The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP019712	Lactobacillus plantarum strain Q7 chromosome, complete genome	2952198	2815	62845	2952198	tRNA,transposase,protease	Lactobacillus_phage(25.0%)	54	NA	NA
AZU38027.1|2815_4207_+|tRNA	tRNA modification GTPase	tRNA	NA	NA	NA	NA
AZU38028.1|4225_6136_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
AZU38029.1|6391_7129_+	cell surface protein	NA	NA	NA	NA	NA
AZU38030.1|7276_8338_+	cell surface protein	NA	NA	NA	NA	NA
AZU38031.1|8357_8699_+	cell surface protein	NA	NA	NA	NA	NA
AZU38032.1|8718_10242_+	cell surface protein	NA	NA	NA	NA	NA
AZU38033.1|10450_11038_+	signal peptidase I	NA	NA	NA	NA	NA
AZU38034.1|11265_12582_+	aminopeptidase	NA	R4TV59	Phaeocystis_globosa_virus	32.5	1.2e-59
AZU38035.1|12594_13017_+	transcriptional regulator	NA	NA	NA	NA	NA
AZU38036.1|13114_13981_-	fatty acid-binding protein DegV	NA	NA	NA	NA	NA
AZU38037.1|14138_14621_+	N-acetyltransferase	NA	NA	NA	NA	NA
AZU38038.1|15399_16200_+	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
AZU38039.1|16362_16899_-	phenolic acid decarboxylase	NA	NA	NA	NA	NA
AZU38040.1|17014_17560_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AZU38041.1|17748_18210_+	universal stress protein UspA	NA	NA	NA	NA	NA
AZU38042.1|18500_21104_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
AZU38043.1|21309_24885_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38044.1|24874_26935_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38045.1|27578_28577_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AZU38046.1|28680_29601_+	ribokinase	NA	NA	NA	NA	NA
AZU38047.1|29603_29999_+	D-ribose pyranase	NA	NA	NA	NA	NA
AZU38048.1|30028_30913_+	ribose transporter RbsU	NA	NA	NA	NA	NA
AZU38049.1|31217_32021_+	sorbitol-6-phosphate 2-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.1	1.0e-08
AZU38050.1|33233_33665_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
AZU38051.1|33637_34009_-|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	54.1	2.0e-28
AZU38052.1|34218_35319_+	lactate oxidase	NA	NA	NA	NA	NA
AZU38053.1|35947_36181_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38054.1|36720_37563_-|transposase	transposase	transposase	Q6J1X2	Lactobacillus_phage	99.3	3.9e-157
AZU38055.1|37616_37868_-|transposase	transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
AZU38056.1|37892_40040_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	38.9	3.7e-119
AZU38057.1|40407_41004_+	accessory regulator AgrB	NA	NA	NA	NA	NA
AZU38058.1|40984_41113_+	autoinducer-binding protein	NA	NA	NA	NA	NA
AZU38059.1|41122_42385_+	histidine kinase	NA	NA	NA	NA	NA
AZU38060.1|42377_43121_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AZU38061.1|43476_43914_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AZU38062.1|44071_45526_-	catalase	NA	A0A2K9L572	Tupanvirus	46.7	5.1e-104
AZU38063.1|45871_46117_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38064.1|46133_46268_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38065.1|46462_47011_+	ECF transporter S component	NA	NA	NA	NA	NA
AZU38066.1|47047_47242_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38067.1|47206_47578_-	hypothetical protein	NA	NA	NA	NA	NA
AZU38068.1|48045_49251_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AZU38069.1|49389_50076_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
AZU40657.1|50593_51781_+	glycosyl transferase	NA	NA	NA	NA	NA
AZU38070.1|51773_52028_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38071.1|52030_52912_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38072.1|53169_55560_-	phosphoketolase	NA	NA	NA	NA	NA
AZU38073.1|55715_56483_-	D-beta-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
AZU38074.1|56810_57281_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
AZU38075.1|57328_57625_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
AZU38076.1|57659_58931_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
AZU40658.1|59011_60070_+	sorbitol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	24.5	4.4e-12
AZU38077.1|60554_61562_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZU38078.1|61669_62845_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP019712	Lactobacillus plantarum strain Q7 chromosome, complete genome	2952198	696660	705174	2952198		Synechococcus_phage(33.33%)	9	NA	NA
AZU38627.1|696660_697146_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
AZU38628.1|697129_698260_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AZU38629.1|698262_698994_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	1.2e-37
AZU38630.1|698995_699250_+	phosphoribosylformylglycinamidine synthase	NA	NA	NA	NA	NA
AZU38631.1|699249_699930_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AZU38632.1|699922_702142_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.1	3.5e-144
AZU38633.1|702126_703581_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	2.5e-50
AZU38634.1|703577_704603_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.0	1.2e-59
AZU38635.1|704595_705174_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	1.3e-21
>prophage 3
CP019712	Lactobacillus plantarum strain Q7 chromosome, complete genome	2952198	871642	967518	2952198	capsid,integrase,holin,portal,transposase,tail,terminase	Lactobacillus_phage(57.69%)	117	907996:908017	967798:967818
AZU38782.1|871642_872809_-|integrase	site-specific integrase	integrase	A0A172LN96	Lactococcus_phage	38.7	1.6e-63
AZU38783.1|872868_873516_-	transcriptional regulator	NA	NA	NA	NA	NA
AZU38784.1|873658_873868_+	helix-turn-helix domain-containing protein	NA	D7RWM4	Brochothrix_phage	55.6	5.5e-12
AZU38785.1|873882_874578_+	phage regulatory protein	NA	A0A192Y918	Salmonella_phage	32.5	4.9e-20
AZU40679.1|874589_874856_+	DNA-binding protein	NA	NA	NA	NA	NA
AZU38786.1|874970_876146_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZU38787.1|876282_876582_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38788.1|876692_876986_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38789.1|877005_878274_+	helicase	NA	A0A2P0ZLC4	Lactobacillus_phage	72.9	1.5e-176
AZU38790.1|878547_878907_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38791.1|878967_879399_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38792.1|880297_881149_+	hypothetical protein	NA	NA	NA	NA	NA
AZU40680.1|882166_882502_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38793.1|883287_884226_-	EamA family transporter	NA	NA	NA	NA	NA
AZU38794.1|884290_884692_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38795.1|884701_886045_+	PFL family protein	NA	NA	NA	NA	NA
AZU38796.1|886417_887146_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	37.1	1.6e-34
AZU38797.1|887142_888666_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AZU38798.1|888961_890143_+	SAM-dependent methyltransferase	NA	W6LLI2	Streptococcus_phage	29.9	3.0e-46
AZU38799.1|890377_891235_+	glucose transporter GlcU	NA	NA	NA	NA	NA
AZU38800.1|891455_892808_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AZU38801.1|893233_893425_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38802.1|893829_895824_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.3	7.2e-32
AZU38803.1|895841_897419_+	poly(glycerol-phosphate) alpha-glucosyltransferase	NA	NA	NA	NA	NA
AZU38804.1|897390_899154_+	multidrug DMT transporter permease	NA	W8CYL7	Bacillus_phage	40.9	4.8e-96
AZU38805.1|899781_899913_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38806.1|900084_900228_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38807.1|900258_900390_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38808.1|900422_900554_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38809.1|900586_900718_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38810.1|900750_900894_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38811.1|900925_901057_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38812.1|901135_901267_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38813.1|901296_901428_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38814.1|901581_904512_+	mucus-binding protein	NA	NA	NA	NA	NA
AZU38815.1|904611_906585_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38816.1|906639_907125_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZU38817.1|907173_907446_-	hypothetical protein	NA	NA	NA	NA	NA
AZU38818.1|907470_907704_-	hypothetical protein	NA	NA	NA	NA	NA
907996:908017	attL	TTGGCTGTCCTTTTGGCTGACT	NA	NA	NA	NA
AZU38819.1|908192_909350_-|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	34.8	6.6e-54
907996:908017	attL	TTGGCTGTCCTTTTGGCTGACT	NA	NA	NA	NA
AZU38820.1|909428_910073_-	transcriptional regulator	NA	NA	NA	NA	NA
AZU38821.1|910221_910401_+	helix-turn-helix domain-containing protein	NA	E9LUT5	Lactobacillus_phage	89.7	2.5e-21
AZU38822.1|910443_910551_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38823.1|910683_910902_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38824.1|910898_911699_+	DNA replication protein	NA	NA	NA	NA	NA
AZU38825.1|911698_913093_+	virulence protein	NA	Q4ZD27	Staphylococcus_phage	35.8	2.7e-70
AZU38826.1|913236_913656_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38827.1|913680_913863_+	DUF2758 domain-containing protein	NA	NA	NA	NA	NA
AZU38828.1|913872_914211_+|tail	phage tail protein	tail	A0A2P0ZLF0	Lactobacillus_phage	35.6	4.6e-08
AZU38829.1|914203_914593_+	endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	45.2	3.0e-19
AZU38830.1|915206_915680_+|terminase	terminase	terminase	NA	NA	NA	NA
AZU38831.1|915676_917380_+|terminase	terminase	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	40.7	1.9e-121
AZU38832.1|917333_917534_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38833.1|917534_918635_+|portal	phage portal protein	portal	A0A2H4J9Q5	uncultured_Caudovirales_phage	34.6	1.4e-48
AZU38834.1|920250_920520_+	DNA-packaging protein	NA	NA	NA	NA	NA
AZU38835.1|920677_921058_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38836.1|921140_921452_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38837.1|921865_922072_+	hypothetical protein	NA	NA	NA	NA	NA
921538:921559	attR	TTGGCTGTCCTTTTGGCTGACT	NA	NA	NA	NA
AZU38838.1|922422_923544_-|integrase	site-specific integrase	integrase	D6PSS4	Lactobacillus_phage	32.1	1.1e-45
921538:921559	attR	TTGGCTGTCCTTTTGGCTGACT	NA	NA	NA	NA
AZU38839.1|923701_924718_-	DNA (cytosine-5-)-methyltransferase	NA	A0A0R6PG08	Moraxella_phage	34.0	2.8e-48
AZU38840.1|924728_925706_-	hypothetical protein	NA	NA	NA	NA	NA
AZU38841.1|925710_926082_+|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	54.1	2.0e-28
AZU38842.1|926054_926486_+|transposase	DDE transposase	transposase	NA	NA	NA	NA
AZU38843.1|926474_927422_-	hypothetical protein	NA	NA	NA	NA	NA
AZU38844.1|927582_927759_-	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	51.7	3.3e-10
AZU38845.1|928179_929052_-	hypothetical protein	NA	NA	NA	NA	NA
AZU38846.1|929102_930449_-	chromosome partitioning protein ParA	NA	A0A1B0Y697	Lactobacillus_phage	51.8	1.1e-81
AZU38847.1|930474_930888_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
AZU38848.1|930899_931262_-	transcriptional regulator	NA	A0A2R2ZGJ3	Clostridioides_phage	48.4	1.7e-08
AZU38849.1|931390_931618_+	transcriptional regulator	NA	NA	NA	NA	NA
AZU38850.1|931614_931815_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38851.1|931811_932033_-	hypothetical protein	NA	E8ZD70	Streptococcus_phage	66.2	1.4e-18
AZU38852.1|932091_932340_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38853.1|932369_932573_-	hypothetical protein	NA	NA	NA	NA	NA
AZU38854.1|932650_932821_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38855.1|932832_933138_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
AZU38856.1|933205_933718_+	transcriptional regulator	NA	D6PST4	Lactobacillus_phage	42.9	5.2e-27
AZU38857.1|933785_933956_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38858.1|934088_934202_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38859.1|934219_934750_+	hypothetical protein	NA	E9LUU0	Lactobacillus_phage	59.2	6.1e-55
AZU38860.1|934761_935727_+	hypothetical protein	NA	A6M982	Geobacillus_virus	54.5	5.3e-65
AZU38861.1|935809_936742_+	DnaD domain protein	NA	A0A0P0HRQ2	Lactobacillus_phage	44.0	5.1e-57
AZU38862.1|936738_937026_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38863.1|937022_937541_+	hypothetical protein	NA	O03915	Lactobacillus_phage	52.6	8.6e-38
AZU38864.1|937537_937921_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38865.1|937910_938042_+	hypothetical protein	NA	O03917	Lactobacillus_phage	88.4	3.3e-15
AZU38866.1|938187_938352_-	YjzC family protein	NA	A0A0A7RTS6	Clostridium_phage	66.0	3.0e-13
AZU40681.1|938485_938701_+	transcriptional regulator	NA	D2IZX1	Enterococcus_phage	39.1	4.7e-06
AZU38867.1|938693_938906_+	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	86.0	1.6e-11
AZU38868.1|939033_939495_+	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	56.3	4.1e-39
AZU38869.1|939759_940377_-	hypothetical protein	NA	NA	NA	NA	NA
AZU40682.1|941539_941839_+	hypothetical protein	NA	A0A1Q1PVT7	Staphylococcus_phage	36.0	2.8e-09
AZU38870.1|941900_942419_+|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	76.2	5.9e-63
AZU38871.1|942399_943743_+|terminase	terminase	terminase	O03927	Lactobacillus_phage	97.1	5.5e-262
AZU40683.1|943752_945279_+|capsid	capsid protein	capsid	O03928	Lactobacillus_phage	94.5	3.0e-280
AZU38872.1|947335_947566_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38873.1|947711_948326_+	hypothetical protein	NA	O03931	Lactobacillus_phage	82.8	6.3e-64
AZU38874.1|948343_949360_+	replication protein	NA	O03966	Lactobacillus_phage	97.3	3.4e-187
AZU38875.1|949386_949815_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38876.1|949814_950165_+|capsid	capsid protein	capsid	O03932	Lactobacillus_phage	87.1	2.9e-53
AZU38877.1|950164_950506_+|capsid	capsid protein	capsid	O03933	Lactobacillus_phage	80.2	6.7e-47
AZU38878.1|950505_950910_+|capsid	minor capsid protein	capsid	O03934	Lactobacillus_phage	94.8	1.4e-64
AZU38879.1|950944_951460_+|capsid	capsid protein	capsid	O03972	Lactobacillus_phage	87.7	1.1e-77
AZU38880.1|951512_951944_+	hypothetical protein	NA	O03935	Lactobacillus_phage	96.5	1.5e-72
AZU38881.1|951949_952573_+	hypothetical protein	NA	O03936	Lactobacillus_phage	96.0	1.4e-103
AZU38882.1|952576_957460_+|tail	phage tail tape measure protein	tail	O03937	Lactobacillus_phage	61.1	0.0e+00
AZU38883.1|957449_958289_+|tail	phage tail protein	tail	NA	NA	NA	NA
AZU38884.1|958288_959395_+	hypothetical protein	NA	A0A0B5CYL4	Listeria_phage	34.2	4.7e-41
AZU38885.1|959396_959852_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38886.1|959829_962391_+	SGNH/GDSL hydrolase family protein	NA	A0A2K9VC32	Lactobacillus_phage	47.3	1.2e-07
AZU40684.1|962859_963213_+	hypothetical protein	NA	D6PSR9	Lactobacillus_phage	49.1	6.7e-26
AZU38887.1|963205_963580_+	hypothetical protein	NA	NA	NA	NA	NA
AZU38888.1|963554_963815_+	hypothetical protein	NA	NA	NA	NA	NA
AZU40685.1|963792_964956_+	lysin	NA	O03950	Lactobacillus_phage	36.4	3.9e-38
AZU38889.1|964956_965253_+	hypothetical protein	NA	A0A2K9VCD4	Lactobacillus_phage	73.5	2.4e-37
AZU38890.1|965239_965623_+|holin	holin	holin	A0A2H4PBB2	Lactobacillus_phage	80.0	9.9e-15
AZU38891.1|966507_967518_+	Abi family protein	NA	A0A0H4U080	Erysipelothrix_phage	26.3	3.3e-25
967798:967818	attR	CCGTGCGGGTGATAAGTCGAC	NA	NA	NA	NA
>prophage 4
CP019712	Lactobacillus plantarum strain Q7 chromosome, complete genome	2952198	1813446	1821964	2952198		Lactobacillus_phage(85.71%)	7	NA	NA
AZU39673.1|1813446_1814442_-	glycosyltransferase	NA	S5FKN0	Shigella_phage	38.5	1.2e-51
AZU39674.1|1815301_1815742_+	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	98.6	3.0e-76
AZU39675.1|1815812_1816373_-	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	100.0	2.7e-101
AZU39676.1|1816460_1818899_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.4	0.0e+00
AZU39677.1|1818901_1819516_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	100.0	6.3e-112
AZU39678.1|1819859_1820807_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	100.0	2.7e-178
AZU39679.1|1820992_1821964_+	peptidase S41	NA	A0A2P0ZL68	Lactobacillus_phage	99.4	1.8e-182
>prophage 5
CP019712	Lactobacillus plantarum strain Q7 chromosome, complete genome	2952198	2159175	2225189	2952198	tRNA,protease,bacteriocin,transposase	Lactobacillus_phage(28.57%)	57	NA	NA
AZU39970.1|2159175_2159505_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AZU39971.1|2159713_2160382_-	phosphoglycerate mutase	NA	NA	NA	NA	NA
AZU40707.1|2160513_2161083_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZU39972.1|2161133_2161898_-	hypothetical protein	NA	NA	NA	NA	NA
AZU39973.1|2161894_2163145_-	hypothetical protein	NA	NA	NA	NA	NA
AZU39974.1|2163108_2164110_-	hypothetical protein	NA	NA	NA	NA	NA
AZU39975.1|2164529_2165294_-	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
AZU39976.1|2165647_2165974_+	transcriptional regulator	NA	NA	NA	NA	NA
AZU39977.1|2166165_2167047_-	RNA pseudouridine synthase	NA	NA	NA	NA	NA
AZU39978.1|2167089_2168898_-	DNA helicase RecQ	NA	M1PGQ0	Moumouvirus	36.1	1.0e-77
AZU39979.1|2169161_2169353_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZU39980.1|2169572_2169839_+	hypothetical protein	NA	NA	NA	NA	NA
AZU39981.1|2169889_2171122_+	hypothetical protein	NA	NA	NA	NA	NA
AZU39982.1|2171157_2172564_+	dipeptidase	NA	NA	NA	NA	NA
AZU39983.1|2173016_2174024_+	asparagine synthetase A	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	43.0	1.4e-63
AZU39984.1|2174062_2175358_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	31.2	3.2e-57
AZU39985.1|2175528_2176158_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AZU39986.1|2176266_2176740_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZU39987.1|2177015_2178905_-	FAD-binding dehydrogenase	NA	A0A2P0ZL82	Lactobacillus_phage	26.2	4.0e-16
AZU39988.1|2179091_2180018_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.8	4.2e-19
AZU39989.1|2180088_2180640_-	Cro/Cl family transcriptional regulator	NA	X2CXD8	Lactobacillus_phage	48.4	6.4e-07
AZU39990.1|2180739_2181492_-	transcriptional regulator	NA	NA	NA	NA	NA
AZU39991.1|2181560_2182055_-	hypothetical protein	NA	NA	NA	NA	NA
AZU39992.1|2182143_2182266_-	hypothetical protein	NA	NA	NA	NA	NA
AZU39993.1|2182471_2186041_+	mucus-binding protein	NA	NA	NA	NA	NA
AZU39994.1|2186155_2186686_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
AZU39995.1|2187049_2187367_-	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
AZU39996.1|2187372_2189163_-	ATP-dependent exonuclease	NA	NA	NA	NA	NA
AZU39997.1|2189304_2191839_-	peptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.2	7.9e-68
AZU39998.1|2192020_2192593_-	alpha-L-rhamnosidase	NA	NA	NA	NA	NA
AZU39999.1|2192698_2193031_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AZU40000.1|2193392_2194403_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
AZU40001.1|2194533_2195364_-	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
AZU40002.1|2195546_2196434_-|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	42.3	1.3e-33
AZU40003.1|2196430_2196961_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU40004.1|2197031_2197472_-	alkaline-shock protein	NA	NA	NA	NA	NA
AZU40005.1|2197532_2197955_-	alkaline-shock protein	NA	NA	NA	NA	NA
AZU40006.1|2197969_2198152_-	hypothetical protein	NA	NA	NA	NA	NA
AZU40007.1|2198164_2198710_-	hypothetical protein	NA	NA	NA	NA	NA
AZU40008.1|2198721_2198976_-	hypothetical protein	NA	NA	NA	NA	NA
AZU40009.1|2199216_2201064_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	23.3	4.5e-20
AZU40010.1|2201053_2201437_-	hypothetical protein	NA	NA	NA	NA	NA
AZU40011.1|2202031_2202388_-	hypothetical protein	NA	NA	NA	NA	NA
AZU40012.1|2202454_2203522_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
AZU40013.1|2204108_2206820_-	hypothetical protein	NA	NA	NA	NA	NA
AZU40014.1|2206982_2207297_+	transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	36.0	3.3e-08
AZU40015.1|2210311_2211004_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AZU40016.1|2211305_2214269_-	DNA helicase	NA	NA	NA	NA	NA
AZU40017.1|2214806_2215175_+	transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	42.7	5.9e-17
AZU40018.1|2215305_2216169_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.3	5.3e-40
AZU40019.1|2216395_2216764_+	hypothetical protein	NA	NA	NA	NA	NA
AZU40020.1|2217080_2218637_-	GMP synthetase	NA	A0A1V0SH76	Hokovirus	29.2	5.6e-16
AZU40021.1|2218730_2219660_-	type I pantothenate kinase	NA	NA	NA	NA	NA
AZU40022.1|2219828_2220758_-	2-nitropropane dioxygenase	NA	NA	NA	NA	NA
AZU40023.1|2221052_2223359_-	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
AZU40024.1|2223590_2224235_+	cytochrome O ubiquinol oxidase	NA	NA	NA	NA	NA
AZU40025.1|2224298_2225189_-|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	42.6	7.6e-50
>prophage 6
CP019712	Lactobacillus plantarum strain Q7 chromosome, complete genome	2952198	2413215	2421827	2952198		Streptococcus_phage(66.67%)	9	NA	NA
AZU40187.1|2413215_2414211_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.2	2.6e-51
AZU40188.1|2414349_2415135_-	acyl-ACP thioesterase	NA	NA	NA	NA	NA
AZU40189.1|2415138_2416035_-	rRNA (cytidine-2'-O-)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.7	9.9e-82
AZU40190.1|2416133_2416481_-	initiation-control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	2.4e-12
AZU40191.1|2416505_2417525_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.5	2.1e-32
AZU40192.1|2417541_2417871_-	hypothetical protein	NA	NA	NA	NA	NA
AZU40193.1|2417867_2418533_-	thymidylate kinase	NA	M1PSC7	Streptococcus_phage	52.7	1.4e-53
AZU40194.1|2418918_2419170_-	hypothetical protein	NA	NA	NA	NA	NA
AZU40195.1|2420129_2421827_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	3.9e-55
