The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP018902	Bacillus amyloliquefaciens strain HK1 chromosome, complete genome	4002836	631	30803	4002836	protease,terminase,head,capsid,holin,tail,portal	Bacillus_phage(24.0%)	41	NA	NA
AZV88266.1|631_1969_+	DNA helicase	NA	W8EEZ1	Geobacillus_phage	56.4	1.2e-136
AZV88267.1|1958_2171_+	hypothetical protein	NA	A0A0U4B0C8	Bacillus_phage	40.6	4.9e-08
AZV88268.1|2207_2324_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88269.1|2320_2449_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88270.1|2445_2646_+	hypothetical protein	NA	A0A1D6X868	Bacillus_phage	53.4	9.0e-12
AZV88271.1|2642_2870_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88272.1|2856_3057_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88273.1|3276_3792_+	RNA polymerase sigma 70	NA	A0A1L2JY33	Aeribacillus_phage	43.2	1.4e-27
AZV88274.1|3806_4223_-	pilus biosynthesis protein HicB	NA	A0A0K2CYJ8	Paenibacillus_phage	57.3	1.4e-38
AZV88275.1|4249_4435_-	hypothetical protein	NA	D6R431	Bacillus_phage	67.8	6.0e-18
AZV88276.1|4679_5405_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88277.1|5410_5989_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88278.1|6257_6365_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88279.1|6381_6486_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88280.1|6488_6803_+	endonuclease	NA	A0A0C5AEM7	Paenibacillus_phage	46.6	1.5e-16
AZV88281.1|7030_7486_+|terminase	terminase	terminase	Q8SBQ3	Clostridium_phage	35.2	2.4e-12
AZV88282.1|7475_9266_+|terminase	terminase	terminase	F8J1B1	Lactobacillus_phage	61.1	7.7e-211
AZV88283.1|9277_10498_+|portal	portal protein	portal	A0A0K2CZB0	Paenibacillus_phage	36.8	1.3e-65
AZV88284.1|10472_11195_+|protease	Clp protease proteolytic subunit ClpP	protease	A0A0C5AJ10	Paenibacillus_phage	65.2	1.1e-67
AZV88285.1|11191_12397_+|capsid	capsid protein	capsid	E9LUQ3	Lactobacillus_phage	49.0	4.8e-100
AZV88286.1|12410_12725_+	hypothetical protein	NA	H9A116	Staphylococcus_phage	41.7	9.6e-08
AZV88287.1|12731_13061_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AZV88288.1|13057_13486_+|head,tail	head-tail adaptor protein	head,tail	A0A0M5M1E5	Enterococcus_phage	44.3	2.0e-08
AZV88289.1|13482_13872_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88290.1|13929_14505_+|tail	tail protein	tail	A0A1I9KKC4	Lactobacillus_phage	36.4	6.0e-24
AZV88291.1|14580_14901_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88292.1|15083_20840_+|tail	tail protein	tail	A8ATV9	Listeria_phage	32.7	1.2e-15
AZV88293.1|20842_21682_+|tail	tail protein	tail	A8ATA8	Listeria_phage	32.8	9.7e-31
AZV88294.1|21691_22846_+	hypothetical protein	NA	A0A1W6JQ67	Staphylococcus_phage	33.6	1.9e-24
AZV88295.1|22838_23147_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88296.1|23143_24154_+	hypothetical protein	NA	Q4ZE16	Staphylococcus_virus	41.2	7.2e-65
AZV88297.1|24169_25456_+	phage infection protein	NA	A0A1J0MFQ3	Staphylococcus_phage	38.9	4.9e-82
AZV88298.1|25456_25792_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88299.1|25798_26041_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88300.1|26077_26293_+	bhlA	NA	A0A290GDY2	Caldibacillus_phage	53.6	2.0e-12
AZV88301.1|26304_26571_+|holin	holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	67.5	4.4e-22
AZV88302.1|26627_27785_+	acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	50.2	1.9e-69
AZV88303.1|27830_28778_-	hypothetical protein	NA	NA	NA	NA	NA
AZV88304.1|28841_29396_-	hypothetical protein	NA	NA	NA	NA	NA
AZV88305.1|29685_30453_+	phage protein	NA	D6R410	Bacillus_phage	94.5	1.8e-132
AZV88306.1|30506_30803_+	phage-like protein	NA	D6R410	Bacillus_phage	95.9	2.6e-47
>prophage 2
CP018902	Bacillus amyloliquefaciens strain HK1 chromosome, complete genome	4002836	48915	115254	4002836	protease,integrase,holin,tail,portal	Bacillus_phage(47.46%)	100	48746:48794	115532:115580
48746:48794	attL	CATTACATGCCGGTGTGGCGGAATTGGCAGACGCGCACGACTCAAAATC	NA	NA	NA	NA
AZV88320.1|48915_49875_+	tyrosine recombinase XerD	NA	A0A142F1N9	Bacillus_phage	49.4	1.5e-83
AZV88321.1|50062_50515_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88322.1|50511_50961_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88323.1|50976_51396_+	transcriptional regulator	NA	A0A2H4IZR0	uncultured_Caudovirales_phage	58.7	2.7e-34
AZV88324.1|51634_51958_+	hypothetical protein	NA	A0A0N9SHL8	Paenibacillus_phage	33.0	6.0e-05
AZV88325.1|51993_52176_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88326.1|52172_52508_+	hypothetical protein	NA	R4JGJ3	Bacillus_phage	39.0	9.9e-11
AZV88327.1|52507_52753_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88328.1|52736_53120_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88329.1|53106_53475_+	hypothetical protein	NA	A0A2H4J134	uncultured_Caudovirales_phage	47.4	1.1e-23
AZV88330.1|53502_54537_+	hypothetical protein	NA	R4JEY6	Bacillus_phage	38.4	1.3e-40
AZV88331.1|54533_54686_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88332.1|54703_54883_+	hypothetical protein	NA	A0A1P8CX65	Bacillus_phage	68.8	1.1e-11
AZV88333.1|54875_55655_+	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	54.8	1.6e-75
AZV88334.1|55651_56179_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88335.1|56175_56922_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88336.1|56921_58316_+	DNA helicase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	51.7	2.2e-128
AZV88337.1|58450_59446_+	DNA primase	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	47.0	2.1e-72
AZV88338.1|59755_59977_-	hypothetical protein	NA	NA	NA	NA	NA
AZV88339.1|60112_61297_+	hypothetical protein	NA	A0A0U3TNF6	Bacillus_phage	34.7	5.0e-57
AZV88340.1|61476_62106_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88341.1|62248_62410_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88342.1|62406_62925_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88343.1|62917_63016_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88344.1|63162_63933_+	single-stranded DNA-binding protein	NA	A0A0N9SJW5	Paenibacillus_phage	51.1	1.4e-55
AZV88345.1|63967_64402_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88346.1|64402_65665_+	hypothetical protein	NA	A0A142F1R1	Bacillus_phage	27.1	4.5e-24
AZV88347.1|65830_65995_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88348.1|66029_68315_+	DNA polymerase I 3'-5' exonuclease and polymerase domain	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	37.4	5.9e-123
AZV88349.1|68315_68612_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88350.1|68608_69667_+	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	52.3	7.3e-76
AZV88351.1|69666_69981_+	hypothetical protein	NA	A0A0F6YQ61	Sinorhizobium_phage	42.1	1.4e-19
AZV88352.1|69977_70541_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88353.1|70541_70904_+	hypothetical protein	NA	A0A0K2D038	Bacillus_phage	32.5	6.5e-08
AZV88354.1|70908_71154_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88355.1|71150_71336_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88356.1|71316_71697_+	ribonucleotide reductase	NA	A0A142F1R4	Bacillus_phage	53.4	1.0e-27
AZV88357.1|71686_72475_+	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A217ER63	Bacillus_phage	82.8	2.9e-122
AZV88358.1|72593_73358_+	endonuclease	NA	A0A024FSJ1	Bacillus_phage	72.0	6.0e-72
AZV88359.1|73596_74736_+	ribonucleoside-diphosphate reductase	NA	A0A217ER63	Bacillus_phage	77.3	4.2e-170
AZV88360.1|74762_74852_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88361.1|74852_75836_+	ribonucleotide-diphosphate reductase	NA	F8WQ21	Bacillus_phage	78.6	6.9e-145
AZV88362.1|75989_76136_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	NA	NA	NA	NA
AZV88363.1|76132_76696_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	55.1	1.6e-42
AZV88364.1|76695_76806_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88365.1|76806_77031_+	hypothetical protein	NA	A0A1P8CX04	Bacillus_phage	91.8	2.7e-33
AZV88366.1|77027_77723_+	hypothetical protein	NA	U5PWA7	Bacillus_virus	65.9	1.1e-83
AZV88367.1|77749_78316_+	SPBc2 prophage-derived protein YorM	NA	A0A142F1S8	Bacillus_phage	54.9	4.1e-25
AZV88368.1|78334_78838_+|protease	zinc-dependent metalloprotease	protease	NA	NA	NA	NA
AZV88369.1|78896_79745_+	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	44.0	1.3e-27
AZV88370.1|79741_80314_+	Dephospho-CoA kinase Dephosphocoenzyme A kinase	NA	J9Q953	Bacillus_phage	43.5	6.8e-36
AZV88371.1|80310_81531_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1P8CX13	Bacillus_phage	75.5	9.1e-139
AZV88372.1|81503_81884_-	hypothetical protein	NA	NA	NA	NA	NA
AZV88373.1|81962_82352_+	RNA polymerase sigma factor sigK Sigma-K factor	NA	A0A0N9RZI0	Paenibacillus_phage	44.2	8.8e-19
AZV88374.1|82344_82833_+	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	47.0	4.9e-19
AZV88375.1|82920_83721_+	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	54.6	9.1e-71
AZV88376.1|83849_84011_-	hypothetical protein	NA	NA	NA	NA	NA
AZV88377.1|84050_84863_-	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	62.5	6.2e-99
AZV88378.1|84954_85314_-	hypothetical protein	NA	NA	NA	NA	NA
AZV88379.1|85328_85508_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	81.4	1.3e-22
AZV88380.1|85638_86076_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	67.4	2.8e-50
AZV88381.1|86072_86189_-	hypothetical protein	NA	NA	NA	NA	NA
AZV88382.1|86181_86382_-	hypothetical protein	NA	NA	NA	NA	NA
AZV88383.1|86587_86734_-	hypothetical protein	NA	NA	NA	NA	NA
AZV88384.1|86849_87080_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88385.1|87170_87944_+	hypothetical protein	NA	A0A0S2SXZ1	Bacillus_phage	57.8	1.5e-73
AZV88386.1|89159_89441_+	hypothetical protein	NA	A0A1S5SBT9	Streptococcus_phage	57.5	7.5e-20
AZV88387.1|89427_89589_+	hypothetical protein	NA	R4JMM6	Bacillus_phage	86.3	5.2e-18
AZV88388.1|89888_90023_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88389.1|90043_90334_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88390.1|90531_91080_-|integrase	integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	51.6	1.8e-38
AZV88391.1|91162_92917_+	hypothetical protein	NA	A0A2H4J484	uncultured_Caudovirales_phage	71.6	9.8e-251
AZV88392.1|92933_93365_+	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	49.6	3.8e-31
AZV88393.1|93367_94999_+|portal	portal protein	portal	A0A2H4J180	uncultured_Caudovirales_phage	57.0	1.8e-166
AZV88394.1|94998_95823_+	type IV secretion protein Rhs	NA	A0A0N9SJR1	Paenibacillus_phage	51.6	2.9e-72
AZV88395.1|95913_96585_+	molecular chaperone ClpB	NA	A0A2H4IZP8	uncultured_Caudovirales_phage	46.0	7.8e-15
AZV88396.1|96596_97700_+	hypothetical protein	NA	A0A2I7S650	Vibrio_phage	27.3	2.2e-30
AZV88397.1|97751_98006_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88398.1|98008_98227_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88399.1|98240_98627_+	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	39.8	3.5e-20
AZV88400.1|98642_98963_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88401.1|98959_99367_+	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	53.7	1.8e-30
AZV88402.1|99787_100342_+	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	58.4	4.0e-49
AZV88403.1|100400_100772_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88404.1|100867_101104_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88405.1|101104_101713_+|tail	tail protein	tail	A0A0N9SJR9	Paenibacillus_phage	42.2	7.0e-31
AZV88406.1|101961_104187_+|tail	tail protein	tail	A0A0N9SJR9	Paenibacillus_phage	36.7	1.8e-55
AZV88407.1|104190_105615_+	glycoside hydrolase family 73	NA	A0A2H4JBY6	uncultured_Caudovirales_phage	43.2	2.6e-60
AZV88408.1|105626_107027_+	endopeptidase	NA	A0A0U4JID8	Exiguobacterium_phage	30.1	1.4e-34
AZV88409.1|107041_109606_+	peptidase G2	NA	D6R401	Bacillus_phage	74.1	0.0e+00
AZV88410.1|109618_111055_+	hypothetical protein	NA	M4ZRP1	Bacillus_phage	52.8	1.5e-68
AZV88411.1|111069_111339_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88412.1|111339_111528_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88413.1|111531_111741_+	bhlA	NA	A0A290GDY2	Caldibacillus_phage	45.1	2.6e-09
AZV88414.1|111820_112759_+	acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	65.3	8.1e-95
AZV88415.1|112780_113038_+|holin	holin	holin	A0A0U4JE55	Bacillus_phage	57.6	5.0e-23
AZV88416.1|113139_113691_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88417.1|113706_114042_-	hypothetical protein	NA	O64030	Bacillus_phage	35.7	8.9e-12
AZV88418.1|114101_114308_-	DNA-binding protein	NA	NA	NA	NA	NA
AZV88419.1|114444_115254_+	hypothetical protein	NA	A0A288WFX2	Bacillus_phage	29.7	1.3e-16
115532:115580	attR	CATTACATGCCGGTGTGGCGGAATTGGCAGACGCGCACGACTCAAAATC	NA	NA	NA	NA
>prophage 3
CP018902	Bacillus amyloliquefaciens strain HK1 chromosome, complete genome	4002836	364523	397045	4002836	coat,tRNA	Planktothrix_phage(16.67%)	38	NA	NA
AZV88669.1|364523_365516_-|tRNA	tryptophanyl-tRNA synthetase	tRNA	NA	NA	NA	NA
AZV88670.1|366260_367895_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZV88671.1|368001_368937_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AZV88672.1|368940_369858_+	diguanylate cyclase	NA	NA	NA	NA	NA
AZV88673.1|369870_370947_+	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	1.7e-16
AZV88674.1|370939_371857_+	peptide ABC transporter substrate-binding protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.5e-05
AZV88675.1|371964_373152_+	GTP-binding protein	NA	NA	NA	NA	NA
AZV88676.1|373269_373848_+	acetyltransferase	NA	NA	NA	NA	NA
AZV88677.1|374025_374421_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AZV88678.1|374478_375135_-	membrane protein	NA	A0A0S4KZH7	Pseudomonas_phage	41.0	1.3e-30
AZV88679.1|375317_376067_+	adaptor protein	NA	NA	NA	NA	NA
AZV88680.1|376218_377379_+	competence protein CoiA	NA	NA	NA	NA	NA
AZV88681.1|377607_379437_+	oligopeptidase PepB	NA	NA	NA	NA	NA
AZV88682.1|379472_379640_-	membrane protein	NA	NA	NA	NA	NA
AZV88683.1|379924_380827_-	hypothetical protein	NA	NA	NA	NA	NA
AZV88684.1|380823_381222_-	thiol management oxidoreductase	NA	NA	NA	NA	NA
AZV88685.1|381446_382133_-	lytic transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	70.3	1.3e-38
AZV88686.1|382137_382710_-	hypothetical protein	NA	NA	NA	NA	NA
AZV88687.1|382834_383200_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88688.1|383227_383863_+	GTP pyrophosphokinase	NA	NA	NA	NA	NA
AZV88689.1|383880_384681_+	inorganic polyphosphate/ATP-NAD kinase	NA	NA	NA	NA	NA
AZV88690.1|384695_385589_+	RNA pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	30.6	5.7e-05
AZV88691.1|385622_386372_-	metallophosphatase	NA	A0A1V0SJW2	Klosneuvirus	26.0	2.9e-10
AZV88692.1|386597_387212_+	Na+/H+ antiporter	NA	NA	NA	NA	NA
AZV88693.1|387635_388346_+	thiaminase	NA	NA	NA	NA	NA
AZV88694.1|388320_388938_+	transcriptional regulator	NA	NA	NA	NA	NA
AZV88695.1|388921_390031_+	glycine oxidase	NA	NA	NA	NA	NA
AZV88696.1|390027_390231_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
AZV88697.1|390233_390998_+	thiazole synthase	NA	NA	NA	NA	NA
AZV88698.1|390994_392005_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
AZV88699.1|392027_392840_+	phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AZV88700.1|392970_393747_+	enoyl-ACP reductase	NA	NA	NA	NA	NA
AZV88701.1|393844_394432_+|coat	spore coat protein	coat	NA	NA	NA	NA
AZV88702.1|394489_394933_-|coat	spore coat protein	coat	NA	NA	NA	NA
AZV88703.1|395081_395564_-|coat	spore coat protein	coat	NA	NA	NA	NA
AZV88704.1|395713_396214_-|coat	spore coat protein	coat	NA	NA	NA	NA
AZV88705.1|396306_396621_-|coat	spore coat protein	coat	NA	NA	NA	NA
AZV88706.1|396658_397045_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 4
CP018902	Bacillus amyloliquefaciens strain HK1 chromosome, complete genome	4002836	456760	503630	4002836	holin,protease,terminase,portal	Bacillus_phage(33.33%)	55	NA	NA
AZV88774.1|456760_458113_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.9	6.0e-14
AZV88775.1|458539_458731_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88776.1|458898_459663_-	membrane protein	NA	NA	NA	NA	NA
AZV88777.1|459806_460274_-	hypothetical protein	NA	NA	NA	NA	NA
AZV88778.1|460484_461615_+	aspartate phosphatase	NA	A0A1P8CWN8	Bacillus_phage	47.9	1.7e-94
AZV88779.1|461604_461739_+	phosphatase	NA	NA	NA	NA	NA
AZV88780.1|461882_462836_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	69.9	9.9e-64
AZV88781.1|462873_463251_-	hypothetical protein	NA	A5GYQ0	Lactococcus_phage	37.6	3.3e-15
AZV88782.1|463360_463963_+	hypothetical protein	NA	A0A0Y0AJU6	Bacillus_phage	46.3	3.7e-40
AZV88783.1|464105_464696_-|portal	phage portal protein	portal	A0A2H4JA43	uncultured_Caudovirales_phage	52.3	1.8e-39
AZV88784.1|464843_465182_-	XRE family transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	49.2	9.9e-19
AZV88785.1|465372_465552_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88786.1|466268_467069_+	hypothetical protein	NA	A6XMI1	Bacillus_virus	44.3	2.3e-58
AZV88787.1|467068_467236_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88788.1|467333_467675_+|portal	phage portal protein	portal	NA	NA	NA	NA
AZV88789.1|467664_467868_+|portal	phage portal protein	portal	A0A2H4J4M6	uncultured_Caudovirales_phage	48.5	9.2e-12
AZV88790.1|467980_468490_+	RNA polymerase sigma 70	NA	A0A0K2CNQ1	Brevibacillus_phage	43.3	3.2e-21
AZV88791.1|468604_469402_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	49.0	1.2e-59
AZV88792.1|469398_470697_+|terminase	terminase	terminase	M4ZRM5	Bacillus_phage	59.7	2.3e-148
AZV88793.1|470700_472137_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.1	1.2e-140
AZV88794.1|472156_472999_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	57.6	5.7e-55
AZV88795.1|473025_473961_+|portal	phage portal protein	portal	A0A1B1P7E3	Bacillus_phage	62.8	3.3e-104
AZV88796.1|474356_474713_+|portal	phage portal protein	portal	NA	NA	NA	NA
AZV88797.1|474709_475213_+|portal	phage portal protein	portal	A0A249XXA4	Clostridium_phage	41.7	9.2e-37
AZV88798.1|475209_475656_+|portal	phage portal protein	portal	NA	NA	NA	NA
AZV88799.1|475652_475862_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88800.1|475861_477259_+|portal	phage portal protein	portal	A0A0A7RTT5	Clostridium_phage	40.9	3.4e-81
AZV88801.1|477260_477704_+|portal	phage portal protein	portal	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
AZV88802.1|477778_478225_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.0e-10
AZV88803.1|478248_478419_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88804.1|478406_483611_+|portal	phage portal protein	portal	A0A1L2JY60	Aeribacillus_phage	47.0	9.0e-42
AZV88805.1|483603_484263_+|portal	phage portal protein	portal	A0A090DBR9	Clostridium_phage	33.5	4.5e-23
AZV88806.1|484276_485254_+|portal	phage portal protein	portal	A0A1L6BY20	Clostridium_phage	29.8	3.7e-34
AZV88807.1|485253_485520_+|portal	phage portal protein	portal	S6C459	Thermus_phage	37.5	2.6e-06
AZV88808.1|485669_486095_+|portal	phage portal protein	portal	A0A0A7RTU4	Clostridium_phage	34.1	5.6e-11
AZV88809.1|486087_487128_+|portal	phage portal protein	portal	S6AVU3	Thermus_phage	43.2	9.4e-68
AZV88810.1|487111_487690_+|portal	phage portal protein	portal	A0A0A7RTT8	Clostridium_phage	30.3	2.4e-12
AZV88811.1|487686_487959_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88812.1|487961_489926_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	34.5	5.0e-54
AZV88813.1|489938_490337_+	hypothetical protein	NA	NA	NA	NA	NA
AZV88814.1|490323_490521_+	hypothetical protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	63.6	1.5e-14
AZV88815.1|490569_491331_+|portal	phage portal protein	portal	NA	NA	NA	NA
AZV88816.1|491384_491648_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.3	4.0e-23
AZV88817.1|491661_491925_+|holin	holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	5.2e-23
AZV88818.1|491938_492817_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	60.9	2.2e-81
AZV88819.1|493072_493243_-	stage II sporulation protein SB	NA	NA	NA	NA	NA
AZV88820.1|493242_493989_-	stage II sporulation protein SA	NA	NA	NA	NA	NA
AZV88821.1|494096_495095_-	inorganic phosphate transporter	NA	NA	NA	NA	NA
AZV88822.1|495107_495725_-	hypothetical protein	NA	NA	NA	NA	NA
AZV88823.1|496009_497326_-	serine/threonine exchanger SteT	NA	NA	NA	NA	NA
AZV88824.1|497648_498599_+	glyoxalase	NA	NA	NA	NA	NA
AZV88825.1|498783_500931_+	mannosyltransferase	NA	NA	NA	NA	NA
AZV88826.1|500943_501915_+	glycosyltransferase	NA	A0A2H5BFL1	Salmonella_phage	42.3	1.0e-63
AZV88827.1|502005_502182_-	hypothetical protein	NA	NA	NA	NA	NA
AZV88828.1|502277_503630_-|protease	serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	33.3	7.0e-23
>prophage 5
CP018902	Bacillus amyloliquefaciens strain HK1 chromosome, complete genome	4002836	990813	997024	4002836		Bacillus_phage(66.67%)	7	NA	NA
AZV89261.1|990813_991206_+	ribonucleotide reductase	NA	G3MBF1	Bacillus_virus	60.0	1.7e-30
AZV89262.1|991165_993268_+	ribonucleotide-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	85.5	0.0e+00
AZV89263.1|993285_994275_+	ribonucleotide-diphosphate reductase	NA	F8WQ21	Bacillus_phage	83.3	5.1e-156
AZV89264.1|994323_994944_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	47.9	2.7e-46
AZV89265.1|994992_995175_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
AZV89266.1|995171_995750_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N6W8I1	Bacillus_phage	51.6	8.1e-45
AZV89267.1|996055_997024_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.9	8.0e-53
>prophage 6
CP018902	Bacillus amyloliquefaciens strain HK1 chromosome, complete genome	4002836	1167034	1177437	4002836		Bacillus_phage(71.43%)	14	NA	NA
AZV89391.1|1167034_1167655_+	XRE family transcriptional regulator	NA	A0A1B2APZ1	Phage_Wrath	62.3	8.5e-16
AZV89392.1|1168003_1168432_-	hypothetical protein	NA	NA	NA	NA	NA
AZV89393.1|1168588_1169038_+	membrane protein	NA	NA	NA	NA	NA
AZV89394.1|1169065_1169896_-	hypothetical protein	NA	A0A172JI70	Bacillus_phage	72.3	8.5e-104
AZV89395.1|1169882_1170032_-	hypothetical protein	NA	NA	NA	NA	NA
AZV89396.1|1170138_1170960_-	hypothetical protein	NA	O64134	Bacillus_phage	42.6	5.3e-50
AZV89397.1|1171165_1171351_+	hypothetical protein	NA	NA	NA	NA	NA
AZV89398.1|1171401_1171836_-	deoxyuridine 5'-triphosphate nucleotidohydrolase yncF	NA	A0A1P8CX51	Bacillus_phage	87.3	4.6e-69
AZV89399.1|1172006_1172246_-	membrane protein	NA	M4ZS56	Bacillus_phage	63.0	4.5e-18
AZV89400.1|1172533_1174951_+	peptidase G2	NA	D6R401	Bacillus_phage	50.1	6.5e-221
AZV89401.1|1175116_1175284_+	hypothetical protein	NA	NA	NA	NA	NA
AZV89402.1|1175612_1176149_+	hypothetical protein	NA	NA	NA	NA	NA
AZV89403.1|1176565_1176655_+	hypothetical protein	NA	NA	NA	NA	NA
AZV89404.1|1176816_1177437_-	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	35.5	9.7e-20
>prophage 7
CP018902	Bacillus amyloliquefaciens strain HK1 chromosome, complete genome	4002836	1419507	1425760	4002836		Staphylococcus_phage(66.67%)	9	NA	NA
AZV89690.1|1419507_1420101_-	segregation and condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.0e-14
AZV89691.1|1420090_1420846_-	segregation and condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.3	1.9e-09
AZV89692.1|1421053_1421143_+	hypothetical protein	NA	NA	NA	NA	NA
AZV89693.1|1421230_1421752_+	hypothetical protein	NA	NA	NA	NA	NA
AZV89694.1|1421817_1422192_-	protein RibT	NA	NA	NA	NA	NA
AZV89695.1|1422308_1422773_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	7.2e-44
AZV89696.1|1422805_1424002_-	3,4-dihydroxy-2-butanone 4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	54.7	2.1e-116
AZV89697.1|1424016_1424664_-	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	2.0e-39
AZV89698.1|1424644_1425760_-	5-amino-6-(5-phosphoribosylamino)uracil reductase	NA	A0A2H4PQS8	Staphylococcus_phage	35.7	2.2e-54
>prophage 8
CP018902	Bacillus amyloliquefaciens strain HK1 chromosome, complete genome	4002836	2064470	2090064	4002836	holin,terminase,capsid,portal	Bacillus_phage(35.0%)	34	NA	NA
AZV90356.1|2064470_2064695_+	hypothetical protein	NA	A0A2K5B263	Erysipelothrix_phage	40.3	1.7e-06
AZV90357.1|2064817_2065120_+	hypothetical protein	NA	NA	NA	NA	NA
AZV90358.1|2065175_2065463_-	hypothetical protein	NA	NA	NA	NA	NA
AZV90359.1|2065495_2066917_-	lipase	NA	NA	NA	NA	NA
AZV90360.1|2066961_2067327_+	hypothetical protein	NA	NA	NA	NA	NA
AZV90361.1|2067357_2067600_-	DNA-binding protein	NA	A0A2H4JDR0	uncultured_Caudovirales_phage	54.4	8.7e-17
AZV90362.1|2067833_2067941_-	hypothetical protein	NA	NA	NA	NA	NA
AZV90363.1|2068063_2068735_-	hypothetical protein	NA	F8WPX5	Bacillus_phage	72.5	1.7e-65
AZV90364.1|2068776_2069184_-|holin	holin	holin	D6R405	Bacillus_phage	67.2	1.6e-39
AZV90365.1|2069221_2069395_-	hypothetical protein	NA	M4ZS22	Bacillus_phage	86.0	4.4e-15
AZV90366.1|2069397_2069679_-	hypothetical protein	NA	O64053	Bacillus_phage	48.4	8.2e-19
AZV90367.1|2069675_2070743_-	hypothetical protein	NA	Q9ZXE1	Bacillus_phage	55.5	8.2e-67
AZV90368.1|2070966_2073555_-	peptidase G2	NA	D6R401	Bacillus_phage	52.0	1.3e-248
AZV90369.1|2073569_2075450_-	autolysin	NA	M5AC19	Bacillus_phage	26.8	8.5e-51
AZV90370.1|2075464_2076298_-	hypothetical protein	NA	NA	NA	NA	NA
AZV90371.1|2076309_2080083_-	hypothetical protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	56.4	9.5e-110
AZV90372.1|2080149_2080335_-	hypothetical protein	NA	NA	NA	NA	NA
AZV90373.1|2080346_2080697_-	hypothetical protein	NA	NA	NA	NA	NA
AZV90374.1|2080784_2081369_-	UDP-N-acetylmuramoylalanine--D-glutamate ligase	NA	U3PCW8	Staphylococcus_phage	37.2	1.1e-25
AZV90375.1|2081401_2081785_-	hypothetical protein	NA	NA	NA	NA	NA
AZV90376.1|2081781_2082165_-	hypothetical protein	NA	A0A0M5M1E5	Enterococcus_phage	34.4	8.6e-11
AZV90377.1|2082164_2082488_-	hypothetical protein	NA	A0A249XUC8	Enterococcus_phage	41.0	8.0e-10
AZV90378.1|2082474_2082771_-	hypothetical protein	NA	A0A2H4J8T8	uncultured_Caudovirales_phage	37.6	6.2e-09
AZV90379.1|2082826_2084020_-|capsid	capsid protein	capsid	U5U4N8	Lactobacillus_phage	50.9	2.3e-70
AZV90380.1|2084057_2084654_-	peptidase U35	NA	A0A1Q1PVX3	Staphylococcus_phage	53.8	2.3e-42
AZV90381.1|2084646_2085891_-|portal	phage portal protein	portal	A0A2H4J331	uncultured_Caudovirales_phage	38.0	3.9e-68
AZV90382.1|2085895_2086099_-	hypothetical protein	NA	NA	NA	NA	NA
AZV90383.1|2086110_2087814_-|terminase	terminase	terminase	A0A1Q1PVU8	Staphylococcus_phage	34.9	1.8e-92
AZV90384.1|2087810_2088284_-|terminase	terminase	terminase	A0A2H4JB21	uncultured_Caudovirales_phage	33.6	4.0e-18
AZV90385.1|2088555_2088789_-	hypothetical protein	NA	NA	NA	NA	NA
AZV90386.1|2088803_2089187_-	hypothetical protein	NA	NA	NA	NA	NA
AZV90387.1|2089201_2089492_-	hypothetical protein	NA	NA	NA	NA	NA
AZV90388.1|2089485_2089677_-	hypothetical protein	NA	NA	NA	NA	NA
AZV90389.1|2089680_2090064_-	hypothetical protein	NA	A0A2H4JI60	uncultured_Caudovirales_phage	36.2	4.3e-10
>prophage 9
CP018902	Bacillus amyloliquefaciens strain HK1 chromosome, complete genome	4002836	2251919	2293328	4002836	holin,terminase,capsid,portal	Bacillus_phage(47.37%)	50	NA	NA
AZV90551.1|2251919_2252756_+	chitosanase	NA	A0A223LHY0	Streptomyces_phage	31.0	3.4e-20
AZV90552.1|2253215_2253368_+	hypothetical protein	NA	NA	NA	NA	NA
AZV90553.1|2253400_2253763_-	hypothetical protein	NA	NA	NA	NA	NA
AZV90554.1|2253778_2254258_-	hypothetical protein	NA	NA	NA	NA	NA
AZV90555.1|2254421_2255435_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1J0MS59	Bacillus_phage	95.3	5.4e-185
AZV90556.1|2255483_2255906_-|holin	holin	holin	D6R405	Bacillus_phage	87.9	2.7e-58
AZV90557.1|2255956_2256145_-	hypothetical protein	NA	Q9ZXD9	Bacillus_phage	96.8	5.3e-30
AZV90558.1|2256141_2256504_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	89.1	5.1e-53
AZV90559.1|2256500_2257637_-	hypothetical protein	NA	D6R402	Bacillus_phage	77.6	3.3e-135
AZV90560.1|2257649_2260232_-	peptidase G2	NA	D6R401	Bacillus_phage	57.4	1.9e-290
AZV90561.1|2260246_2261965_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	69.4	2.5e-222
AZV90562.1|2261977_2262814_-	hypothetical protein	NA	D6R3Z9	Bacillus_phage	68.6	8.0e-110
AZV90563.1|2262814_2266561_-	hypothetical protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	58.4	3.1e-113
AZV90564.1|2266815_2267178_-	hypothetical protein	NA	NA	NA	NA	NA
AZV90565.1|2267235_2267814_-	UDP-N-acetylmuramoylalanine--D-glutamate ligase	NA	J7KKC8	Streptococcus_phage	39.9	9.6e-30
AZV90566.1|2267833_2268226_-	hypothetical protein	NA	NA	NA	NA	NA
AZV90567.1|2268222_2268612_-	hypothetical protein	NA	I7A9A4	Enterococcus_phage	35.0	2.2e-09
AZV90568.1|2268611_2268938_-	hypothetical protein	NA	NA	NA	NA	NA
AZV90569.1|2268927_2269221_-	hypothetical protein	NA	A0A2H4JB77	uncultured_Caudovirales_phage	39.6	8.6e-11
AZV90570.1|2269272_2269713_-	hypothetical protein	NA	D6R3Z0	Bacillus_phage	58.3	1.7e-10
AZV90571.1|2269740_2270940_-|capsid	capsid protein	capsid	A0A2H4J3W9	uncultured_Caudovirales_phage	49.8	3.1e-75
AZV90572.1|2270988_2271585_-	peptidase U35	NA	A0A1J0MFL1	Staphylococcus_phage	52.2	3.1e-47
AZV90573.1|2271577_2272804_-|portal	phage portal protein	portal	A0A2H4J331	uncultured_Caudovirales_phage	38.0	1.2e-66
AZV90574.1|2272808_2273015_-	hypothetical protein	NA	NA	NA	NA	NA
AZV90575.1|2273031_2274765_-|terminase	terminase	terminase	A0A1W6JPU1	Staphylococcus_phage	48.2	8.1e-141
AZV90576.1|2274754_2275240_-|terminase	terminase	terminase	A0A1J0MG04	Staphylococcus_phage	36.5	4.8e-14
AZV90577.1|2276096_2276255_-	hypothetical protein	NA	NA	NA	NA	NA
AZV90578.1|2276324_2276705_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	75.6	1.0e-43
AZV90579.1|2276701_2278057_-	DEAD/DEAH box helicase	NA	S5MA26	Brevibacillus_phage	66.1	5.3e-180
AZV90580.1|2278147_2278321_-	nuclease	NA	Q3LZN4	Bacteriophage	59.6	5.6e-10
AZV90581.1|2278603_2281018_-	hypothetical protein	NA	A0A0A7RTG3	Clostridium_phage	56.0	7.6e-278
AZV90582.1|2281040_2281214_-	hypothetical protein	NA	M4ZR07	Bacillus_phage	50.9	9.6e-10
AZV90583.1|2281329_2283276_-	XRE family transcriptional regulator	NA	S5M5X4	Brevibacillus_phage	66.9	5.4e-250
AZV90584.1|2283272_2283821_-	hypothetical protein	NA	Q38587	Bacillus_phage	62.8	4.8e-23
AZV90585.1|2283879_2284449_-	hypothetical protein	NA	S5MC21	Brevibacillus_phage	74.9	1.3e-76
AZV90586.1|2284504_2284834_-	hypothetical protein	NA	A0A2P0ZLA7	Lactobacillus_phage	50.0	5.5e-22
AZV90587.1|2284848_2286027_-	hypothetical protein	NA	S5MUB5	Brevibacillus_phage	61.4	1.5e-133
AZV90588.1|2286023_2286419_-	hypothetical protein	NA	NA	NA	NA	NA
AZV90589.1|2286431_2286833_-	hypothetical protein	NA	NA	NA	NA	NA
AZV90590.1|2286925_2287027_-	hypothetical protein	NA	D6R417	Bacillus_phage	63.6	7.0e-05
AZV90591.1|2287023_2287293_-	phage protein	NA	Q9ZXC9	Bacillus_phage	47.7	1.3e-18
AZV90592.1|2287289_2287436_-	hypothetical protein	NA	NA	NA	NA	NA
AZV90593.1|2287408_2287678_-	hypothetical protein	NA	A0A0S2SXU9	Bacillus_phage	64.0	2.3e-26
AZV90594.1|2287679_2287865_-	transcriptional regulator	NA	A0A0M3ULF9	Bacillus_phage	68.9	6.8e-14
AZV90595.1|2288133_2288562_+	Cro/Cl family transcriptional regulator	NA	Q5YAA4	Bacillus_phage	58.9	6.9e-41
AZV90596.1|2288570_2288993_+	hypothetical protein	NA	A0A0S2SXM3	Bacillus_phage	60.9	8.0e-42
AZV90597.1|2289037_2290195_+	tyrosine recombinase XerC	NA	S5MBZ0	Brevibacillus_phage	67.8	2.6e-151
AZV90598.1|2290257_2291655_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AZV90599.1|2291674_2292118_-	Fe-S assembly protein NifU	NA	A0A2P1CJL8	Mycobacterium_phage	39.4	1.8e-15
AZV90600.1|2292107_2293328_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	48.3	1.2e-117
>prophage 10
CP018902	Bacillus amyloliquefaciens strain HK1 chromosome, complete genome	4002836	2501142	2510015	4002836		Bacillus_phage(50.0%)	8	NA	NA
AZV90819.1|2501142_2502096_-	hypothetical protein	NA	A1IMD5	Streptococcus_phage	40.2	2.6e-64
AZV90820.1|2502092_2502980_-	glmZ(sRNA)-inactivating NTPase	NA	A0A0R8VB27	Thermobifida_phage	28.8	5.1e-06
AZV90821.1|2503005_2503500_-	putative triphosphate pyrophosphate hydrolase	NA	NA	NA	NA	NA
AZV90822.1|2503747_2504701_-	thioredoxin reductase	NA	G3MA85	Bacillus_virus	52.6	8.3e-87
AZV90823.1|2504900_2506373_-	peptidase C40	NA	A0A0A0RVE6	Bacillus_phage	52.6	4.3e-26
AZV90824.1|2506709_2508164_-	hypothetical protein	NA	NA	NA	NA	NA
AZV90825.1|2508279_2509341_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	40.6	5.3e-66
AZV90826.1|2509337_2510015_-	heme response regulator HssR	NA	W8CYM9	Bacillus_phage	55.4	6.3e-65
>prophage 11
CP018902	Bacillus amyloliquefaciens strain HK1 chromosome, complete genome	4002836	2749692	2844745	4002836	holin,protease,coat,tRNA	Bacillus_phage(21.43%)	103	NA	NA
AZV91069.1|2749692_2751363_-|tRNA	arginyl-tRNA synthetase	tRNA	NA	NA	NA	NA
AZV91070.1|2751359_2751788_-	hypothetical protein	NA	NA	NA	NA	NA
AZV91071.1|2752085_2752334_-	antibiotic biosynthesis protein AlbG	NA	NA	NA	NA	NA
AZV91072.1|2752406_2752961_-	hypothetical protein	NA	NA	NA	NA	NA
AZV91073.1|2752930_2753800_-	factor interacting with DNA helicase PcrA	NA	NA	NA	NA	NA
AZV91074.1|2754028_2755174_+	aspartate phosphatase	NA	A0A1P8CWN8	Bacillus_phage	42.9	6.5e-78
AZV91075.1|2755157_2755277_+	phosphatase	NA	NA	NA	NA	NA
AZV91076.1|2755390_2756263_-	agmatinase	NA	NA	NA	NA	NA
AZV91077.1|2756321_2757152_-	spermidine synthase	NA	NA	NA	NA	NA
AZV91078.1|2757351_2759424_+	penicillin-binding protein 2D	NA	NA	NA	NA	NA
AZV91079.1|2759448_2759880_-	hypothetical protein	NA	NA	NA	NA	NA
AZV91080.1|2760023_2760545_-	hypothetical protein	NA	NA	NA	NA	NA
AZV91081.1|2760557_2761217_-|protease	zinc metalloprotease	protease	NA	NA	NA	NA
AZV91082.1|2761321_2761510_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
AZV91083.1|2761548_2761968_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZV91084.1|2762344_2763727_+	amino acid permease	NA	NA	NA	NA	NA
AZV91085.1|2763791_2764292_-	hypothetical protein	NA	NA	NA	NA	NA
AZV91086.1|2764331_2765633_-	hypothetical protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.9	1.4e-23
AZV91087.1|2765794_2766019_-	hypothetical protein	NA	NA	NA	NA	NA
AZV91088.1|2766222_2766993_+	transcriptional regulator	NA	NA	NA	NA	NA
AZV91089.1|2767254_2767569_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AZV91090.1|2767569_2768124_+	hypothetical protein	NA	NA	NA	NA	NA
AZV91091.1|2768221_2769142_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.8	2.0e-37
AZV91092.1|2769138_2770092_+	antibiotic ABC transporter permease	NA	NA	NA	NA	NA
AZV91093.1|2770081_2770918_-	hypothetical protein	NA	NA	NA	NA	NA
AZV91094.1|2770908_2771706_-	hypothetical protein	NA	NA	NA	NA	NA
AZV91095.1|2771674_2772598_-	hypothetical protein	NA	NA	NA	NA	NA
AZV91096.1|2772647_2772827_-	hypothetical protein	NA	NA	NA	NA	NA
AZV91097.1|2772981_2773845_-	octanoyltransferase	NA	NA	NA	NA	NA
AZV91098.1|2773900_2774791_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	40.2	2.7e-07
AZV91099.1|2774905_2775883_+	membrane protein	NA	NA	NA	NA	NA
AZV91100.1|2775921_2776893_-	phosphotransacetylase	NA	NA	NA	NA	NA
AZV91101.1|2777149_2777914_+	heme peroxidase	NA	NA	NA	NA	NA
AZV91102.1|2778079_2778277_+	DNA-binding protein	NA	NA	NA	NA	NA
AZV91103.1|2778279_2778654_+	hypothetical protein	NA	NA	NA	NA	NA
AZV91104.1|2778825_2779605_+	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
AZV91105.1|2779619_2780819_-	diaminopimelate aminotransferase	NA	NA	NA	NA	NA
AZV91106.1|2780831_2782013_-	bacilysin biosynthesis protein BacE	NA	NA	NA	NA	NA
AZV91107.1|2782009_2783428_-	carboxylate--amine ligase	NA	NA	NA	NA	NA
AZV91108.1|2783444_2784206_-	oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.1	4.8e-21
AZV91109.1|2784202_2784913_-	cupin	NA	NA	NA	NA	NA
AZV91110.1|2784902_2785370_-	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
AZV91111.1|2785673_2786912_-	MFS transporter	NA	NA	NA	NA	NA
AZV91112.1|2787132_2788335_+	MFS transporter	NA	S4TR35	Salmonella_phage	26.6	1.4e-27
AZV91113.1|2788366_2789785_-	amino acid permease	NA	NA	NA	NA	NA
AZV91114.1|2789809_2791492_-	peptidase M20	NA	NA	NA	NA	NA
AZV91115.1|2791563_2793111_-	1-pyrroline-5-carboxylate dehydrogenase	NA	NA	NA	NA	NA
AZV91116.1|2793318_2794605_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
AZV91117.1|2794792_2795257_-	hypothetical protein	NA	NA	NA	NA	NA
AZV91118.1|2795479_2795935_-|coat	spore coat protein	coat	NA	NA	NA	NA
AZV91119.1|2795931_2796780_-|coat	spore coat protein	coat	A0A291LA50	Escherichia_phage	37.3	3.5e-36
AZV91120.1|2796800_2797748_-|coat	spore coat protein	coat	I7HTA3	Enterobacteria_phage	42.9	5.0e-68
AZV91121.1|2797750_2798488_-|coat	spore coat protein	coat	G3MA50	Bacillus_virus	42.7	6.5e-47
AZV91122.1|2798515_2799520_-|coat	spore coat protein	coat	NA	NA	NA	NA
AZV91123.1|2799521_2800265_-|coat	spore coat protein	coat	NA	NA	NA	NA
AZV91124.1|2800254_2801376_-|coat	spore coat protein	coat	NA	NA	NA	NA
AZV91125.1|2801375_2802239_-|coat	spore coat protein	coat	NA	NA	NA	NA
AZV91126.1|2802239_2803409_-|coat	spore coat protein	coat	NA	NA	NA	NA
AZV91127.1|2803431_2804856_-|coat	spore coat protein	coat	NA	NA	NA	NA
AZV91128.1|2804860_2805631_-	glycosyl transferase	NA	A0A0F7L2F7	uncultured_marine_virus	30.7	7.6e-06
AZV91129.1|2805911_2806463_+|coat	spore coat protein	coat	NA	NA	NA	NA
AZV91130.1|2806509_2806881_-	membrane protein	NA	NA	NA	NA	NA
AZV91131.1|2806944_2808264_-	purine permease	NA	NA	NA	NA	NA
AZV91132.1|2808282_2808795_-	hypothetical protein	NA	NA	NA	NA	NA
AZV91133.1|2808763_2809447_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	44.7	3.2e-48
AZV91134.1|2809461_2810265_-	glycosyltransferase	NA	NA	NA	NA	NA
AZV91135.1|2810348_2810543_-	membrane protein	NA	NA	NA	NA	NA
AZV91136.1|2810626_2811439_+	pyridoxal kinase	NA	NA	NA	NA	NA
AZV91137.1|2811470_2811710_-	hypothetical protein	NA	NA	NA	NA	NA
AZV91138.1|2811810_2813250_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	24.7	2.4e-21
AZV91139.1|2813246_2814629_-	PTS sugar transporter	NA	NA	NA	NA	NA
AZV91140.1|2814846_2815677_-	levansucrase	NA	NA	NA	NA	NA
AZV91141.1|2815700_2816015_-	hypothetical protein	NA	NA	NA	NA	NA
AZV91142.1|2816540_2818952_+	peptidase S8	NA	A0A217EQY2	Bacillus_phage	36.8	2.9e-19
AZV91143.1|2818993_2819995_-	hypothetical protein	NA	NA	NA	NA	NA
AZV91144.1|2820345_2821275_+	transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	29.6	3.2e-11
AZV91145.1|2821351_2822152_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AZV91146.1|2822176_2822593_+	hypothetical protein	NA	NA	NA	NA	NA
AZV91147.1|2822579_2822867_+	stress protein	NA	NA	NA	NA	NA
AZV91148.1|2823165_2823915_-	FMN reductase	NA	NA	NA	NA	NA
AZV91149.1|2824017_2825205_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
AZV91150.1|2825440_2825899_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZV91151.1|2826193_2826454_+	spore germination protein	NA	NA	NA	NA	NA
AZV91152.1|2826497_2826866_-	quinol oxidase subunit 4	NA	NA	NA	NA	NA
AZV91153.1|2826867_2827482_-	cytochrome O ubiquinol oxidase	NA	NA	NA	NA	NA
AZV91154.1|2827496_2829446_-	quinol oxidase subunit 1	NA	NA	NA	NA	NA
AZV91155.1|2829473_2830439_-	quinol oxidase subunit 2	NA	NA	NA	NA	NA
AZV91156.1|2830941_2831187_+	hypothetical protein	NA	NA	NA	NA	NA
AZV91157.1|2831202_2832744_-	galactose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
AZV91158.1|2832733_2833918_-	galactokinase	NA	NA	NA	NA	NA
AZV91159.1|2833981_2834389_-	membrane protein	NA	NA	NA	NA	NA
AZV91160.1|2834446_2835070_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZV91161.1|2835405_2835567_+	antirepressor	NA	NA	NA	NA	NA
AZV91162.1|2835784_2836465_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZV91163.1|2836464_2837139_+	streptomycin biosynthesis protein StrF	NA	NA	NA	NA	NA
AZV91164.1|2837158_2837761_-	hypothetical protein	NA	NA	NA	NA	NA
AZV91165.1|2837848_2839105_-	deferrochelatase	NA	NA	NA	NA	NA
AZV91166.1|2839124_2840276_-	peptidase M75	NA	NA	NA	NA	NA
AZV91167.1|2840272_2841721_-	iron transporter	NA	NA	NA	NA	NA
AZV91168.1|2841856_2842525_-	thiamine-phosphate pyrophosphorylase	NA	NA	NA	NA	NA
AZV91169.1|2842521_2843340_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
AZV91170.1|2843343_2844252_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZV91171.1|2844358_2844745_+|holin	holin	holin	NA	NA	NA	NA
>prophage 12
CP018902	Bacillus amyloliquefaciens strain HK1 chromosome, complete genome	4002836	3699353	3737638	4002836	integrase,terminase,head,coat,tail,portal	uncultured_Caudovirales_phage(29.27%)	60	3701296:3701315	3745354:3745373
AZV91995.1|3699353_3699638_+	molecular chaperone GroES	NA	A0A221S3C8	uncultured_virus	51.6	3.7e-19
AZV91996.1|3699679_3701314_+	molecular chaperone GroEL	NA	A0A219YK78	uncultured_virus	57.5	3.7e-159
3701296:3701315	attL	TATGGGCGGAATGATGTAAA	NA	NA	NA	NA
AZV91997.1|3701392_3702604_-|integrase	integrase	integrase	S6C485	Thermus_phage	41.8	4.0e-78
AZV91998.1|3702615_3703089_-	hypothetical protein	NA	NA	NA	NA	NA
AZV91999.1|3703280_3703628_-	hypothetical protein	NA	A0A0S2MVJ2	Bacillus_phage	67.1	5.1e-18
AZV92000.1|3703641_3704163_-	hypothetical protein	NA	NA	NA	NA	NA
AZV92001.1|3704430_3704811_-	transcriptional regulator	NA	A8ATJ9	Listeria_phage	41.2	7.8e-12
AZV92002.1|3704980_3705223_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZV92003.1|3705235_3705550_+	hypothetical protein	NA	A0A2H4JDL0	uncultured_Caudovirales_phage	49.5	1.6e-15
AZV92004.1|3705546_3706317_+	antirepressor	NA	A0A290FZK7	Caldibacillus_phage	68.0	1.9e-73
AZV92005.1|3706426_3706999_+	transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	55.0	1.3e-58
AZV92006.1|3706995_3707253_+	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	40.5	3.5e-08
AZV92007.1|3707249_3707447_+	hypothetical protein	NA	NA	NA	NA	NA
AZV92008.1|3707548_3707734_+	hypothetical protein	NA	NA	NA	NA	NA
AZV92009.1|3707733_3708237_+	nuclease	NA	A0A2H4JA52	uncultured_Caudovirales_phage	76.5	8.8e-72
AZV92010.1|3708259_3708673_+	hypothetical protein	NA	A0A2H4JA52	uncultured_Caudovirales_phage	68.4	1.6e-47
AZV92011.1|3708675_3709515_+	hypothetical protein	NA	A0A2H4JCY8	uncultured_Caudovirales_phage	80.9	1.8e-122
AZV92012.1|3709679_3710396_+	DNA-binding protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	44.5	2.1e-42
AZV92013.1|3710487_3711252_+	hypothetical protein	NA	A6XMI1	Bacillus_virus	51.2	3.2e-57
AZV92014.1|3711248_3711392_+	hypothetical protein	NA	NA	NA	NA	NA
AZV92015.1|3711537_3711990_+	hypothetical protein	NA	A0A059T7V5	Listeria_phage	33.6	5.4e-12
AZV92016.1|3711976_3712435_+	hypothetical protein	NA	A0A2H4J891	uncultured_Caudovirales_phage	79.3	6.0e-59
AZV92017.1|3712554_3712707_+	hypothetical protein	NA	A0A2H4J4N7	uncultured_Caudovirales_phage	65.9	1.2e-08
AZV92018.1|3712788_3712992_+|portal	phage portal protein	portal	A0A2H4J4M6	uncultured_Caudovirales_phage	75.4	3.4e-22
AZV92019.1|3713023_3713365_+	hypothetical protein	NA	NA	NA	NA	NA
AZV92020.1|3713361_3713616_+	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	39.8	1.1e-06
AZV92021.1|3713620_3714997_+	DNA methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	49.3	1.2e-142
AZV92022.1|3715008_3715332_+	hypothetical protein	NA	M5ABU9	Bacillus_phage	33.7	7.8e-05
AZV92023.1|3715328_3715928_+	hypothetical protein	NA	A0A1L2JY27	Aeribacillus_phage	38.5	6.0e-27
AZV92024.1|3715927_3716290_+	hypothetical protein	NA	H6WU17	Pseudomonas_phage	65.9	1.3e-05
AZV92025.1|3716286_3716562_+	hypothetical protein	NA	F8WQ59	Bacillus_phage	47.3	5.2e-18
AZV92026.1|3716558_3716972_+	hypothetical protein	NA	M4ZRL6	Bacillus_phage	53.4	1.5e-32
AZV92027.1|3716968_3717523_+	hypothetical protein	NA	NA	NA	NA	NA
AZV92028.1|3717515_3717896_+	hypothetical protein	NA	NA	NA	NA	NA
AZV92029.1|3717892_3718084_+	hypothetical protein	NA	A0A217ERD8	Bacillus_phage	67.2	4.6e-13
AZV92030.1|3718129_3718348_+	hypothetical protein	NA	NA	NA	NA	NA
AZV92031.1|3718353_3718788_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	70.7	1.8e-49
AZV92032.1|3718933_3719311_+	hypothetical protein	NA	NA	NA	NA	NA
AZV92033.1|3719342_3719930_+	hypothetical protein	NA	NA	NA	NA	NA
AZV92034.1|3720194_3720710_+	RNA polymerase sigma 70	NA	A0A1L2JY33	Aeribacillus_phage	43.8	4.0e-27
AZV92035.1|3720814_3720952_+	hypothetical protein	NA	NA	NA	NA	NA
AZV92036.1|3721249_3721462_+	transcriptional regulator	NA	A0A1Z1LZP5	Bacillus_phage	52.9	9.6e-12
AZV92037.1|3721595_3721784_+	hypothetical protein	NA	NA	NA	NA	NA
AZV92038.1|3721919_3722150_+	hypothetical protein	NA	NA	NA	NA	NA
AZV92039.1|3722194_3722950_+	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	62.0	3.4e-51
AZV92040.1|3722936_3724211_+|terminase	terminase	terminase	S5MC58	Brevibacillus_phage	72.3	6.5e-180
AZV92041.1|3724232_3725684_+|portal	portal protein	portal	A0A1Q1PVT0	Bacillus_phage	49.4	1.3e-128
AZV92042.1|3725670_3726594_+|head	head protein	head	A0A1Q1PVS0	Bacillus_phage	51.2	1.0e-81
AZV92043.1|3726597_3726867_+	hypothetical protein	NA	NA	NA	NA	NA
AZV92044.1|3727020_3727686_+	scaffold protein	NA	I1TLE1	Bacillus_phage	49.3	4.5e-23
AZV92045.1|3727698_3728685_+|coat	coat protein	coat	D2J006	Enterococcus_phage	37.4	2.7e-48
AZV92046.1|3728725_3728947_+	alpha-1,2-mannosidase	NA	Q0PDK9	Bacillus_phage	63.6	1.3e-16
AZV92047.1|3728947_3729139_+	hypothetical protein	NA	NA	NA	NA	NA
AZV92048.1|3729143_3729440_+	hypothetical protein	NA	Q4ZBR3	Staphylococcus_phage	40.4	5.6e-10
AZV92049.1|3729436_3729775_+	hypothetical protein	NA	NA	NA	NA	NA
AZV92050.1|3729767_3730184_+	hypothetical protein	NA	O48447	Bacillus_phage	54.2	7.4e-32
AZV92051.1|3730202_3730601_+|tail	tail protein	tail	W8EK61	Geobacillus_phage	43.8	2.4e-24
AZV92052.1|3730614_3731127_+|tail	tail protein	tail	NA	NA	NA	NA
AZV92053.1|3731695_3732202_+	hypothetical protein	NA	I6T7F0	Staphylococcus_virus	33.3	6.7e-11
AZV92054.1|3732508_3737638_+	hypothetical protein	NA	Q4ZC60	Staphylococcus_virus	27.2	1.2e-35
3745354:3745373	attR	TATGGGCGGAATGATGTAAA	NA	NA	NA	NA
>prophage 13
CP018902	Bacillus amyloliquefaciens strain HK1 chromosome, complete genome	4002836	3786587	3796484	4002836		Synechococcus_phage(50.0%)	9	NA	NA
AZV92101.1|3786587_3787880_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	1.3e-18
AZV92102.1|3787961_3788681_+	phosphoribosylaminoimidazole-succinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.3	1.3e-47
AZV92103.1|3788680_3788935_+	phosphoribosylformylglycinamidine synthase	NA	A0A0E3FKD5	Synechococcus_phage	37.0	4.2e-06
AZV92104.1|3788931_3789615_+	phosphoribosylformylglycinamidine synthase	NA	NA	NA	NA	NA
AZV92105.1|3789598_3791827_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	41.1	7.7e-160
AZV92106.1|3791802_3793233_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	2.8e-54
AZV92107.1|3793324_3794365_+	phosphoribosylaminoimidazole synthetase	NA	A0A0E3F760	Synechococcus_phage	41.4	6.3e-64
AZV92108.1|3794361_3794949_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.9	7.7e-27
AZV92109.1|3794945_3796484_+	purine biosynthesis protein purH	NA	Q58MG4	Prochlorococcus_phage	51.4	1.5e-77
>prophage 14
CP018902	Bacillus amyloliquefaciens strain HK1 chromosome, complete genome	4002836	3996807	4000953	4002836		Bacillus_phage(50.0%)	8	NA	NA
AZV92296.1|3996807_3997956_-	tyrosine recombinase XerC	NA	A0A1S5S7K9	Streptococcus_phage	32.7	1.2e-34
AZV92297.1|3998023_3998488_-	membrane protein	NA	A0A2I7SC21	Paenibacillus_phage	51.0	9.1e-39
AZV92298.1|3998502_3998808_-	transcriptional regulator	NA	Q8W5Y0	Listeria_phage	50.5	2.0e-18
AZV92299.1|3999079_3999280_+	transcriptional regulator	NA	A0A0M3ULF9	Bacillus_phage	65.6	3.3e-14
AZV92300.1|3999266_3999539_+	hypothetical protein	NA	NA	NA	NA	NA
AZV92301.1|3999588_3999738_+	hypothetical protein	NA	NA	NA	NA	NA
AZV92302.1|3999734_4000016_+	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	41.9	8.0e-14
AZV92303.1|4000305_4000953_+	DNA-binding protein	NA	A0A288WFT2	Bacillus_phage	41.6	1.9e-34
