The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025521	Bordetella avium strain Owl19 chromosome, complete genome	3785260	1388630	1477856	3785260	tRNA,terminase,integrase,portal,head,protease,capsid,tail	Pseudomonas_phage(14.29%)	97	1400525:1400542	1484375:1484392
AZY48815.1|1388630_1391492_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.5	3.3e-70
AZY48816.1|1391481_1392447_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
AZY50853.1|1392495_1393164_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.8	2.3e-27
AZY50854.1|1393344_1394655_+	rRNA methyltransferase	NA	NA	NA	NA	NA
AZY50855.1|1394661_1394937_-	hypothetical protein	NA	NA	NA	NA	NA
AZY48817.1|1395277_1396486_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
AZY48818.1|1396482_1398735_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.1	2.9e-106
AZY48819.1|1399090_1401013_-	ABC transporter	NA	A0A2K9L0W2	Tupanvirus	32.1	9.5e-66
1400525:1400542	attL	CAGCGCGCGCGCCAGGGC	NA	NA	NA	NA
AZY48820.1|1401009_1401900_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AZY48821.1|1401906_1403040_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
AZY48822.1|1403039_1403861_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
AZY48823.1|1403884_1405093_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
AZY48824.1|1405406_1406615_-|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	61.6	6.3e-132
AZY48825.1|1407002_1407260_-	hypothetical protein	NA	NA	NA	NA	NA
AZY48826.1|1407401_1408418_-	recombinase RecT	NA	Q858E1	Salmonella_phage	47.8	6.4e-61
AZY48827.1|1408429_1409284_-	exonuclease VIII	NA	V5YTC9	Pseudomonas_phage	31.9	1.4e-37
AZY48828.1|1409287_1409473_-	hypothetical protein	NA	NA	NA	NA	NA
AZY48829.1|1409469_1409757_-	hypothetical protein	NA	NA	NA	NA	NA
AZY48830.1|1409818_1410205_-	hypothetical protein	NA	NA	NA	NA	NA
AZY48831.1|1410572_1410866_-	hypothetical protein	NA	NA	NA	NA	NA
AZY48832.1|1410917_1411142_-	hypothetical protein	NA	NA	NA	NA	NA
AZY48833.1|1411693_1412122_-	hypothetical protein	NA	NA	NA	NA	NA
AZY48834.1|1412930_1413293_-	transcriptional regulator	NA	NA	NA	NA	NA
AZY48835.1|1413365_1413587_+	hypothetical protein	NA	NA	NA	NA	NA
AZY48836.1|1413918_1414305_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZY48837.1|1414632_1414881_-	bssS family protein	NA	NA	NA	NA	NA
AZY48838.1|1415143_1415575_+	hypothetical protein	NA	NA	NA	NA	NA
AZY48839.1|1415607_1415823_+	hypothetical protein	NA	I6NMK4	Burkholderia_virus	42.9	8.0e-06
AZY48840.1|1415819_1416632_+	hypothetical protein	NA	A0A2I7RHJ6	Vibrio_phage	47.7	3.7e-19
AZY48841.1|1416618_1417317_+	hypothetical protein	NA	NA	NA	NA	NA
AZY50856.1|1417450_1417813_+	hypothetical protein	NA	R9TNL4	Vibrio_phage	50.0	1.0e-21
AZY48842.1|1417823_1418207_+	hypothetical protein	NA	NA	NA	NA	NA
AZY48843.1|1418203_1418794_+	hypothetical protein	NA	NA	NA	NA	NA
AZY48844.1|1418996_1419479_+	hypothetical protein	NA	NA	NA	NA	NA
AZY48845.1|1419841_1420624_+	restriction endonuclease subunit M	NA	Q5ZQW7	Pseudomonas_phage	74.6	2.2e-114
AZY48846.1|1421161_1421440_-	hypothetical protein	NA	K4NZP3	Burkholderia_phage	57.1	2.9e-08
AZY48847.1|1421426_1421693_-	hypothetical protein	NA	NA	NA	NA	NA
AZY50857.1|1421873_1422257_+	endonuclease	NA	Q8W6N0	Burkholderia_virus	56.4	2.4e-29
AZY48848.1|1422450_1422933_+|terminase	phage terminase small subunit P27 family	terminase	A4JWZ6	Burkholderia_virus	64.6	2.7e-54
AZY48849.1|1422936_1424661_+|terminase	terminase large subunit	terminase	A4JWZ7	Burkholderia_virus	80.5	7.0e-278
AZY48850.1|1424814_1426047_+|portal	phage portal protein	portal	A0A1J0GUY8	Halomonas_phage	66.8	1.2e-154
AZY48851.1|1426055_1426673_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1J0GUZ0	Halomonas_phage	61.8	5.1e-61
AZY48852.1|1426685_1427909_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	59.3	3.6e-135
AZY50858.1|1427946_1428267_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	36.5	3.8e-12
AZY48853.1|1428277_1428616_+|head,tail	head-tail adaptor protein	head,tail	Q3HQT3	Burkholderia_phage	39.3	9.3e-09
AZY48854.1|1428612_1429107_+	hypothetical protein	NA	NA	NA	NA	NA
AZY48855.1|1429099_1429450_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
AZY48856.1|1429449_1429890_+	hypothetical protein	NA	NA	NA	NA	NA
AZY48857.1|1429961_1430609_+|tail	phage tail protein	tail	A0A0H5BBY3	Pseudomonas_phage	52.1	3.9e-56
AZY48858.1|1430642_1430960_+	hypothetical protein	NA	A0A0S2SYT8	Pseudomonas_phage	48.6	5.6e-24
AZY50859.1|1431022_1431268_+	hypothetical protein	NA	NA	NA	NA	NA
AZY48859.1|1431302_1436840_+|tail	phage tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	34.0	8.8e-72
AZY48860.1|1436836_1437727_+	hypothetical protein	NA	NA	NA	NA	NA
AZY48861.1|1437728_1438658_+|tail	phage tail protein	tail	NA	NA	NA	NA
AZY48862.1|1438663_1439056_+	hypothetical protein	NA	NA	NA	NA	NA
AZY50860.1|1439436_1440243_+	hypothetical protein	NA	NA	NA	NA	NA
AZY48863.1|1440247_1440463_+	hypothetical protein	NA	NA	NA	NA	NA
AZY48864.1|1440462_1441014_+	lysozyme	NA	NA	NA	NA	NA
AZY48865.1|1440995_1441391_+	hypothetical protein	NA	NA	NA	NA	NA
AZY50861.1|1442219_1442783_-	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
AZY48866.1|1442799_1443171_-	hypothetical protein	NA	NA	NA	NA	NA
AZY48867.1|1443492_1443699_+	hypothetical protein	NA	NA	NA	NA	NA
AZY48868.1|1443824_1444109_-	transcriptional regulator	NA	NA	NA	NA	NA
AZY48869.1|1445100_1445439_+	hypothetical protein	NA	NA	NA	NA	NA
AZY48870.1|1445819_1446008_-	hypothetical protein	NA	NA	NA	NA	NA
AZY48871.1|1446198_1446519_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZY48872.1|1446515_1446815_-	DNA-binding protein	NA	NA	NA	NA	NA
AZY48873.1|1447394_1447628_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AZY48874.1|1447815_1449573_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
AZY48875.1|1450039_1450228_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
AZY48876.1|1450519_1450840_+	hypothetical protein	NA	NA	NA	NA	NA
AZY48877.1|1451147_1451351_+	cold-shock protein CspA	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
AZY48878.1|1451628_1452174_+	DUF924 domain-containing protein	NA	NA	NA	NA	NA
AZY50862.1|1452429_1452636_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.1	1.1e-15
AZY48879.1|1452705_1453284_-	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	33.5	6.7e-23
AZY48880.1|1453463_1454774_+	trigger factor	NA	NA	NA	NA	NA
AZY48881.1|1454776_1455430_+	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	7.5e-55
AZY48882.1|1455533_1456832_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.2	1.8e-129
AZY48883.1|1457006_1459439_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.0	2.5e-220
AZY48884.1|1459674_1461171_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	28.5	4.1e-16
AZY48885.1|1461278_1462523_+	benzoate transporter	NA	NA	NA	NA	NA
AZY48886.1|1462682_1463876_-	MFS transporter	NA	NA	NA	NA	NA
AZY48887.1|1464322_1464964_-	LexA repressor	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	3.2e-10
AZY48888.1|1465264_1466467_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
AZY48889.1|1466542_1468573_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AZY48890.1|1468822_1469314_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
AZY48891.1|1469503_1470037_+	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
AZY48892.1|1470058_1471270_+	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
AZY48893.1|1471306_1471711_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.2	1.8e-51
AZY48894.1|1471712_1472036_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	52.3	1.2e-24
AZY48895.1|1472039_1472546_+	co-chaperone protein HscB	NA	NA	NA	NA	NA
AZY48896.1|1472578_1474441_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	40.8	1.3e-99
AZY48897.1|1474449_1474791_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AZY48898.1|1474790_1474985_+	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AZY48899.1|1475099_1475996_+	methylglyoxal synthase	NA	NA	NA	NA	NA
AZY48900.1|1476040_1476328_-	hypothetical protein	NA	NA	NA	NA	NA
AZY48901.1|1476341_1477856_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.8	1.3e-81
1484375:1484392	attR	GCCCTGGCGCGCGCGCTG	NA	NA	NA	NA
>prophage 2
CP025521	Bordetella avium strain Owl19 chromosome, complete genome	3785260	2049948	2060982	3785260	tRNA	uncultured_Mediterranean_phage(25.0%)	12	NA	NA
AZY49308.1|2049948_2051379_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	26.4	1.4e-29
AZY49309.1|2051491_2052040_-	hypothetical protein	NA	NA	NA	NA	NA
AZY49310.1|2052143_2052923_-	3'-5' exonuclease	NA	NA	NA	NA	NA
AZY49311.1|2052919_2053771_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A292GJG6	Xanthomonas_phage	40.3	9.2e-13
AZY50913.1|2053788_2054478_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	45.7	8.5e-33
AZY49312.1|2054567_2055326_-	5'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.0	6.2e-69
AZY49313.1|2055495_2056134_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AZY49314.1|2056286_2057324_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	52.9	9.0e-95
AZY49315.1|2057422_2058715_+	guanine permease	NA	A0A0R6PHV4	Moraxella_phage	36.3	5.8e-67
AZY49316.1|2058868_2059882_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
AZY49317.1|2059993_2060377_+	thioredoxin	NA	V9SJ74	Achromobacter_phage	27.6	1.5e-10
AZY50914.1|2060379_2060982_-	thymidylate synthase	NA	A0A1X9I5T8	Streptococcus_phage	48.6	7.4e-17
>prophage 3
CP025521	Bordetella avium strain Owl19 chromosome, complete genome	3785260	2479649	2520009	3785260	terminase,integrase,portal,head,tail	Burkholderia_phage(26.92%)	60	2476029:2476075	2520034:2520080
2476029:2476075	attL	TGGTAGGCCCCCCGAGAGTCGAACTCGGCACCAACGGATTATGAGTC	NA	NA	NA	NA
AZY49665.1|2479649_2480108_-	lysozyme	NA	A0A0U4JP67	Pseudomonas_phage	62.4	6.0e-43
AZY49666.1|2480107_2480320_-	hypothetical protein	NA	NA	NA	NA	NA
AZY49667.1|2481707_2482358_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	41.3	5.2e-40
AZY49668.1|2482354_2483545_-	hypothetical protein	NA	Q6IWQ3	Burkholderia_phage	42.0	5.3e-67
AZY49669.1|2483537_2483882_-	hypothetical protein	NA	NA	NA	NA	NA
AZY49670.1|2483878_2484586_-	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	36.2	1.5e-32
AZY49671.1|2484570_2485398_-	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	38.5	4.1e-42
AZY49672.1|2485387_2485699_-	hypothetical protein	NA	I7A8L4	Escherichia_phage	39.0	3.1e-11
AZY49673.1|2485686_2486238_-	hypothetical protein	NA	NA	NA	NA	NA
AZY49674.1|2486234_2487848_-|tail	phage tail protein	tail	NA	NA	NA	NA
AZY49675.1|2487849_2488047_-	hypothetical protein	NA	NA	NA	NA	NA
AZY50951.1|2487968_2488394_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	47.9	5.8e-24
AZY49676.1|2488405_2488867_-	hypothetical protein	NA	I7ATP4	Escherichia_phage	47.6	1.0e-29
AZY49677.1|2488926_2490435_-	hypothetical protein	NA	I7B2P4	Escherichia_phage	37.6	6.8e-75
AZY49678.1|2490443_2490971_-	hypothetical protein	NA	NA	NA	NA	NA
AZY49679.1|2490951_2491335_-	hypothetical protein	NA	NA	NA	NA	NA
AZY49680.1|2491331_2491808_-	hypothetical protein	NA	A0A077KC03	Edwardsiella_phage	42.8	5.5e-23
AZY49681.1|2491804_2492230_-	DUF4054 domain-containing protein	NA	A0A088C3T8	Shewanella_sp._phage	36.8	1.5e-16
AZY49682.1|2492231_2492573_-	hypothetical protein	NA	NA	NA	NA	NA
AZY49683.1|2492682_2493762_-	hypothetical protein	NA	A0A2H4P6S2	Pseudomonas_phage	39.5	2.3e-53
AZY49684.1|2493777_2494245_-	hypothetical protein	NA	NA	NA	NA	NA
AZY49685.1|2494247_2495498_-	hypothetical protein	NA	A0A088C4R4	Shewanella_sp._phage	47.2	7.9e-37
AZY49686.1|2495490_2496339_-|head	phage head morphogenesis protein	head	Q6IWU3	Burkholderia_phage	37.5	5.0e-43
AZY49687.1|2496283_2497759_-|portal	portal protein	portal	B5M9R6	Pseudomonas_phage	43.4	5.7e-103
AZY49688.1|2497755_2499093_-|terminase	terminase	terminase	A0A0D4DCE6	Acinetobacter_phage	61.7	6.1e-144
AZY49689.1|2499157_2499592_-|terminase	terminase small subunit	terminase	E5AGA2	Erwinia_phage	63.4	1.6e-37
AZY49690.1|2499653_2499908_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	77.4	4.5e-32
AZY49691.1|2499891_2500218_+	transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	76.6	2.6e-40
AZY49692.1|2500232_2500745_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	40.8	2.7e-15
AZY49693.1|2501128_2501530_-	hypothetical protein	NA	NA	NA	NA	NA
AZY49694.1|2501529_2501976_-	hypothetical protein	NA	NA	NA	NA	NA
AZY49695.1|2502016_2502388_-	endonuclease	NA	NA	NA	NA	NA
AZY49696.1|2502384_2503083_-	hypothetical protein	NA	NA	NA	NA	NA
AZY49697.1|2503069_2503861_-	hypothetical protein	NA	A0A220NQM6	Acinetobacter_phage	48.9	3.2e-44
AZY49698.1|2503847_2504219_-	recombinase	NA	NA	NA	NA	NA
AZY49699.1|2504215_2504689_-	hypothetical protein	NA	NA	NA	NA	NA
AZY49700.1|2504688_2504997_-	transcriptional regulator	NA	NA	NA	NA	NA
AZY49701.1|2505210_2505429_-	hypothetical protein	NA	NA	NA	NA	NA
AZY49702.1|2505565_2506606_+	LexA family transcriptional repressor	NA	A0A1B0VRI7	Pseudomonas_phage	34.2	5.8e-09
AZY49703.1|2506602_2507283_+	hypothetical protein	NA	NA	NA	NA	NA
AZY49704.1|2507312_2507969_-	hypothetical protein	NA	NA	NA	NA	NA
AZY49705.1|2508162_2508852_+	hypothetical protein	NA	NA	NA	NA	NA
AZY49706.1|2509598_2509832_+	hypothetical protein	NA	NA	NA	NA	NA
AZY49707.1|2509888_2510194_+	hypothetical protein	NA	NA	NA	NA	NA
AZY49708.1|2510596_2510950_+	hypothetical protein	NA	NA	NA	NA	NA
AZY49709.1|2511119_2511554_+	hypothetical protein	NA	NA	NA	NA	NA
AZY49710.1|2511550_2511751_+	hypothetical protein	NA	NA	NA	NA	NA
AZY49711.1|2511862_2512513_+	ATP-binding protein	NA	A0A2D1GLT5	Escherichia_phage	49.8	1.7e-54
AZY49712.1|2512525_2513125_+	hypothetical protein	NA	NA	NA	NA	NA
AZY49713.1|2513115_2513622_+	hypothetical protein	NA	A0A0P0I392	Lactobacillus_phage	32.1	5.1e-11
AZY49714.1|2513632_2514157_-	hypothetical protein	NA	NA	NA	NA	NA
AZY49715.1|2514466_2515366_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	34.8	3.3e-45
AZY49716.1|2515411_2515861_+	hypothetical protein	NA	NA	NA	NA	NA
AZY49717.1|2515857_2516319_+	hypothetical protein	NA	NA	NA	NA	NA
AZY49718.1|2516315_2517158_+	hypothetical protein	NA	NA	NA	NA	NA
AZY49719.1|2517154_2517505_+	hypothetical protein	NA	NA	NA	NA	NA
AZY49720.1|2517504_2518002_+	SAM-dependent methyltransferase	NA	A0A0N7IRF6	Acinetobacter_phage	62.3	2.3e-56
AZY49721.1|2518169_2518778_+	hypothetical protein	NA	NA	NA	NA	NA
AZY49722.1|2518867_2519209_+	hypothetical protein	NA	NA	NA	NA	NA
AZY49723.1|2519292_2520009_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
2520034:2520080	attR	TGGTAGGCCCCCCGAGAGTCGAACTCGGCACCAACGGATTATGAGTC	NA	NA	NA	NA
>prophage 4
CP025521	Bordetella avium strain Owl19 chromosome, complete genome	3785260	2994293	3032333	3785260	tRNA,terminase,integrase,portal,head,protease,capsid,tail	Burkholderia_virus(30.77%)	53	3021453:3021468	3032531:3032546
AZY50082.1|2994293_2994902_-|tail	phage tail protein	tail	Q8W6T1	Burkholderia_virus	56.4	8.5e-53
AZY50993.1|2994898_2995681_-	hydrolase Nlp/P60	NA	A4JX14	Burkholderia_virus	49.0	2.8e-64
AZY50083.1|2995683_2996412_-|tail	phage minor tail protein L	tail	Q6JIL5	Burkholderia_virus	51.9	5.4e-62
AZY50084.1|2996486_2996873_-	hypothetical protein	NA	NA	NA	NA	NA
AZY50085.1|2996875_2998522_-|tail	phage tail protein	tail	A0A0B5A509	Achromobacter_phage	47.9	5.3e-41
AZY50086.1|2998525_2998867_-|tail	phage tail protein	tail	A0A0S2SYI2	Pseudomonas_phage	45.9	1.2e-24
AZY50087.1|2998863_3002319_-|tail	phage tail tape measure protein	tail	A0A2H4J7J3	uncultured_Caudovirales_phage	31.9	2.0e-90
AZY50088.1|3002320_3002572_-	hypothetical protein	NA	K7P6Y9	Escherichia_phage	44.3	2.1e-10
AZY50089.1|3002628_3002967_-	hypothetical protein	NA	NA	NA	NA	NA
AZY50994.1|3002976_3003627_-|tail	phage tail protein	tail	A0A0H5BBY3	Pseudomonas_phage	56.0	1.4e-58
AZY50090.1|3003684_3004035_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
AZY50091.1|3004027_3004456_-	hypothetical protein	NA	NA	NA	NA	NA
AZY50092.1|3004452_3004785_-|head,tail	head-tail adaptor protein	head,tail	Q6JIM4	Burkholderia_virus	43.3	1.0e-12
AZY50093.1|3004781_3005087_-	hypothetical protein	NA	NA	NA	NA	NA
AZY50094.1|3005079_3005439_-	hypothetical protein	NA	NA	NA	NA	NA
AZY50095.1|3005487_3006678_-|capsid	phage major capsid protein	capsid	A0A2D1GNH4	Pseudomonas_phage	53.4	1.6e-116
AZY50096.1|3006745_3007384_-|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	48.8	4.3e-47
AZY50097.1|3007385_3008612_-|portal	phage portal protein	portal	A0A2D1GNU4	Pseudomonas_phage	48.5	6.2e-95
AZY50098.1|3008611_3010330_-|terminase	terminase	terminase	A4JWZ7	Burkholderia_virus	78.0	3.3e-275
AZY50099.1|3010333_3010816_-|terminase	phage terminase small subunit P27 family	terminase	A4JWZ6	Burkholderia_virus	63.9	9.4e-55
AZY50100.1|3011025_3011406_-	endonuclease	NA	Q6JIE9	Burkholderia_virus	54.2	2.0e-28
AZY50101.1|3011405_3011777_-	hypothetical protein	NA	NA	NA	NA	NA
AZY50995.1|3011827_3012340_-	hypothetical protein	NA	B6SCX2	Bacteriophage	45.9	9.8e-18
AZY50102.1|3012493_3013267_-	restriction endonuclease subunit M	NA	Q5ZQW7	Pseudomonas_phage	73.1	3.8e-114
AZY50996.1|3013645_3014299_-	hypothetical protein	NA	Q3HR05	Burkholderia_phage	41.5	1.6e-28
AZY50997.1|3014313_3014727_-	hypothetical protein	NA	NA	NA	NA	NA
AZY50103.1|3015069_3016071_-	hypothetical protein	NA	Q8W6P0	Burkholderia_virus	38.3	7.5e-30
AZY50998.1|3016067_3016478_-	DUF1364 domain-containing protein	NA	NA	NA	NA	NA
AZY50104.1|3016525_3016786_-	hypothetical protein	NA	NA	NA	NA	NA
AZY50105.1|3016806_3017322_-	hypothetical protein	NA	NA	NA	NA	NA
AZY50106.1|3017563_3017809_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZY50107.1|3017890_3018613_+	hypothetical protein	NA	A0A0A0YR73	Pseudomonas_phage	33.8	6.6e-28
AZY50108.1|3018627_3019071_-	hypothetical protein	NA	NA	NA	NA	NA
AZY50109.1|3019440_3019887_+	hypothetical protein	NA	NA	NA	NA	NA
AZY50110.1|3019900_3020206_+	hypothetical protein	NA	NA	NA	NA	NA
AZY50111.1|3021065_3021530_+	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	52.8	3.7e-40
3021453:3021468	attL	CCGGCGCAGCGGCCTG	NA	NA	NA	NA
AZY50112.1|3021620_3021878_+	hypothetical protein	NA	NA	NA	NA	NA
AZY50113.1|3021889_3022792_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	34.4	4.8e-44
AZY50114.1|3022788_3023979_+	hypothetical protein	NA	NA	NA	NA	NA
AZY50115.1|3023975_3024326_+	hypothetical protein	NA	NA	NA	NA	NA
AZY50116.1|3024322_3024700_+	hypothetical protein	NA	A0A240F4V4	Ochrobactrum_phage	49.6	7.7e-28
AZY50117.1|3024696_3025146_+	hypothetical protein	NA	B5WZU9	Pseudomonas_phage	51.4	2.8e-37
AZY50118.1|3025408_3025654_+	hypothetical protein	NA	NA	NA	NA	NA
AZY50119.1|3025653_3026157_+	SAM-dependent methyltransferase	NA	A0A0N7IRF6	Acinetobacter_phage	62.3	2.3e-56
AZY50120.1|3026153_3026534_+	hypothetical protein	NA	NA	NA	NA	NA
AZY50121.1|3026736_3027339_+	hypothetical protein	NA	NA	NA	NA	NA
AZY50122.1|3027563_3027917_+	hypothetical protein	NA	NA	NA	NA	NA
AZY50123.1|3027754_3028726_+|integrase	site-specific integrase	integrase	B5WZU7	Pseudomonas_phage	32.9	7.1e-17
AZY50999.1|3029001_3029550_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
AZY50124.1|3029546_3029951_-	DoxX family protein	NA	NA	NA	NA	NA
AZY51000.1|3030086_3030992_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZY50125.1|3031002_3031584_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AZY50126.1|3031580_3032333_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
3032531:3032546	attR	CCGGCGCAGCGGCCTG	NA	NA	NA	NA
