carboxylate N-succinyltransferase	NA	NA	NA	NA	NA
AZU29672.1|1705020_1705377_+	arsenate reductase	NA	NA	NA	NA	NA
AZU29673.1|1705623_1706754_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
AZU29674.1|1707046_1708741_+	asparagine synthetase B	NA	A0A0P0C1V4	Ostreococcus_lucimarinus_virus	39.0	1.2e-88
AZU29675.1|1708808_1709861_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32517.1|1710133_1710280_-	hypothetical protein	NA	NA	NA	NA	NA
AZU29676.1|1710296_1712435_-	ligand-gated channel	NA	NA	NA	NA	NA
AZU29677.1|1712842_1715260_-	penicillin acylase	NA	NA	NA	NA	NA
AZU29678.1|1715406_1715892_+	bacterioferritin	NA	NA	NA	NA	NA
AZU29679.1|1716120_1716387_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU29680.1|1716380_1717208_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU29681.1|1718898_1721142_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.0	1.0e-82
AZU29682.1|1723622_1723895_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	60.0	1.5e-20
AZU29683.1|1723912_1724767_+|transposase	transposase	transposase	U5P429	Shigella_phage	59.9	1.9e-90
>prophage 11
CP012060	Xanthomonas sp. ISO98C4, complete genome	5225327	1903096	1972245	5225327	integrase,transposase,tRNA,protease	Catovirus(22.22%)	58	1931977:1931994	1958785:1958802
AZU29842.1|1903096_1904491_-|tRNA	asparaginyl-tRNA synthetase	tRNA	A0A2P1EMB4	Moumouvirus	39.0	1.1e-79
AZU29843.1|1904695_1905034_+	Fe-S cluster assembly protein HesB	NA	NA	NA	NA	NA
AZU29844.1|1905489_1905921_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
AZU29845.1|1905932_1906163_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
AZU29846.1|1906351_1906801_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
AZU29847.1|1907010_1910514_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
AZU29848.1|1910570_1911302_+	cell division protein ZipA	NA	NA	NA	NA	NA
AZU29849.1|1911308_1911692_+	membrane protein	NA	NA	NA	NA	NA
AZU29850.1|1911870_1912995_-	aminotransferase	NA	A0A1X6WGT4	Pacmanvirus	24.7	4.5e-07
AZU29851.1|1913329_1915831_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	37.2	8.2e-118
AZU29852.1|1915827_1916790_+|tRNA	lysyl-tRNA synthetase	tRNA	A0A1V0SAC0	Catovirus	26.2	1.8e-20
AZU29853.1|1916898_1917585_+	hypothetical protein	NA	NA	NA	NA	NA
AZU29854.1|1917772_1918837_+	methylthioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
AZU29855.1|1919046_1921746_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.4	9.8e-109
AZU29856.1|1922050_1924471_+	glucose dehydrogenase	NA	NA	NA	NA	NA
AZU29857.1|1924842_1925571_-	hypothetical protein	NA	NA	NA	NA	NA
AZU29858.1|1925835_1927503_-	urocanate hydratase	NA	NA	NA	NA	NA
AZU29859.1|1927519_1928377_-	formimidoylglutamase	NA	NA	NA	NA	NA
AZU29860.1|1928373_1928562_-	hypothetical protein	NA	NA	NA	NA	NA
AZU29861.1|1928558_1930100_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.8	1.3e-78
AZU29862.1|1930113_1931319_-	imidazolonepropionase	NA	NA	NA	NA	NA
AZU29863.1|1931379_1932750_+	N-formimino-L-glutamate deiminase	NA	NA	NA	NA	NA
1931977:1931994	attL	GCGCTGCCGGATGCGGTG	NA	NA	NA	NA
AZU32519.1|1932810_1933038_+	hypothetical protein	NA	NA	NA	NA	NA
AZU29864.1|1933027_1933804_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZU29865.1|1933990_1934995_-	membrane protein	NA	NA	NA	NA	NA
AZU29866.1|1935531_1936092_-	poly(hydroxyalcanoate) granule associated protein	NA	NA	NA	NA	NA
AZU29867.1|1936254_1936530_-	polyhydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
AZU29868.1|1936767_1937577_+	hypothetical protein	NA	NA	NA	NA	NA
AZU29869.1|1937518_1938175_-	sulfite oxidase	NA	NA	NA	NA	NA
AZU29870.1|1938300_1939269_-	sulfoxide reductase catalytic subunit YedY	NA	NA	NA	NA	NA
AZU29871.1|1939445_1940531_+	MFS transporter	NA	M1Q1P2	Streptococcus_phage	43.6	1.5e-76
AZU29872.1|1940614_1941823_+	prephenate dehydratase	NA	NA	NA	NA	NA
AZU29873.1|1941946_1943269_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AZU29874.1|1943610_1944078_-	energy transducer TonB	NA	NA	NA	NA	NA
AZU29875.1|1944434_1945106_-	energy transducer TonB	NA	NA	NA	NA	NA
AZU29876.1|1945217_1946498_+|tRNA	seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	55.4	3.3e-99
AZU29877.1|1946818_1947403_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AZU29878.1|1947503_1948520_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZU29879.1|1949066_1950536_+|integrase	integrase	integrase	NA	NA	NA	NA
AZU29880.1|1951052_1951880_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU29881.1|1951873_1952140_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU29882.1|1952607_1953435_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU29883.1|1953428_1953695_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU29884.1|1955988_1957179_-	FAD-binding monooxygenase	NA	NA	NA	NA	NA
AZU29885.1|1957215_1957680_-	transcriptional regulator	NA	NA	NA	NA	NA
AZU32520.1|1957719_1957890_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32521.1|1958041_1958155_+	hypothetical protein	NA	NA	NA	NA	NA
AZU29886.1|1961114_1961459_-	chemotaxis protein CheY	NA	NA	NA	NA	NA
1958785:1958802	attR	GCGCTGCCGGATGCGGTG	NA	NA	NA	NA
AZU29887.1|1961757_1963275_+	circadian clock protein KaiC	NA	NA	NA	NA	NA
AZU29888.1|1963261_1965334_+	histidine kinase	NA	NA	NA	NA	NA
AZU29889.1|1965691_1966399_-	C-type cytochrome biogenesis protein	NA	NA	NA	NA	NA
AZU29890.1|1966392_1966890_-	cytochrome C biogenesis protein	NA	NA	NA	NA	NA
AZU29891.1|1966889_1967432_-	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AZU29892.1|1967428_1969417_-	cytochrome C biogenesis protein	NA	NA	NA	NA	NA
AZU29893.1|1969480_1969951_-	cytochrome C biogenesis protein CcmE	NA	NA	NA	NA	NA
AZU29894.1|1969947_1970154_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
AZU29895.1|1970150_1970909_-	heme ABC transporter permease	NA	NA	NA	NA	NA
AZU29896.1|1970919_1972245_-|protease	serine protease	protease	A0A217EQY2	Bacillus_phage	39.6	5.3e-23
>prophage 12
CP012060	Xanthomonas sp. ISO98C4, complete genome	5225327	2030505	2041333	5225327	tRNA	Micromonas_pusilla_virus(16.67%)	7	NA	NA
AZU29953.1|2030505_2032182_+	ubiquinone biosynthesis protein UbiB	NA	G8DDN0	Micromonas_pusilla_virus	29.2	7.1e-41
AZU29954.1|2032269_2032911_+	LexA family transcriptional regulator	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
AZU29955.1|2033083_2034118_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.0	1.1e-113
AZU29956.1|2034411_2034900_+	recombinase RecX	NA	NA	NA	NA	NA
AZU29957.1|2035001_2037650_+|tRNA	alanyl-tRNA synthetase	tRNA	A0A1V0SK38	Klosneuvirus	39.8	2.8e-84
AZU29958.1|2037789_2038002_+	carbon storage regulator	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
AZU29959.1|2039374_2041333_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.1	9.6e-13
>prophage 13
CP012060	Xanthomonas sp. ISO98C4, complete genome	5225327	2222390	2235167	5225327	transposase,protease	uncultured_virus(100.0%)	10	NA	NA
AZU30091.1|2222390_2222657_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU30092.1|2222650_2223478_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU30093.1|2223502_2224297_+	hypothetical protein	NA	NA	NA	NA	NA
AZU30094.1|2224444_2226820_+	hypothetical protein	NA	NA	NA	NA	NA
AZU30095.1|2227180_2227399_-	hypothetical protein	NA	NA	NA	NA	NA
AZU30096.1|2227916_2228654_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU30097.1|2228737_2229004_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU30098.1|2231144_2231474_+	hypothetical protein	NA	NA	NA	NA	NA
AZU30099.1|2231464_2232691_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU30100.1|2234615_2235167_-|protease	CAAX protease	protease	NA	NA	NA	NA
>prophage 14
CP012060	Xanthomonas sp. ISO98C4, complete genome	5225327	2394447	2442433	5225327	transposase	Ralstonia_phage(40.0%)	34	NA	NA
AZU30208.1|2394447_2394714_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU30209.1|2394707_2395535_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU30210.1|2396553_2398212_-	chemotaxis protein	NA	NA	NA	NA	NA
AZU30211.1|2398214_2398841_-	chemotaxis protein	NA	NA	NA	NA	NA
AZU30212.1|2398840_2399233_-	histidine kinase	NA	NA	NA	NA	NA
AZU30213.1|2399268_2400036_-	flagellar biosynthesis sigma factor	NA	NA	NA	NA	NA
AZU30214.1|2400032_2400917_-	cobyrinic acid a,c-diamide synthase	NA	NA	NA	NA	NA
AZU30215.1|2400903_2402595_-	flagellar biosynthesis regulator FlhF	NA	NA	NA	NA	NA
AZU30216.1|2403346_2405440_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
AZU30217.1|2405436_2406567_-	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
AZU30218.1|2406914_2409002_-	membrane protein	NA	G3MA91	Bacillus_virus	34.9	6.6e-20
AZU30219.1|2412435_2413419_-|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
AZU30220.1|2416885_2417677_-	flagellar biosynthesis protein FliR	NA	NA	NA	NA	NA
AZU30221.1|2417690_2417960_-	flagellar biogenesis protein	NA	NA	NA	NA	NA
AZU30222.1|2418422_2419406_-|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
AZU30223.1|2420067_2420913_-	flagellar biosynthesis protein flip	NA	NA	NA	NA	NA
AZU30224.1|2420914_2421322_-	flagellar protein	NA	NA	NA	NA	NA
AZU30225.1|2421318_2421657_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
AZU30226.1|2421653_2422667_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
AZU30227.1|2422677_2423205_-	flagellar basal body protein FliL	NA	NA	NA	NA	NA
AZU30228.1|2423395_2424688_-	flagellar protein	NA	NA	NA	NA	NA
AZU30229.1|2424684_2425140_-	flagellar export protein FliJ	NA	NA	NA	NA	NA
AZU30230.1|2425143_2426520_-	flagellar protein FliI	NA	NA	NA	NA	NA
AZU30231.1|2426516_2427137_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
AZU30232.1|2427133_2428123_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
AZU30233.1|2428133_2429858_-	flagellar MS-ring protein	NA	NA	NA	NA	NA
AZU30234.1|2429871_2430243_-	flagellar hook-basal body protein	NA	NA	NA	NA	NA
AZU30235.1|2430672_2434167_-	O-antigen biosynthesis protein	NA	K7QL84	Escherichia_phage	25.9	6.5e-12
AZU30236.1|2434613_2434859_+	hypothetical protein	NA	NA	NA	NA	NA
AZU30237.1|2437246_2437975_-	methyltransferase	NA	NA	NA	NA	NA
AZU30238.1|2437986_2438736_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AZU30239.1|2438779_2440063_-	hypothetical protein	NA	NA	NA	NA	NA
AZU30240.1|2441005_2442232_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU30241.1|2442316_2442433_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 15
CP012060	Xanthomonas sp. ISO98C4, complete genome	5225327	2571440	2600008	5225327	transposase,protease	Xanthomonas_phage(63.64%)	26	NA	NA
AZU30342.1|2571440_2574176_-|protease	serine protease	protease	NA	NA	NA	NA
AZU30343.1|2575299_2575575_+	hypothetical protein	NA	NA	NA	NA	NA
AZU30344.1|2576052_2576469_+	membrane protein	NA	NA	NA	NA	NA
AZU30345.1|2576465_2577779_+	sorbosone dehydrogenase	NA	NA	NA	NA	NA
AZU30346.1|2578017_2578200_+	hypothetical protein	NA	NA	NA	NA	NA
AZU30347.1|2578234_2579461_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU30348.1|2579503_2580532_-	hypothetical protein	NA	NA	NA	NA	NA
AZU30349.1|2581206_2582190_+|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
AZU30350.1|2582270_2583497_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU30351.1|2585138_2585324_+	hypothetical protein	NA	A0A1W6DXV6	Xanthomonas_phage	82.0	4.9e-20
AZU30352.1|2585323_2585509_+	hypothetical protein	NA	NA	NA	NA	NA
AZU30353.1|2586685_2586982_+	hypothetical protein	NA	NA	NA	NA	NA
AZU30354.1|2587007_2587208_+	hypothetical protein	NA	A0A077JGA5	Xanthomonas_phage	98.5	6.7e-31
AZU30355.1|2587210_2587477_+	hypothetical protein	NA	A0A077JBM7	Xanthomonas_phage	75.0	1.8e-23
AZU30356.1|2587583_2589083_+	hypothetical protein	NA	A0A077JDC5	Xanthomonas_phage	86.2	2.9e-211
AZU30357.1|2589082_2589400_+	hypothetical protein	NA	A0A077JCZ2	Xanthomonas_phage	98.1	3.4e-53
AZU30358.1|2589396_2590563_+	zonular occludens toxin	NA	A0A077JGB2	Xanthomonas_phage	92.0	9.8e-207
AZU30359.1|2590562_2591219_+	conjugal transfer protein	NA	A0A077JBM8	Xanthomonas_phage	85.4	2.4e-101
AZU30360.1|2592234_2592555_-	hypothetical protein	NA	NA	NA	NA	NA
AZU30361.1|2592998_2594225_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU30362.1|2595062_2596427_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZU30363.1|2596721_2597390_-	glycosyl transferase	NA	NA	NA	NA	NA
AZU30364.1|2597386_2597989_-	methyltransferase	NA	NA	NA	NA	NA
AZU30365.1|2597985_2598744_-	N- acetylglucosaminylphosphatidylinositol deacetylase	NA	NA	NA	NA	NA
AZU30366.1|2598731_2599250_-	dehydrogenase	NA	NA	NA	NA	NA
AZU30367.1|2599741_2600008_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 16
CP012060	Xanthomonas sp. ISO98C4, complete genome	5225327	2830201	2880315	5225327	transposase,tRNA,protease	Moumouvirus(12.5%)	47	NA	NA
AZU30569.1|2830201_2831629_+|tRNA	cysteinyl-tRNA synthetase	tRNA	M1PG92	Moumouvirus	32.6	2.4e-37
AZU30570.1|2832193_2832631_+	Fe-S cluster assembly protein SufE	NA	NA	NA	NA	NA
AZU30571.1|2832627_2833878_+	multidrug transporter	NA	NA	NA	NA	NA
AZU30572.1|2834083_2834584_-	molecular chaperone DnaK	NA	NA	NA	NA	NA
AZU30573.1|2834630_2835209_+	hypothetical protein	NA	NA	NA	NA	NA
AZU30574.1|2835208_2835502_+	membrane protein	NA	NA	NA	NA	NA
AZU30575.1|2835498_2836848_+	dihydroorotase	NA	NA	NA	NA	NA
AZU30576.1|2836847_2837690_+	peptidase M23	NA	A0A075BS18	Microcystis_phage	43.0	1.3e-14
AZU30577.1|2837764_2838307_+	glyoxalase	NA	NA	NA	NA	NA
AZU30578.1|2838725_2840090_+	ethanolamine permease	NA	NA	NA	NA	NA
AZU30579.1|2840086_2841496_+	ethanolamine ammonia-lyase	NA	NA	NA	NA	NA
AZU30580.1|2841492_2842308_+	ethanolamine ammonia-lyase	NA	NA	NA	NA	NA
AZU30581.1|2842364_2842655_-	hypothetical protein	NA	NA	NA	NA	NA
AZU30582.1|2842748_2843630_-	beta-lactamase	NA	NA	NA	NA	NA
AZU30583.1|2843749_2844238_-	general stress protein	NA	NA	NA	NA	NA
AZU30584.1|2844848_2845694_+	hypothetical protein	NA	NA	NA	NA	NA
AZU30585.1|2847067_2848051_+|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
AZU30586.1|2848789_2850460_+	polygalacturonase	NA	NA	NA	NA	NA
AZU30587.1|2850545_2850812_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU30588.1|2850805_2851633_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU30589.1|2851870_2852560_-	phytoene synthase	NA	NA	NA	NA	NA
AZU30590.1|2852588_2853281_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
AZU30591.1|2853366_2854086_-	3-demethylubiquinone-9 3-methyltransferase	NA	NA	NA	NA	NA
AZU30592.1|2854117_2855455_-	N-ethylammeline chlorohydrolase	NA	NA	NA	NA	NA
AZU30593.1|2855472_2856285_-	hypothetical protein	NA	NA	NA	NA	NA
AZU30594.1|2856479_2857046_-	elongation factor P	NA	NA	NA	NA	NA
AZU30595.1|2857148_2858177_+	lysine 2,3-aminomutase	NA	NA	NA	NA	NA
AZU30596.1|2858411_2860529_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AZU30597.1|2860525_2861455_-	metal-binding protein	NA	NA	NA	NA	NA
AZU30598.1|2861506_2862271_-	RNA methyltransferase	NA	NA	NA	NA	NA
AZU30599.1|2862388_2863222_+	inositol monophosphatase	NA	NA	NA	NA	NA
AZU30600.1|2863417_2864029_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	69.8	1.1e-79
AZU30601.1|2864283_2864724_+	ribonuclease	NA	NA	NA	NA	NA
AZU30602.1|2864720_2865146_+	barnase inhibitor	NA	NA	NA	NA	NA
AZU30603.1|2865428_2867318_-	ABC transporter ATPase	NA	A0A2K9L3Z8	Tupanvirus	27.4	3.6e-49
AZU30604.1|2867428_2868805_+	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.4	1.2e-54
AZU30605.1|2868906_2869467_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	49.0	6.5e-31
AZU30606.1|2869561_2871118_-	hypothetical protein	NA	NA	NA	NA	NA
AZU30607.1|2871399_2872275_+	carboxylesterase	NA	NA	NA	NA	NA
AZU30608.1|2872369_2873197_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU30609.1|2873190_2873457_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU30610.1|2873684_2874383_-	glutathione S-transferase	NA	NA	NA	NA	NA
AZU30611.1|2874553_2874763_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	63.9	5.7e-17
AZU30612.1|2875318_2875867_+	hypothetical protein	NA	NA	NA	NA	NA
AZU30613.1|2875863_2877045_+	membrane protein	NA	NA	NA	NA	NA
AZU30614.1|2877266_2879336_+	membrane protein	NA	NA	NA	NA	NA
AZU30615.1|2879436_2880315_-|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 17
CP012060	Xanthomonas sp. ISO98C4, complete genome	5225327	2994159	3023484	5225327	transposase,tRNA	uncultured_Mediterranean_phage(83.33%)	29	NA	NA
AZU30696.1|2994159_2995386_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU30697.1|2996039_2997008_-	preprotein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	29.9	8.9e-28
AZU30698.1|2997122_2998967_-	preprotein translocase subunit SecD	NA	NA	NA	NA	NA
AZU30699.1|2999157_2999511_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
AZU30700.1|2999642_3000788_-|tRNA	queuine tRNA-ribosyltransferase	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.9	1.9e-85
AZU30701.1|3000869_3001940_-|tRNA	S-adenosylmethionine:tRNA ribosyltransferase-isomerase	tRNA	NA	NA	NA	NA
AZU30702.1|3002093_3002525_-	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AZU32531.1|3002524_3002629_-	hypothetical protein	NA	NA	NA	NA	NA
AZU30703.1|3002646_3004143_+	lysine 6-aminotransferase	NA	NA	NA	NA	NA
AZU30704.1|3004285_3004483_-	hypothetical protein	NA	NA	NA	NA	NA
AZU30705.1|3004479_3005187_-	hypothetical protein	NA	NA	NA	NA	NA
AZU30706.1|3005562_3006942_-	phosphoesterase	NA	NA	NA	NA	NA
AZU30707.1|3006938_3008060_-	phytase	NA	NA	NA	NA	NA
AZU30708.1|3008056_3010615_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AZU30709.1|3010766_3011399_+	Uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AZU30710.1|3011772_3013533_-	cellulase	NA	NA	NA	NA	NA
AZU32532.1|3013529_3013643_-	hypothetical protein	NA	NA	NA	NA	NA
AZU30711.1|3013823_3015602_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
AZU30712.1|3015598_3015883_-	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.1e-18
AZU30713.1|3015873_3016056_-	hypothetical protein	NA	NA	NA	NA	NA
AZU30714.1|3016114_3016612_-	hypothetical protein	NA	NA	NA	NA	NA
AZU30715.1|3016658_3017165_-	phosphopantetheine adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	4.8e-25
AZU30716.1|3017161_3017785_-	methyltransferase	NA	NA	NA	NA	NA
AZU30717.1|3018024_3019929_+	heat shock protein 90	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.4	2.3e-112
AZU30718.1|3020522_3021260_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU30719.1|3021342_3021609_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU30720.1|3021602_3022430_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU30721.1|3022542_3022809_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU30722.1|3023217_3023484_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 18
CP012060	Xanthomonas sp. ISO98C4, complete genome	5225327	3026513	3077828	5225327	terminase,head,tail,capsid,portal,integrase,plate,transposase	Stenotrophomonas_phage(55.17%)	59	3026445:3026504	3086118:3086506
3026445:3026504	attL	GGTAATCCCCCCGCCCATTAGCAGACGCCAGAAGTGGAATTTTCTCGTATCCTTTCTCGA	NA	NA	NA	NA
AZU30724.1|3026513_3026780_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU30725.1|3026899_3027328_+	hypothetical protein	NA	A0A218MND5	uncultured_virus	58.5	1.5e-08
AZU30726.1|3028182_3028449_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU30727.1|3029109_3029751_-	carboxypeptidase	NA	NA	NA	NA	NA
AZU30728.1|3031617_3032679_-	hypothetical protein	NA	NA	NA	NA	NA
AZU30729.1|3032779_3033502_-	hypothetical protein	NA	NA	NA	NA	NA
AZU30730.1|3033608_3036062_-	hypothetical protein	NA	NA	NA	NA	NA
AZU30731.1|3036163_3036433_-	hypothetical protein	NA	NA	NA	NA	NA
AZU30732.1|3036467_3036878_-	hypothetical protein	NA	NA	NA	NA	NA
AZU30733.1|3036935_3037766_-	hypothetical protein	NA	NA	NA	NA	NA
AZU30734.1|3037828_3038869_-	type IV secretion system energizing component VirB11	NA	NA	NA	NA	NA
AZU30735.1|3038883_3040053_-	hypothetical protein	NA	NA	NA	NA	NA
AZU30736.1|3040049_3040817_-	Type IV secretory pathway, VirB9 component	NA	NA	NA	NA	NA
AZU30737.1|3040813_3041845_-	conjugative transfer protein	NA	NA	NA	NA	NA
AZU30738.1|3041970_3042381_-	hypothetical protein	NA	NA	NA	NA	NA
AZU30739.1|3042713_3044387_-	hypothetical protein	NA	NA	NA	NA	NA
AZU30740.1|3044423_3044666_-	hypothetical protein	NA	NA	NA	NA	NA
AZU30741.1|3045544_3047566_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AZU30742.1|3048462_3049692_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	53.2	5.3e-118
AZU30743.1|3049691_3049910_-	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	55.9	3.3e-15
AZU30744.1|3049906_3050116_-	hypothetical protein	NA	NA	NA	NA	NA
AZU30745.1|3050112_3050385_-	hypothetical protein	NA	NA	NA	NA	NA
AZU30746.1|3050381_3050606_-	hypothetical protein	NA	NA	NA	NA	NA
AZU30747.1|3050602_3050875_-	hypothetical protein	NA	NA	NA	NA	NA
AZU30748.1|3050867_3051050_-	hypothetical protein	NA	NA	NA	NA	NA
AZU30749.1|3051042_3051468_-	hypothetical protein	NA	NA	NA	NA	NA
AZU30750.1|3051546_3051819_-	hypothetical protein	NA	NA	NA	NA	NA
AZU30751.1|3051818_3052106_-	hypothetical protein	NA	NA	NA	NA	NA
AZU30752.1|3052102_3052321_-	hypothetical protein	NA	NA	NA	NA	NA
AZU30753.1|3052644_3055065_-	toprim domain protein	NA	V9IQW5	Stenotrophomonas_phage	68.8	4.0e-271
AZU30754.1|3055067_3055913_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	42.7	1.5e-44
AZU30755.1|3055906_3056170_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU30756.1|3056399_3057386_-	phage late control protein	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	51.8	1.7e-90
AZU30757.1|3057382_3057781_-	oxidoreductase	NA	V9IQX3	Stenotrophomonas_phage	61.4	4.6e-39
AZU30758.1|3057793_3060664_-|tail	tail protein	tail	V9IQL1	Stenotrophomonas_phage	48.0	1.2e-194
AZU30759.1|3060693_3060807_-	P2 GpE family protein	NA	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
AZU30760.1|3060815_3061118_-|tail	tail protein	tail	V9IQM4	Stenotrophomonas_phage	67.4	4.9e-25
AZU30761.1|3061162_3061672_-|tail	major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	80.5	3.6e-73
AZU30762.1|3061702_3062869_-|tail	tail sheath protein	tail	E5FFG9	Burkholderia_phage	63.2	5.9e-135
AZU30763.1|3062880_3063240_-|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	66.9	1.5e-36
AZU30764.1|3063236_3063800_-|plate	baseplate assembly protein	plate	Q9ZXL0	Pseudomonas_virus	47.0	1.4e-25
AZU30765.1|3063860_3064439_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
AZU30766.1|3064448_3065954_-	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	46.6	1.0e-51
AZU30767.1|3065963_3066509_-|tail	tail protein	tail	V9IQK7	Stenotrophomonas_phage	54.7	4.6e-50
AZU30768.1|3066501_3066945_-|plate	baseplate assembly protein	plate	R4JDM0	Burkholderia_phage	53.8	1.3e-34
AZU30769.1|3067210_3068011_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU30770.1|3068031_3068298_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU30771.1|3068897_3069344_-|tail	tail protein	tail	V9IQH0	Stenotrophomonas_phage	62.4	1.6e-40
AZU30772.1|3069331_3069751_-|tail	tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	63.7	8.2e-39
AZU30773.1|3069747_3070236_-	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	51.7	7.6e-28
AZU30774.1|3070235_3070874_-	lysozyme	NA	V9IQK6	Stenotrophomonas_phage	61.5	2.1e-49
AZU30775.1|3070873_3071149_-	hypothetical protein	NA	V9IQV8	Stenotrophomonas_phage	59.8	1.3e-21
AZU30776.1|3071141_3071498_-	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	3.5e-22
AZU30777.1|3071502_3071712_-|tail	tail protein	tail	K4PAW7	Burkholderia_phage	59.4	7.0e-15
AZU30778.1|3071711_3072179_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.0	1.2e-30
AZU30779.1|3072277_3072997_-|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	62.9	2.2e-68
AZU30780.1|3073000_3074020_-|capsid	capsid protein	capsid	Q9ZXM3	Pseudomonas_virus	69.7	6.7e-135
AZU30781.1|3074066_3074909_-|capsid	phage capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	53.1	2.9e-67
AZU30782.1|3076814_3077828_+|portal	Presumed portal vertex protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	72.8	3.6e-141
3086118:3086506	attR	GGTAATCCCCCCGCCCATTAGCAGACGCCAGAAGTGGAATTTTCTCGTATCCTTTCTCGAGGAGGTTCCATGAAGAAGTCCCGCTTTACCGACAGCCAGATCATCGCCGTGCTCAAGCAGGCCCAGGCCGGTGCGCCCGTGCCGGAGCTGTGCCGCGAGCACGGCATCAGCTCGGCCACGTTCTACAAGTGGCGCAGCAAGTTCGGCGGCATGGACGTGTCCATGGTCGCGCGCATGAAGGAGCTGGAGGAGGAGAACCGCCGGCTCAAGAAGATGTACGCCGAGGCGCAGCTCAGTACCGACCTGCTGAAGGAAGCGCTCGCAAAAAAATGGTGAGGCCATCTCAGCGACGCGAGATGGCCCAATCGGCAGTCACGAGCGGGCGTACG	NA	NA	NA	NA
>prophage 19
CP012060	Xanthomonas sp. ISO98C4, complete genome	5225327	3405728	3464294	5225327	transposase	Prochlorococcus_phage(25.0%)	57	NA	NA
AZU31056.1|3405728_3406955_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU31057.1|3407120_3408092_+	thiamine biosynthesis protein ApbE	NA	NA	NA	NA	NA
AZU31058.1|3408088_3409870_+	sulfite reductase	NA	NA	NA	NA	NA
AZU31059.1|3410113_3410971_-	HutD-family protein	NA	NA	NA	NA	NA
AZU31060.1|3411397_3411730_-	competence protein ComEA	NA	NA	NA	NA	NA
AZU31061.1|3411929_3413423_+	peptidase M20	NA	NA	NA	NA	NA
AZU31062.1|3413958_3414231_+	membrane protein	NA	NA	NA	NA	NA
AZU31063.1|3414288_3415308_+	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
AZU31064.1|3415304_3416015_+	mannose-1-phosphate guanylyltransferase	NA	A0A1D7XFC1	Escherichia_phage	33.9	3.3e-08
AZU31065.1|3416235_3416937_-	hypothetical protein	NA	NA	NA	NA	NA
AZU31066.1|3416933_3418100_-	membrane protein	NA	NA	NA	NA	NA
AZU31067.1|3418096_3419209_-	hypothetical protein	NA	NA	NA	NA	NA
AZU31068.1|3419339_3420365_+	phosphoribosylaminoimidazole synthetase	NA	Q58MH8	Prochlorococcus_phage	44.1	2.1e-72
AZU31069.1|3420382_3420841_+	membrane protein	NA	NA	NA	NA	NA
AZU31070.1|3420863_3421481_+	membrane protein	NA	NA	NA	NA	NA
AZU31071.1|3421467_3422136_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	35.7	1.0e-19
AZU31072.1|3422202_3423030_+	hypothetical protein	NA	NA	NA	NA	NA
AZU31073.1|3423033_3423717_+	hypothetical protein	NA	NA	NA	NA	NA
AZU31074.1|3424277_3424601_-	membrane protein	NA	NA	NA	NA	NA
AZU31075.1|3424597_3425872_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AZU31076.1|3426123_3426351_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
AZU31077.1|3426404_3427406_+	D-arabinose 5-phosphate isomerase	NA	E3T535	Cafeteria_roenbergensis_virus	24.9	1.4e-12
AZU31078.1|3427454_3428003_+	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase	NA	NA	NA	NA	NA
AZU31079.1|3427999_3428575_+	hypothetical protein	NA	NA	NA	NA	NA
AZU31080.1|3428561_3429134_+	hypothetical protein	NA	NA	NA	NA	NA
AZU31081.1|3429133_3429853_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.3	5.6e-27
AZU31082.1|3429893_3431333_+	RNA polymerase sigma54 factor	NA	NA	NA	NA	NA
AZU31083.1|3431420_3431738_+	ribosome hibernation promoting factor HPF	NA	NA	NA	NA	NA
AZU31084.1|3431759_3432218_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
AZU31085.1|3432214_3433165_+	serine kinase	NA	NA	NA	NA	NA
AZU31086.1|3433161_3434034_+	nucleotide-binding protein	NA	A0A0R8VB27	Thermobifida_phage	30.5	7.8e-07
AZU31087.1|3434566_3434959_+	PTS system fructose IIA component family protein	NA	NA	NA	NA	NA
AZU31088.1|3434951_3435221_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AZU31089.1|3436968_3437322_+	hypothetical protein	NA	NA	NA	NA	NA
AZU31090.1|3437636_3438998_+	magnesium transporter	NA	NA	NA	NA	NA
AZU31091.1|3439139_3439937_+	phospholipase	NA	NA	NA	NA	NA
AZU31092.1|3439971_3440988_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AZU31093.1|3441090_3441918_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU31094.1|3441911_3442178_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU31095.1|3442296_3442419_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU31096.1|3443707_3444418_+	type IV secretory pathway, TrbF protein	NA	NA	NA	NA	NA
AZU31097.1|3444444_3445437_+	conjugal transfer protein TrbG	NA	NA	NA	NA	NA
AZU31098.1|3445452_3446805_+	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
AZU31099.1|3446977_3447184_+	hypothetical protein	NA	NA	NA	NA	NA
AZU31100.1|3447194_3447434_+	hypothetical protein	NA	NA	NA	NA	NA
AZU31101.1|3447506_3447755_+	hypothetical protein	NA	NA	NA	NA	NA
AZU31102.1|3449593_3453202_-	hypothetical protein	NA	NA	NA	NA	NA
AZU31103.1|3454088_3455366_-	murein transglycosylase	NA	NA	NA	NA	NA
AZU31104.1|3455497_3456244_-	hypothetical protein	NA	A0A1B0V7H9	Salmonella_phage	35.7	9.2e-33
AZU31105.1|3456844_3457222_+	hypothetical protein	NA	NA	NA	NA	NA
AZU31106.1|3457773_3457962_+	hypothetical protein	NA	NA	NA	NA	NA
AZU31107.1|3458161_3458761_+	hypothetical protein	NA	NA	NA	NA	NA
AZU31108.1|3459380_3459647_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU31109.1|3459903_3460209_-	hypothetical protein	NA	NA	NA	NA	NA
AZU31110.1|3460807_3461137_+	hypothetical protein	NA	NA	NA	NA	NA
AZU32493.1|3461629_3462472_-	outer protein AF, type III effector XopAF	NA	NA	NA	NA	NA
AZU31111.1|3463466_3464294_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 20
CP012060	Xanthomonas sp. ISO98C4, complete genome	5225327	3551701	3637920	5225327	transposase,protease	uncultured_virus(27.27%)	58	NA	NA
AZU31175.1|3551701_3551968_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU31176.1|3552170_3553397_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU31177.1|3554266_3554722_-	histidine biosynthesis protein HisIE	NA	NA	NA	NA	NA
AZU31178.1|3555499_3555727_+	hypothetical protein	NA	NA	NA	NA	NA
AZU31179.1|3555727_3556123_-	glycine cleavage system protein H	NA	NA	NA	NA	NA
AZU31180.1|3556270_3557380_-	glycine cleavage system protein T	NA	NA	NA	NA	NA
AZU31181.1|3557553_3557988_-	membrane protein	NA	NA	NA	NA	NA
AZU31182.1|3557991_3558954_-	membrane protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	32.9	2.5e-22
AZU31183.1|3559112_3559448_-	membrane protein	NA	A0A218MNG8	uncultured_virus	57.8	6.8e-28
AZU31184.1|3560689_3561490_-	3'-5'-bisphosphate nucleotidase	NA	NA	NA	NA	NA
AZU31185.1|3561486_3562035_-	ADP-ribose diphosphatase	NA	NA	NA	NA	NA
AZU31186.1|3562076_3563495_+	adenosylmethionine-8-amino-7-oxononanoate aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	20.7	2.1e-09
AZU31187.1|3563485_3564220_+	16S rRNA methyltransferase	NA	NA	NA	NA	NA
AZU31188.1|3564531_3565548_-	glucokinase	NA	NA	NA	NA	NA
AZU31189.1|3567979_3568717_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU31190.1|3568800_3569067_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU31191.1|3570319_3572005_+	alpha-L-fucosidase	NA	NA	NA	NA	NA
AZU31192.1|3572008_3573076_+	glycosyl hydrolase	NA	A0A2P1CFB9	Microbacterium_phage	23.4	1.1e-07
AZU31193.1|3573340_3575791_+	beta-hexosaminidase	NA	NA	NA	NA	NA
AZU31194.1|3575812_3578503_+	beta-mannosidase	NA	NA	NA	NA	NA
AZU31195.1|3578986_3581647_+	glycoside hydrolase family 3	NA	NA	NA	NA	NA
AZU31196.1|3582229_3583693_+	Tat pathway signal protein	NA	NA	NA	NA	NA
AZU31197.1|3583803_3586146_+	alpha-mannosidase	NA	NA	NA	NA	NA
AZU31198.1|3586460_3588296_+	beta-galactosidase	NA	NA	NA	NA	NA
AZU31199.1|3588345_3590784_-	type III secretion system effector protein	NA	NA	NA	NA	NA
AZU31200.1|3591518_3591719_+	hypothetical protein	NA	NA	NA	NA	NA
AZU31201.1|3591776_3592106_-	R body protein RebB-like protein	NA	NA	NA	NA	NA
AZU31202.1|3594074_3595790_+	leucine-rich repeat (LRR) protein	NA	NA	NA	NA	NA
AZU31203.1|3595894_3596626_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AZU31204.1|3596622_3597687_-	N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase	NA	NA	NA	NA	NA
AZU31205.1|3598397_3598595_+	hypothetical protein	NA	NA	NA	NA	NA
AZU31206.1|3598621_3599215_-	alanine acetyltransferase	NA	NA	NA	NA	NA
AZU31207.1|3599446_3599923_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AZU31208.1|3599956_3601144_-	chemotaxis protein	NA	NA	NA	NA	NA
AZU31209.1|3601151_3608357_-	chemotaxis protein CheY	NA	W8CYM9	Bacillus_phage	31.9	1.3e-11
AZU31210.1|3608470_3610507_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.2	3.6e-23
AZU31211.1|3610546_3611077_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AZU31212.1|3611076_3611439_-	chemotaxis protein CheY	NA	A0A220YL79	Alteromonas_virus	27.7	4.1e-10
AZU31213.1|3611456_3611858_-	pilus assembly protein PilG	NA	NA	NA	NA	NA
AZU31214.1|3612094_3613045_+	glutathione synthetase	NA	NA	NA	NA	NA
AZU31215.1|3613041_3613917_+	energy transducer TonB	NA	NA	NA	NA	NA
AZU31216.1|3614262_3615180_-	ADP-ribosylglycohydrolase	NA	A0A1S6UB21	Serratia_phage	47.1	2.0e-66
AZU31217.1|3615176_3615896_-|protease	glycoprotease	protease	NA	NA	NA	NA
AZU32542.1|3616114_3616210_-	hypothetical protein	NA	NA	NA	NA	NA
AZU31218.1|3616257_3618249_-	helicase	NA	A0A127AW80	Bacillus_phage	33.0	1.9e-93
AZU31219.1|3618527_3619052_-	hypothetical protein	NA	NA	NA	NA	NA
AZU31220.1|3619065_3621510_-	penicillin-binding protein	NA	NA	NA	NA	NA
AZU31221.1|3621747_3623832_+	glycosyl transferase	NA	NA	NA	NA	NA
AZU31222.1|3624192_3625635_-	hypothetical protein	NA	NA	NA	NA	NA
AZU31223.1|3625906_3628093_-	(p)ppGpp synthetase	NA	NA	NA	NA	NA
AZU31224.1|3628546_3629446_+	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
AZU31225.1|3629442_3630195_+	pyrroloquinoline quinone biosynthesis protein PqqC	NA	NA	NA	NA	NA
AZU31226.1|3630191_3630470_+	pyrroloquinoline quinone biosynthesis protein PqqD	NA	NA	NA	NA	NA
AZU31227.1|3630466_3631585_+	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
AZU31228.1|3631647_3632160_+	hypothetical protein	NA	NA	NA	NA	NA
AZU31229.1|3632585_3634100_+	PhoPQ-regulated protein	NA	NA	NA	NA	NA
AZU31230.1|3634402_3635437_+	glucokinase	NA	NA	NA	NA	NA
AZU31231.1|3636693_3637920_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
>prophage 21
CP012060	Xanthomonas sp. ISO98C4, complete genome	5225327	3753348	3846469	5225327	integrase,transposase	uncultured_virus(20.0%)	83	3796535:3796594	3846446:3847775
AZU31319.1|3753348_3754149_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU31320.1|3754169_3754436_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU31321.1|3754465_3756307_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.6	7.3e-15
AZU31322.1|3756509_3756944_-	membrane protein	NA	NA	NA	NA	NA
AZU31323.1|3756930_3757455_-	hypothetical protein	NA	NA	NA	NA	NA
AZU31324.1|3757457_3758279_-	laccase	NA	NA	NA	NA	NA
AZU31325.1|3758280_3759276_-	ribosomal large subunit pseudouridine synthase D	NA	NA	NA	NA	NA
AZU31326.1|3759396_3760278_+	competence protein	NA	NA	NA	NA	NA
AZU31327.1|3760592_3761570_+	hypothetical protein	NA	A0A0N9SJH5	Pseudomonas_phage	41.0	1.7e-55
AZU31328.1|3761588_3763229_-	NAD synthetase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	4.9e-95
AZU31329.1|3763251_3763623_-	DNA methyltransferase	NA	NA	NA	NA	NA
AZU31330.1|3764289_3765165_-	succinyl-CoA synthetase subunit alpha	NA	NA	NA	NA	NA
AZU31331.1|3765189_3766359_-	succinyl-CoA synthetase subunit beta	NA	NA	NA	NA	NA
AZU31332.1|3766590_3768204_+	ATPase	NA	NA	NA	NA	NA
AZU31333.1|3768534_3769929_+	chemotaxis protein CheY	NA	NA	NA	NA	NA
AZU31334.1|3770333_3770453_-	pilus assembly protein	NA	NA	NA	NA	NA
AZU31335.1|3770697_3772407_-	general secretion pathway protein GspE	NA	NA	NA	NA	NA
AZU31336.1|3772498_3772954_-	fimbrial protein	NA	NA	NA	NA	NA
AZU31337.1|3773063_3773504_-	fimbrial protein	NA	NA	NA	NA	NA
AZU31338.1|3773797_3775024_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU31339.1|3775195_3776452_+	type II secretory pathway protein	NA	NA	NA	NA	NA
AZU31340.1|3776458_3777322_+	methyltransferase	NA	NA	NA	NA	NA
AZU31341.1|3777332_3777944_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
AZU31342.1|3779244_3779511_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU31343.1|3779531_3780332_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU31344.1|3780714_3782049_-	histidine kinase	NA	NA	NA	NA	NA
AZU31345.1|3782041_3782719_-	XRE family transcriptional regulator	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
AZU31346.1|3783394_3784282_-	ribosomal protein S6 modification protein	NA	A0A1D7SR78	Cyanophage	32.0	3.5e-31
AZU31347.1|3784773_3786906_+	glycogen debranching protein	NA	NA	NA	NA	NA
AZU31348.1|3787364_3787757_-	histone-like nucleoid-structuring protein	NA	NA	NA	NA	NA
AZU31349.1|3787847_3788240_-	hypothetical protein	NA	NA	NA	NA	NA
AZU31350.1|3788348_3789008_-	hypothetical protein	NA	NA	NA	NA	NA
AZU31351.1|3789764_3790037_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	60.0	1.5e-20
AZU31352.1|3790054_3790909_+|transposase	transposase	transposase	U5P429	Shigella_phage	59.9	1.9e-90
AZU31353.1|3791666_3791858_-	hypothetical protein	NA	NA	NA	NA	NA
AZU31354.1|3791928_3792408_-	RadC family protein	NA	NA	NA	NA	NA
AZU31355.1|3792763_3793591_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU31356.1|3793584_3793851_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU31357.1|3794005_3794230_-	hypothetical protein	NA	NA	NA	NA	NA
AZU31358.1|3794993_3795977_-|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
3796535:3796594	attL	GAGCGTGTGCAGAATTTTGTGTAACCGTGGTTTGGGTTACCGCTGAGGAAGTCGCCCCTC	NA	NA	NA	NA
AZU31359.1|3796570_3797797_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU31360.1|3799188_3800415_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU31361.1|3800451_3801234_+	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	33.1	7.9e-11
AZU31362.1|3802026_3802827_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU31363.1|3802847_3803114_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU31364.1|3804812_3806093_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	49.3	5.7e-107
AZU31365.1|3806079_3806511_-	peptidase S24	NA	A0A2H4J538	uncultured_Caudovirales_phage	42.0	2.6e-19
AZU31366.1|3807063_3808008_-	membrane protein	NA	NA	NA	NA	NA
AZU31367.1|3808087_3808816_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZU31368.1|3809582_3810371_+	protein kinase	NA	NA	NA	NA	NA
AZU31369.1|3810753_3811623_+	hypothetical protein	NA	A0A142K541	Mycobacterium_phage	27.2	1.5e-05
AZU31370.1|3811803_3812604_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU31371.1|3812624_3812891_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU31372.1|3813058_3814759_+	hypothetical protein	NA	NA	NA	NA	NA
AZU31373.1|3814961_3815945_+|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
AZU31374.1|3816016_3816502_+	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AZU31375.1|3817018_3817417_-	hypothetical protein	NA	NA	NA	NA	NA
AZU31376.1|3817782_3818994_-	nuclease	NA	NA	NA	NA	NA
AZU31377.1|3819206_3819986_+	conjugal transfer protein	NA	NA	NA	NA	NA
AZU31378.1|3819982_3820528_+|integrase	integrase	integrase	NA	NA	NA	NA
AZU31379.1|3820596_3820998_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AZU31380.1|3821119_3823126_+	DNA mismatch repair protein MutL	NA	NA	NA	NA	NA
AZU31381.1|3823165_3826480_-	hypothetical protein	NA	NA	NA	NA	NA
AZU31382.1|3826947_3827145_-	hypothetical protein	NA	NA	NA	NA	NA
AZU31383.1|3827159_3829181_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	26.4	5.0e-33
AZU31384.1|3829723_3831229_+	DNA methyltransferase	NA	Q6V7R9	Burkholderia_virus	44.9	1.4e-101
AZU31385.1|3831666_3832494_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU31386.1|3832487_3832754_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU31387.1|3832915_3833302_+	hypothetical protein	NA	NA	NA	NA	NA
AZU31388.1|3833397_3833841_+	hypothetical protein	NA	NA	NA	NA	NA
AZU31389.1|3833968_3834682_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZU31390.1|3834978_3835776_+	GTPase	NA	NA	NA	NA	NA
AZU31391.1|3836787_3837525_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU31392.1|3837608_3837875_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU31393.1|3837939_3838413_-	hypothetical protein	NA	NA	NA	NA	NA
AZU31394.1|3838500_3838701_-	hypothetical protein	NA	NA	NA	NA	NA
AZU31395.1|3838808_3839636_+	hypothetical protein	NA	A0A2C9CYF8	Yersinia_phage	36.1	1.1e-42
AZU31396.1|3839712_3840384_+	hypothetical protein	NA	NA	NA	NA	NA
AZU32546.1|3840500_3840680_-	hypothetical protein	NA	NA	NA	NA	NA
AZU31397.1|3840830_3841091_+	hypothetical protein	NA	NA	NA	NA	NA
AZU31398.1|3841169_3841820_+	hypothetical protein	NA	NA	NA	NA	NA
AZU31399.1|3841893_3843003_+	methyltransferase	NA	NA	NA	NA	NA
AZU31400.1|3845242_3846469_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
3846446:3847775	attR	GAGGGGCGACTTCCTCAGCGGTAACCCAAACCACGGTTACACAAAATTCTGCACACGCTCAACAGGGCTTGATCTGCTGGAGTTCCCCACAATTGTCTTCATGCAATCAGGGTGGAACATCTACACGCTTCAGCAGGCCGCACGTCGCTCATGGCGTATAGGCCAGAAGTTGCGTGTGAGGGTGATCTACTTGGGGTACATGGCCACGTCGCAGATGACGTGCCTTGCTCTGATGGCCAAAAAGATCCTGGTGTCTCAAAGCACGTCGGGCGACGTCCCGGAATCGGGGCTTGACGTGCTCAATCAGGATGGCGACTCAATTGAGGTCGCTTTGGCGCGGCAGCTTGTTGCTGCTTGATGTCCAGAATCAGCCGGCACCCTTCGGGGCGCCGGCTTTTTTTTCTAATGCATACTTCTGCTACCGATGGTTTGACAATCAGCACGCCAGAACATGGATGAGCGCTAATTCGCATTCTTTACTGACCGGGGTTGCTGTCTGCAGGGATGGTATCGGCTTACTGCAACAGGAAGCCGGTTCATGCAAAACATCTGCTGCTCCTCACTCCTGGCTGGCTGTGGTCTGGTAGTCGCTGCCATTTTTACTGGTGGTTGCGCCACTACGTCTTCAGAAGTTCAGCCGCCCCCTACTGAAGAGGTAATCGCTCCCCGCGACCAGACCGATCCGGAGTTGATTCCAGTGATCCGCTATGGGCGCTACACCCTGGTTGAACTGTCTCCTGGCTCAGCACAGCGCGACCTACTGCTGCAGGTCATCGATGTGCGGATGCCAGACGAAGCGAGAGCTAGTGTTGGCGATGGCCTACGCCACGTTCTCAACCGCAGTGGCTACCAAATGTGTGAGACGGGATCAGCCGCCCTTGAACTCTACCCGCTGCCAATGCCCGCCGCCCATCTGCAACTGGGCCCTATGACTCTGCGCGATGCGCTACTCACTCTGGCAGGCCCTGCTTGGGATGTTGAGGTCAATGACAGCACACGGCAGGTGTGCTTTGTCCGTCCTGGAACTCATGTTGACCTTCAATCTCAGGATCTTCGAAGCTCCGAGCCGGCTCAGGTGTTTCCGCAAGATGGAGCCCAGCAATGACTAGATCCAAGATCATCTTCGGCGCGAAACATTCACGAGCCTACTCAATCATCCAGATATTGCTGTGGGTGTGGCTTGTCGGGCTTATGGCCTTAGTGATGATCGCGTTGCTCGCTGTGCAGTCGCAACGCGAAAAGACCCTCAATCGTTTGCACGCGCTGGAGGTAGGTCAGGCGCAAATCGCTGACGCAAATCGGGCGCTACAGGCCCGGCCGGAATCGGCCA	NA	NA	NA	NA
>prophage 22
CP012060	Xanthomonas sp. ISO98C4, complete genome	5225327	4172088	4194407	5225327	transposase,holin	Shigella_phage(28.57%)	24	NA	NA
AZU31644.1|4172088_4172355_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU31645.1|4172402_4173629_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU31646.1|4173712_4174513_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU31647.1|4174910_4175864_+	DegV domain-containing protein	NA	NA	NA	NA	NA
AZU31648.1|4176414_4176753_+	hypothetical protein	NA	NA	NA	NA	NA
AZU31649.1|4176983_4177256_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	60.0	1.5e-20
AZU31650.1|4177273_4178128_+|transposase	transposase	transposase	U5P429	Shigella_phage	59.9	1.9e-90
AZU31651.1|4178158_4178989_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AZU31652.1|4179047_4179623_-	glutathione-dependent formaldehyde-activating protein	NA	NA	NA	NA	NA
AZU31653.1|4179691_4180801_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.4	1.1e-34
AZU31654.1|4180867_4181143_-	regulator	NA	NA	NA	NA	NA
AZU31655.1|4181472_4181820_-	hypothetical protein	NA	NA	NA	NA	NA
AZU31656.1|4182273_4183374_-	glycosyltransferase	NA	A0A142BZU7	Faustovirus	29.4	5.2e-16
AZU31657.1|4183451_4184231_+	transcriptional regulator	NA	NA	NA	NA	NA
AZU31658.1|4184227_4185730_+	histidine kinase	NA	W8CYF6	Bacillus_phage	24.4	8.7e-14
AZU31659.1|4185741_4185924_+	hypothetical protein	NA	NA	NA	NA	NA
AZU31660.1|4185917_4187300_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AZU31661.1|4187407_4188196_-	hypothetical protein	NA	NA	NA	NA	NA
AZU31662.1|4188287_4188911_-	GTP-binding protein	NA	NA	NA	NA	NA
AZU31663.1|4189054_4189852_+	cytochrome C	NA	NA	NA	NA	NA
AZU31664.1|4189946_4190597_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AZU31665.1|4190688_4191504_+	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AZU31666.1|4191553_4192291_+	endonuclease	NA	NA	NA	NA	NA
AZU31667.1|4192427_4194407_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	26.1	5.3e-19
>prophage 23
CP012060	Xanthomonas sp. ISO98C4, complete genome	5225327	4214332	4222383	5225327	coat	Enterobacteria_phage(42.86%)	7	NA	NA
AZU31686.1|4214332_4215679_+	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	26.2	4.8e-32
AZU31687.1|4215725_4217129_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.8	1.9e-47
AZU31688.1|4217431_4218598_-	UDP-glucose 6-dehydrogenase	NA	M1HV26	Paramecium_bursaria_Chlorella_virus	57.8	1.6e-116
AZU31689.1|4218938_4219838_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	1.6e-26
AZU31690.1|4219834_4220392_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	49.4	3.0e-44
AZU31691.1|4220388_4221276_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	57.8	1.7e-94
AZU31692.1|4221327_4222383_-|coat	spore coat protein	coat	I7HTA3	Enterobacteria_phage	45.0	2.4e-79
>prophage 24
CP012060	Xanthomonas sp. ISO98C4, complete genome	5225327	4643474	4712550	5225327	transposase,tRNA,protease	Listeria_phage(27.27%)	58	NA	NA
AZU32068.1|4643474_4644479_-|tRNA	tRNA-dihydrouridine synthase A	tRNA	NA	NA	NA	NA
AZU32069.1|4644935_4645160_-	membrane protein	NA	NA	NA	NA	NA
AZU32070.1|4645735_4646341_-	ankyrin	NA	NA	NA	NA	NA
AZU32071.1|4646400_4647924_-	catalase	NA	A0A2K9L0T1	Tupanvirus	48.3	9.8e-98
AZU32072.1|4648298_4648910_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32073.1|4648906_4650040_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32560.1|4650060_4650228_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32074.1|4651958_4653185_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU32075.1|4653165_4653771_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32076.1|4653767_4654907_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32077.1|4655194_4657327_-	ATP-dependent DNA helicase DinG	NA	NA	NA	NA	NA
AZU32078.1|4657623_4657860_-	membrane protein	NA	NA	NA	NA	NA
AZU32079.1|4657856_4658231_-	membrane protein	NA	NA	NA	NA	NA
AZU32080.1|4658220_4659072_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
AZU32081.1|4659136_4660018_+	TolB-like protein	NA	NA	NA	NA	NA
AZU32082.1|4660666_4663201_-	iron-uptake factor	NA	NA	NA	NA	NA
AZU32083.1|4663431_4664184_+	endonuclease	NA	H6X497	Enterobacteria_phage	33.8	3.0e-23
AZU32084.1|4664555_4665548_-	delta-aminolevulinic acid dehydratase	NA	NA	NA	NA	NA
AZU32561.1|4665572_4665734_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32085.1|4665757_4666006_-	membrane protein	NA	NA	NA	NA	NA
AZU32086.1|4666222_4666693_+	hypothetical protein	NA	NA	NA	NA	NA
AZU32087.1|4666791_4668582_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32088.1|4669484_4671734_-	peptidase S9	NA	NA	NA	NA	NA
AZU32089.1|4672961_4673153_+	hypothetical protein	NA	NA	NA	NA	NA
AZU32090.1|4673319_4676334_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AZU32091.1|4676520_4677222_+	peptidase	NA	NA	NA	NA	NA
AZU32092.1|4677211_4678225_+	cupin	NA	NA	NA	NA	NA
AZU32093.1|4678235_4679801_+	tryptophan halogenase	NA	E3SL43	Synechococcus_phage	28.5	2.5e-40
AZU32094.1|4679940_4680951_+	energy transducer TonB	NA	NA	NA	NA	NA
AZU32095.1|4681197_4682391_-	sodium ABC transporter permease	NA	NA	NA	NA	NA
AZU32096.1|4682387_4683134_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.2e-19
AZU32097.1|4683165_4684767_-|protease	cysteine protease	protease	NA	NA	NA	NA
AZU32098.1|4684827_4685028_-	Cro/Cl family transcriptional regulator	NA	NA	NA	NA	NA
AZU32099.1|4685024_4685612_-	membrane protein	NA	NA	NA	NA	NA
AZU32100.1|4686052_4687615_+	beta-xylosidase	NA	NA	NA	NA	NA
AZU32101.1|4687704_4687977_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32102.1|4688041_4689055_+	cation transporter	NA	NA	NA	NA	NA
AZU32103.1|4689146_4689869_-	phenol hydroxylase	NA	NA	NA	NA	NA
AZU32104.1|4690010_4691006_+	ABC transporter	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.1	1.0e-23
AZU32105.1|4691023_4691815_+	membrane protein	NA	NA	NA	NA	NA
AZU32106.1|4691820_4692759_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AZU32107.1|4693538_4693805_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU32108.1|4693825_4694626_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU32109.1|4694916_4695321_-	thioesterase	NA	NA	NA	NA	NA
AZU32110.1|4695357_4695810_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32111.1|4695847_4696174_-	thioredoxin	NA	NA	NA	NA	NA
AZU32112.1|4696145_4696640_-	flavodoxin	NA	A0A068CFW0	Listeria_phage	36.1	6.1e-17
AZU32113.1|4696865_4697336_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32114.1|4697335_4698034_-	hypothetical protein	NA	I3NLD4	Bifidobacterium_phage	28.1	1.6e-15
AZU32115.1|4698076_4699120_-	ribonucleotide-diphosphate reductase subunit beta	NA	A8ASV9	Listeria_phage	76.0	8.6e-154
AZU32116.1|4699297_4701796_-	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A088FNW1	Listeria_phage	67.1	6.4e-304
AZU32117.1|4702398_4703442_-	hypothetical protein	NA	A0A172Q0Y5	Acinetobacter_phage	50.7	1.1e-79
AZU32118.1|4703547_4706256_-	GCN5 family acetyltransferase	NA	NA	NA	NA	NA
AZU32119.1|4706370_4707738_-	magnesium transporter	NA	NA	NA	NA	NA
AZU32120.1|4708320_4709148_+	carbonic anhydrase	NA	NA	NA	NA	NA
AZU32121.1|4709365_4711171_+	potassium transporter KefB	NA	NA	NA	NA	NA
AZU32122.1|4711462_4711729_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU32123.1|4711812_4712550_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 25
CP012060	Xanthomonas sp. ISO98C4, complete genome	5225327	4969907	5041116	5225327	transposase	Bacillus_phage(33.33%)	49	NA	NA
AZU32306.1|4969907_4970174_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU32307.1|4970257_4970995_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU32308.1|4971267_4971510_+	hypothetical protein	NA	NA	NA	NA	NA
AZU32309.1|4971790_4972309_+	hypothetical protein	NA	NA	NA	NA	NA
AZU32310.1|4974622_4975462_+	hypothetical protein	NA	NA	NA	NA	NA
AZU32311.1|4977362_4977935_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32312.1|4978087_4978291_+	hypothetical protein	NA	NA	NA	NA	NA
AZU32313.1|4978725_4979706_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AZU32314.1|4980043_4982713_-	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AZU32315.1|4982712_4983684_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32316.1|4984094_4985147_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AZU32317.1|4985314_4988353_+	membrane protein	NA	NA	NA	NA	NA
AZU32565.1|4988404_4988527_+	hypothetical protein	NA	NA	NA	NA	NA
AZU32318.1|4988678_4991714_+	membrane protein	NA	NA	NA	NA	NA
AZU32319.1|4991737_4993339_+	tryptophan halogenase	NA	M4T1E3	Cyanophage	29.2	6.3e-47
AZU32320.1|4993723_4994452_-	orotidine 5'-phosphate decarboxylase	NA	NA	NA	NA	NA
AZU32321.1|4994448_4995414_-	acid phosphatase	NA	NA	NA	NA	NA
AZU32322.1|4995763_4996420_+	hypothetical protein	NA	NA	NA	NA	NA
AZU32323.1|4996583_4997435_-	radical SAM protein	NA	NA	NA	NA	NA
AZU32324.1|4997442_4998804_-	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AZU32325.1|4998800_4999643_-	metalloenzyme domain-containing protein	NA	NA	NA	NA	NA
AZU32326.1|4999611_5000706_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32327.1|5000725_5001637_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32328.1|5001779_5002901_+	ATPase AAA	NA	A0A2H4PB07	Aphanizomenon_phage	28.9	4.3e-18
AZU32329.1|5002897_5003311_+	hypothetical protein	NA	NA	NA	NA	NA
AZU32330.1|5003307_5005155_+	hypothetical protein	NA	NA	NA	NA	NA
AZU32331.1|5007953_5008988_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32332.1|5009039_5009576_-	acetyltransferase	NA	NA	NA	NA	NA
AZU32333.1|5010138_5012115_-	ATP-dependent DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.2	8.2e-113
AZU32334.1|5012323_5012953_+	thymidine kinase	NA	A0A023W530	Serratia_phage	55.6	6.7e-53
AZU32335.1|5013381_5014626_+	histidine kinase	NA	NA	NA	NA	NA
AZU32336.1|5014788_5016390_-	glucan biosynthesis protein D	NA	NA	NA	NA	NA
AZU32337.1|5016458_5017436_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32338.1|5018094_5018832_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU32339.1|5018915_5019182_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU32340.1|5019327_5020143_-	5-hydroxymethyluracil DNA glycosylase	NA	A0A127AWE5	Bacillus_phage	27.4	8.3e-19
AZU32341.1|5026902_5028084_+	membrane protein	NA	NA	NA	NA	NA
AZU32342.1|5028158_5030063_-	phytochrome	NA	Q6XLU9	Feldmannia_irregularis_virus	27.4	1.1e-18
AZU32343.1|5030059_5030653_-	heme oxygenase	NA	NA	NA	NA	NA
AZU32344.1|5030752_5032018_-	MFS transporter	NA	NA	NA	NA	NA
AZU32345.1|5032614_5034777_-	epimerase	NA	NA	NA	NA	NA
AZU32346.1|5034955_5035162_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32347.1|5035378_5035657_-	zinc chelation protein SecC	NA	NA	NA	NA	NA
AZU32348.1|5036955_5037315_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32349.1|5037326_5037641_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32350.1|5037721_5038492_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32351.1|5038594_5038936_+	transcriptional regulator	NA	NA	NA	NA	NA
AZU32352.1|5040028_5040295_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU32353.1|5040378_5041116_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 26
CP012060	Xanthomonas sp. ISO98C4, complete genome	5225327	5060786	5121213	5225327	integrase,transposase	uncultured_virus(66.67%)	41	5050330:5050344	5128501:5128515
5050330:5050344	attL	GCTGCAGGGCTTTGC	NA	NA	NA	NA
AZU32370.1|5060786_5062013_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU32371.1|5062184_5066207_+	ATP-binding protein	NA	NA	NA	NA	NA
AZU32372.1|5066281_5067085_-	membrane protein	NA	NA	NA	NA	NA
AZU32373.1|5067362_5068916_+|integrase	integrase	integrase	NA	NA	NA	NA
AZU32374.1|5069320_5070547_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU32375.1|5071055_5072675_+	enterochelin esterase	NA	NA	NA	NA	NA
AZU32376.1|5072778_5073177_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32377.1|5073940_5074633_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32378.1|5074663_5075566_-	pseudouridylate synthase	NA	NA	NA	NA	NA
AZU32379.1|5075898_5077476_+	chlamydia polymorphic membrane family protein	NA	NA	NA	NA	NA
AZU32380.1|5078400_5078667_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU32381.1|5078923_5079229_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32382.1|5083794_5085846_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32383.1|5085939_5086959_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32384.1|5088099_5090685_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32385.1|5091623_5092601_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32386.1|5092731_5094375_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32387.1|5094794_5095973_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32388.1|5096049_5097693_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32389.1|5097981_5098506_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32390.1|5098686_5099766_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32391.1|5099762_5100524_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32392.1|5100532_5100799_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32393.1|5100801_5101494_-	type III secretion system protein	NA	NA	NA	NA	NA
AZU32394.1|5101493_5102546_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32395.1|5102770_5103235_+	hypothetical protein	NA	NA	NA	NA	NA
AZU32396.1|5103734_5104172_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32397.1|5104173_5105523_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32398.1|5105525_5105885_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32399.1|5105945_5108042_-	type III secretion system protein InvA	NA	NA	NA	NA	NA
AZU32400.1|5108291_5109407_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32401.1|5112458_5113571_+	hypothetical protein	NA	NA	NA	NA	NA
AZU32402.1|5113603_5113873_+	hypothetical protein	NA	NA	NA	NA	NA
AZU32403.1|5113938_5114223_+	hypothetical protein	NA	NA	NA	NA	NA
AZU32404.1|5115675_5116350_+	hypothetical protein	NA	NA	NA	NA	NA
AZU32405.1|5116346_5116580_+	hypothetical protein	NA	NA	NA	NA	NA
AZU32406.1|5116761_5117076_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU32407.1|5117075_5117891_+|integrase	integrase	integrase	NA	NA	NA	NA
AZU32408.1|5118881_5119184_+	hypothetical protein	NA	NA	NA	NA	NA
AZU32409.1|5119727_5119988_+	hypothetical protein	NA	NA	NA	NA	NA
AZU32410.1|5120037_5121213_+|integrase	integrase	integrase	Q5QBN6	Enterobacteria_phage	25.4	8.5e-17
5128501:5128515	attR	GCTGCAGGGCTTTGC	NA	NA	NA	NA
>prophage 27
CP012060	Xanthomonas sp. ISO98C4, complete genome	5225327	5131059	5187691	5225327	transposase,tail	Shigella_phage(16.67%)	50	NA	NA
AZU32416.1|5131059_5132043_+|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
AZU32417.1|5132146_5132557_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32418.1|5134081_5134387_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32419.1|5134518_5135319_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU32420.1|5135339_5135606_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU32421.1|5135670_5136600_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32422.1|5136593_5137049_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32423.1|5137111_5137348_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32424.1|5137385_5137658_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	60.0	1.5e-20
AZU32425.1|5137675_5138530_+|transposase	transposase	transposase	U5P429	Shigella_phage	59.9	1.9e-90
AZU32426.1|5138660_5141045_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32427.1|5141111_5141480_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32428.1|5141498_5142056_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32429.1|5143484_5143751_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU32430.1|5143834_5144572_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU32431.1|5144568_5144769_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32432.1|5144886_5145732_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	42.7	1.5e-44
AZU32433.1|5145725_5145989_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU32434.1|5146654_5147386_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32435.1|5147377_5147704_+	hypothetical protein	NA	NA	NA	NA	NA
AZU32436.1|5148053_5151701_-	urea carboxylase	NA	NA	NA	NA	NA
AZU32437.1|5151784_5153584_-	allophanate hydrolase	NA	NA	NA	NA	NA
AZU32438.1|5153709_5153898_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32439.1|5153933_5154410_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
AZU32440.1|5154473_5155043_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZU32441.1|5155159_5155732_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZU32442.1|5155816_5156560_+	oxidoreductase	NA	A0A0M4JSW6	Mollivirus	28.8	5.0e-15
AZU32443.1|5156925_5157444_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32444.1|5158436_5158769_+	lipoprotein	NA	NA	NA	NA	NA
AZU32445.1|5159083_5161009_+	aminopeptidase precursor	NA	NA	NA	NA	NA
AZU32446.1|5161076_5161256_+	hypothetical protein	NA	NA	NA	NA	NA
AZU32447.1|5161358_5162747_-	nucleoside hydrolase	NA	NA	NA	NA	NA
AZU32448.1|5163101_5163392_-	XRE family transcriptional regulator	NA	M9MUN2	Rhodococcus_phage	52.5	2.8e-14
AZU32566.1|5163409_5163523_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32449.1|5163787_5166295_-	exodeoxyribonuclease V subunit alpha	NA	A0A0N9S864	Staphylococcus_phage	44.9	3.7e-09
AZU32450.1|5166482_5170469_-	exodeoxyribonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	21.9	2.4e-10
AZU32451.1|5170465_5173870_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
AZU32452.1|5174222_5178998_-	hemagglutinin	NA	F5B3Z3	Synechococcus_phage	50.5	9.4e-22
AZU32453.1|5179259_5179811_+	microcystin-dependent protein	NA	A0A0U4JQ24	Arthrobacter_phage	32.6	1.1e-11
AZU32454.1|5179858_5180386_+|tail	tail collar protein	tail	A0A0U4JYA4	Arthrobacter_phage	34.3	4.5e-18
AZU32455.1|5180990_5181539_+	acetyltransferase	NA	NA	NA	NA	NA
AZU32456.1|5181557_5181845_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32457.1|5182226_5183021_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
AZU32458.1|5183020_5183770_+	ABC transporter permease	NA	NA	NA	NA	NA
AZU32459.1|5183781_5184327_+	mammalian cell entry protein	NA	NA	NA	NA	NA
AZU32460.1|5184323_5184986_+	organic solvent ABC transporter	NA	NA	NA	NA	NA
AZU32461.1|5184975_5185266_+	anti-sigma B factor antagonist	NA	NA	NA	NA	NA
AZU32462.1|5185276_5186332_+	lipoprotein	NA	NA	NA	NA	NA
AZU32463.1|5186603_5187341_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU32464.1|5187424_5187691_-|transposase	transposase	transposase	NA	NA	NA	NA
