The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	0	5542	4876986		Escherichia_phage(25.0%)	4	NA	NA
AZZ00696.1|706_1606_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
AZZ00697.1|1605_2691_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AZZ00698.1|3067_3961_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AZZ00699.1|4138_5542_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	2.3e-21
>prophage 2
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	11099	17805	4876986		Bacillus_phage(25.0%)	6	NA	NA
AZZ00704.1|11099_12470_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.4	5.8e-33
AZZ00705.1|12580_14023_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.7	9.4e-50
AZZ00706.1|14019_15243_-	colanic acid biosynthesis glycosyltransferase WcaI	NA	NA	NA	NA	NA
AZZ00707.1|15239_15713_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
AZZ00708.1|15715_16681_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.2	7.9e-85
AZZ00709.1|16683_17805_-	GDP-mannose 4,6-dehydratase	NA	M1HXY1	Acanthocystis_turfacea_Chlorella_virus	65.3	6.9e-133
>prophage 3
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	22980	32280	4876986		Streptococcus_phage(25.0%)	7	NA	NA
AZZ00716.1|22980_25140_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.8	5.4e-17
AZZ00717.1|25136_25586_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
AZZ00718.1|25591_26731_-	polysaccharide export protein	NA	NA	NA	NA	NA
AZZ00719.1|27405_28986_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.1e-38
AZZ00720.1|29071_30928_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
AZZ00721.1|30966_31548_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	43.2	9.3e-33
AZZ00722.1|31638_32280_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	2.5e-34
>prophage 4
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	42728	49340	4876986		Bacillus_phage(66.67%)	4	NA	NA
AZZ00728.1|42728_45809_+	multidrug efflux RND transporter permease subunit MdtC	NA	S5VTK5	Leptospira_phage	23.2	1.4e-63
AZZ00729.1|45805_47218_+	MFS transporter	NA	NA	NA	NA	NA
AZZ00730.1|47217_48621_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.7	3.6e-30
AZZ00731.1|48617_49340_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	6.4e-31
>prophage 5
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	54148	56791	4876986	transposase	Macacine_betaherpesvirus(50.0%)	3	NA	NA
AZZ00735.1|54148_55259_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.0	4.9e-06
AZZ00736.1|55714_56452_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ00737.1|56560_56791_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	64.9	6.1e-20
>prophage 6
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	67647	70505	4876986		Phage_TP(50.0%)	2	NA	NA
AZZ05109.1|67647_69009_+	U32 family peptidase	NA	Q6DW11	Phage_TP	95.4	2.3e-207
AZZ00750.1|69458_70505_+	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	75.8	2.4e-148
>prophage 7
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	87703	96874	4876986	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AZZ00768.1|87703_89737_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
AZZ00769.1|89977_90436_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AZZ00770.1|90607_91138_+	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AZZ00771.1|91194_91662_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AZZ00772.1|91708_92428_-	two-component system response regulator YehT	NA	NA	NA	NA	NA
AZZ00773.1|92424_94110_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
AZZ00774.1|94332_95064_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AZZ00775.1|95123_95231_+	protein YohO	NA	NA	NA	NA	NA
AZZ00776.1|95211_95943_-	ABC transporter permease	NA	NA	NA	NA	NA
AZZ00777.1|95926_96874_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 8
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	122927	124448	4876986		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AZZ00802.1|122927_124448_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
>prophage 9
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	128407	129076	4876986		Cellulophaga_phage(100.0%)	1	NA	NA
AZZ00806.1|128407_129076_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	5.3e-56
>prophage 10
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	134515	136507	4876986		Acinetobacter_phage(100.0%)	1	NA	NA
AZZ00812.1|134515_136507_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
>prophage 11
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	140622	141480	4876986		Catovirus(100.0%)	1	NA	NA
AZZ00816.1|140622_141480_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
>prophage 12
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	151620	152193	4876986		Clostridioides_phage(100.0%)	1	NA	NA
AZZ00827.1|151620_152193_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
>prophage 13
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	158117	166444	4876986		Vibrio_phage(50.0%)	8	NA	NA
AZZ00832.1|158117_159707_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.1	2.5e-19
AZZ00833.1|159710_160055_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ00834.1|160445_161636_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	5.4e-19
AZZ00835.1|161663_162359_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
AZZ00836.1|162510_164271_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
AZZ00837.1|164395_164680_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
AZZ00838.1|164788_165409_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ00839.1|165436_166444_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
>prophage 14
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	176939	177557	4876986		Brazilian_cedratvirus(100.0%)	1	NA	NA
AZZ00853.1|176939_177557_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	1.8e-10
>prophage 15
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	184639	190457	4876986		Bacillus_phage(33.33%)	5	NA	NA
AZZ00861.1|184639_186283_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.4	5.7e-11
AZZ00862.1|186358_187009_-	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
AZZ00863.1|187011_188073_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A167R6J9	Powai_lake_megavirus	58.0	3.1e-18
AZZ00864.1|188153_189206_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
AZZ00865.1|189320_190457_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.8	6.6e-115
>prophage 16
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	194624	201837	4876986		Hokovirus(33.33%)	3	NA	NA
AZZ00868.1|194624_197471_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.4	1.2e-40
AZZ00869.1|197588_200225_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.8	1.1e-93
AZZ00870.1|200634_201837_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	36.0	7.8e-58
>prophage 17
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	205277	212478	4876986		Pseudomonas_phage(50.0%)	6	NA	NA
AZZ00874.1|205277_207563_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.6	1.3e-282
AZZ00875.1|207675_208806_+	ribonucleoside-diphosphate reductase 1 subunit beta	NA	G9IAA3	Pseudomonas_phage	79.4	8.7e-176
AZZ00876.1|208805_209060_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	74.6	3.1e-25
AZZ00877.1|209061_210252_-	MFS transporter	NA	NA	NA	NA	NA
AZZ00878.1|210413_211292_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ00879.1|211407_212478_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 18
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	222101	223307	4876986		Oenococcus_phage(100.0%)	1	NA	NA
AZZ00889.1|222101_223307_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	3.5e-26
>prophage 19
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	226954	231963	4876986		Tupanvirus(50.0%)	4	NA	NA
AZZ00893.1|226954_227560_-	lipopolysaccharide core heptose(II)-phosphate phosphatase	NA	A0A2L1IV13	Escherichia_phage	43.8	1.9e-12
AZZ05113.1|227858_228998_+	UDP-4-amino-4-deoxy-L-arabinose-oxoglutarate aminotransferase	NA	A0A2K9L0G1	Tupanvirus	29.3	2.0e-31
AZZ00894.1|229000_229984_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	32.7	1.7e-34
AZZ00895.1|229980_231963_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	26.4	1.0e-22
>prophage 20
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	244530	257043	4876986		Bacillus_thuringiensis_phage(50.0%)	3	NA	NA
AZZ00910.1|244530_245532_+	chemotaxis signal transduction protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.6	4.1e-28
AZZ00911.1|245572_247354_-	VWA domain-containing protein	NA	NA	NA	NA	NA
AZZ00912.1|248061_257043_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	26.4	3.7e-43
>prophage 21
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	276364	279636	4876986		Salmonella_phage(50.0%)	3	NA	NA
AZZ00930.1|276364_276964_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	37.3	1.2e-06
AZZ00931.1|277055_278882_-	SLC13 family permease	NA	NA	NA	NA	NA
AZZ05114.1|278958_279636_-	sugar phosphatase	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	33.3	9.3e-08
>prophage 22
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	290442	291462	4876986		Enterobacteria_phage(100.0%)	1	NA	NA
AZZ00943.1|290442_291462_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.7	3.2e-20
>prophage 23
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	295190	295964	4876986		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AZZ05115.1|295190_295964_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	29.1	1.7e-10
>prophage 24
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	307393	308911	4876986		Mollivirus(100.0%)	1	NA	NA
AZZ00960.1|307393_308911_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	6.3e-89
>prophage 25
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	315413	316550	4876986		Brazilian_cedratvirus(100.0%)	1	NA	NA
AZZ00968.1|315413_316550_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.0e-22
>prophage 26
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	327207	328293	4876986		Pandoravirus(100.0%)	1	NA	NA
AZZ00980.1|327207_328293_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	5.3e-90
>prophage 27
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	337473	344319	4876986	transposase	Salmonella_virus(42.86%)	7	NA	NA
AZZ00989.1|337473_338415_+	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	87.8	4.1e-147
AZZ00990.1|339669_340374_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZZ00991.1|340470_340860_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	97.5	1.3e-59
AZZ00992.1|340828_341095_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.3e-25
AZZ00993.1|341101_343024_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.7	5.6e-300
AZZ00994.1|344013_344157_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	85.4	2.6e-13
AZZ05116.1|344172_344319_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	73.9	1.1e-14
>prophage 28
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	352973	353894	4876986		Morganella_phage(100.0%)	1	NA	NA
AZZ00999.1|352973_353894_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.9	8.3e-76
>prophage 29
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	375186	385036	4876986		Lactobacillus_phage(25.0%)	9	NA	NA
AZZ01015.1|375186_376113_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.4	1.5e-08
AZZ01016.1|376202_377201_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
AZZ01017.1|377197_377416_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ01018.1|377417_379433_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.9	8.8e-147
AZZ01019.1|379504_380491_-	cell division protein ZipA	NA	NA	NA	NA	NA
AZZ01020.1|380722_381484_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
AZZ01021.1|381647_382619_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	7.4e-75
AZZ01022.1|383002_383260_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
AZZ01023.1|383308_385036_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	31.1	7.4e-17
>prophage 30
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	390443	401463	4876986	transposase	Macacine_betaherpesvirus(16.67%)	12	NA	NA
AZZ01030.1|390443_391555_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.0	4.9e-06
AZZ01031.1|391911_392823_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	41.8	1.7e-57
AZZ01032.1|392890_393988_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	38.5	7.0e-29
AZZ01033.1|393977_394853_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
AZZ01034.1|394852_395686_-	sulfate ABC transporter permease	NA	NA	NA	NA	NA
AZZ01035.1|395685_396702_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZZ01036.1|396859_397651_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	1.5e-17
AZZ01037.1|397888_398788_-	Dyp-type peroxidase	NA	S4VVJ7	Pandoravirus	33.3	3.8e-25
AZZ01038.1|398882_399458_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
AZZ01039.1|399519_399969_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
AZZ01040.1|399955_400492_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AZZ01041.1|400593_401463_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	31.9	2.8e-17
>prophage 31
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	422078	423029	4876986		Cyanophage(100.0%)	1	NA	NA
AZZ01063.1|422078_423029_+	transaldolase	NA	A0A127KNC6	Cyanophage	30.3	8.2e-10
>prophage 32
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	441652	442366	4876986		Synechococcus_phage(100.0%)	1	NA	NA
AZZ01077.1|441652_442366_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	37.5	9.1e-38
>prophage 33
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	445704	446844	4876986		Streptococcus_phage(100.0%)	1	NA	NA
AZZ01082.1|445704_446844_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.8	5.5e-45
>prophage 34
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	452427	457702	4876986		uncultured_Caudovirales_phage(25.0%)	6	NA	NA
AZZ01087.1|452427_452787_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	45.6	1.1e-18
AZZ01088.1|452813_453539_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
AZZ01089.1|453609_454899_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.6	8.6e-63
AZZ01090.1|454986_455613_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AZZ01091.1|456026_457064_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	41.8	2.9e-69
AZZ01092.1|457063_457702_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	43.4	9.6e-31
>prophage 35
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	464164	465667	4876986		Escherichia_phage(100.0%)	3	NA	NA
AZZ01096.1|464164_464356_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	84.1	6.4e-23
AZZ01097.1|464596_465112_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	85.4	1.8e-48
AZZ01098.1|465127_465667_+	hypothetical protein	NA	G9L6F0	Escherichia_phage	77.7	1.0e-25
>prophage 36
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	475461	483939	4876986		Klosneuvirus(33.33%)	3	NA	NA
AZZ01107.1|475461_476928_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	4.0e-88
AZZ01108.1|477088_478438_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.6	4.4e-41
AZZ01109.1|478599_483939_-	fibronectin-binding autotransporter adhesin ShdA	NA	A0A2L1IV18	Escherichia_phage	25.8	8.3e-35
>prophage 37
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	503175	508424	4876986		Escherichia_phage(66.67%)	5	NA	NA
AZZ01122.1|503175_503607_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.1	1.1e-17
AZZ01123.1|503727_504591_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
AZZ01124.1|504590_505400_-	dimethyl sulfoxide reductase	NA	NA	NA	NA	NA
AZZ01125.1|505392_506022_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	56.4	5.5e-63
AZZ01126.1|506018_508424_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	38.4	3.0e-141
>prophage 38
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	519222	529174	4876986	tRNA	Mycoplasma_phage(16.67%)	12	NA	NA
AZZ01133.1|519222_520506_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	38.2	1.2e-35
AZZ01134.1|520559_520760_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
AZZ01135.1|520771_521107_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AZZ01136.1|521108_522959_-	Fe-S protein assembly chaperone HscA	NA	A0A167RF67	Powai_lake_megavirus	39.5	3.6e-102
AZZ01137.1|522971_523487_-	co-chaperone HscB	NA	NA	NA	NA	NA
AZZ01138.1|523682_524006_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	4.1e-22
AZZ01139.1|524034_524421_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	2.4e-53
AZZ01140.1|524448_525663_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.2e-34
AZZ01141.1|525843_526338_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
AZZ01142.1|526497_527229_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
AZZ01143.1|527347_528151_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
AZZ01144.1|528295_529174_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
>prophage 39
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	536593	537847	4876986		Aeromonas_phage(100.0%)	1	NA	NA
AZZ01152.1|536593_537847_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
>prophage 40
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	545062	555053	4876986		Bacillus_phage(50.0%)	6	NA	NA
AZZ01157.1|545062_546523_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
AZZ01158.1|546571_546910_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
AZZ01159.1|546986_548324_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
AZZ01160.1|548320_549085_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AZZ01161.1|549086_550517_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
AZZ01162.1|551165_555053_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.3	2.3e-127
>prophage 41
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	563637	571483	4876986		Lactobacillus_phage(25.0%)	9	NA	NA
AZZ01171.1|563637_564564_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
AZZ01172.1|564601_564862_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
AZZ01173.1|564973_565354_-	holo-ACP synthase	NA	NA	NA	NA	NA
AZZ01174.1|565353_566085_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AZZ01175.1|566096_566825_-	DNA repair protein RecO	NA	NA	NA	NA	NA
AZZ01176.1|566836_567742_-	GTPase Era	NA	NA	NA	NA	NA
AZZ01177.1|567738_568419_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
AZZ01178.1|568692_569667_-	signal peptidase I	NA	NA	NA	NA	NA
AZZ01179.1|569683_571483_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
>prophage 42
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	577321	583492	4876986	tRNA	uncultured_Mediterranean_phage(25.0%)	7	NA	NA
AZZ01188.1|577321_578656_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
AZZ01189.1|578673_579573_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ01190.1|579675_580263_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
AZZ01191.1|580324_580708_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
AZZ01192.1|581026_581716_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
AZZ01193.1|581831_582869_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AZZ01194.1|583072_583492_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
>prophage 43
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	588791	590652	4876986		Burkholderia_virus(50.0%)	2	NA	NA
AZZ01198.1|588791_590093_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.2e-43
AZZ01199.1|590196_590652_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
>prophage 44
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	596646	599220	4876986		Enterobacteria_phage(100.0%)	1	NA	NA
AZZ01201.1|596646_599220_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
>prophage 45
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	606005	609247	4876986		Escherichia_coli_O157_typing_phage(50.0%)	3	NA	NA
AZZ01209.1|606005_607076_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
AZZ05127.1|607515_608034_+	YfiR family protein	NA	NA	NA	NA	NA
AZZ01210.1|608026_609247_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
>prophage 46
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	621015	621498	4876986		Staphylococcus_phage(100.0%)	1	NA	NA
AZZ01224.1|621015_621498_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
>prophage 47
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	635062	637243	4876986		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AZZ01227.1|635062_637243_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
>prophage 48
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	644754	645865	4876986	transposase	Macacine_betaherpesvirus(100.0%)	1	NA	NA
AZZ01231.1|644754_645865_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.0	4.9e-06
>prophage 49
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	650582	654239	4876986		Bacillus_phage(100.0%)	1	NA	NA
AZZ01236.1|650582_654239_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.6	1.5e-43
>prophage 50
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	674606	678614	4876986		Klosneuvirus(50.0%)	4	NA	NA
AZZ01254.1|674606_675890_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.1	6.0e-32
AZZ01255.1|676023_677424_+	GABA permease	NA	NA	NA	NA	NA
AZZ01256.1|677465_678143_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
AZZ01257.1|678164_678614_-	peptidoglycan-binding protein LysM	NA	A0A090DBR9	Clostridium_phage	38.2	7.5e-06
>prophage 51
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	685313	690368	4876986		Bacillus_phage(25.0%)	4	NA	NA
AZZ01270.1|685313_685724_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	41.8	3.3e-16
AZZ01271.1|685696_687841_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	48.6	2.9e-196
AZZ01272.1|687851_688811_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.8	1.8e-129
AZZ01273.1|689165_690368_+	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.8	1.4e-27
>prophage 52
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	702204	709458	4876986	tRNA	Acanthocystis_turfacea_Chlorella_virus(20.0%)	7	NA	NA
AZZ01284.1|702204_702771_-	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	27.6	7.2e-14
AZZ01285.1|703911_704097_-	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
AZZ01286.1|704331_706962_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.3	3.5e-79
AZZ05132.1|706994_707201_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ01287.1|707197_707698_-	recombination regulator RecX	NA	NA	NA	NA	NA
AZZ01288.1|707814_708876_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.8	3.0e-114
AZZ05133.1|708960_709458_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	51.6	4.4e-31
>prophage 53
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	715364	716330	4876986		Tetraselmis_virus(100.0%)	1	NA	NA
AZZ01297.1|715364_716330_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.1	3.3e-35
>prophage 54
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	740244	741066	4876986		Brazilian_cedratvirus(100.0%)	1	NA	NA
AZZ01322.1|740244_741066_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A2R8FG22	Brazilian_cedratvirus	26.5	3.1e-13
>prophage 55
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	774568	776257	4876986		Vibrio_phage(100.0%)	1	NA	NA
AZZ01357.1|774568_776257_-	type III secretion system outer membrane ring protein InvG	NA	R9TEZ5	Vibrio_phage	27.8	3.9e-15
>prophage 56
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	781747	787548	4876986		Escherichia_phage(50.0%)	5	NA	NA
AZZ01364.1|781747_782404_+	protein-serine/threonine phosphatase	NA	Q71TJ1	Escherichia_phage	47.4	5.0e-51
AZZ01365.1|782648_783143_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ01366.1|783169_783838_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ01367.1|784411_784822_-	cytoplasmic protein	NA	NA	NA	NA	NA
AZZ01368.1|784980_787548_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	21.2	1.9e-29
>prophage 57
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	793514	803941	4876986		Escherichia_phage(50.0%)	12	NA	NA
AZZ01375.1|793514_794153_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.8e-85
AZZ01376.1|794149_795412_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.5	1.5e-131
AZZ01377.1|795405_796329_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	77.1	8.2e-116
AZZ01378.1|796525_797290_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.5	1.1e-70
AZZ01379.1|797308_797713_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ01380.1|797883_798477_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
AZZ01381.1|798476_799904_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
AZZ01382.1|799914_800151_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ01383.1|800195_801188_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AZZ01384.1|801250_802384_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	5.0e-06
AZZ01385.1|802559_803186_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.4	4.8e-35
AZZ01386.1|803179_803941_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.4	1.9e-57
>prophage 58
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	807051	809083	4876986		Tupanvirus(50.0%)	2	NA	NA
AZZ01392.1|807051_807657_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	39.6	1.3e-29
AZZ01393.1|807643_809083_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	26.5	3.6e-33
>prophage 59
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	831749	835575	4876986		Vibrio_phage(33.33%)	3	NA	NA
AZZ01412.1|831749_832421_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.6	2.3e-14
AZZ01413.1|832556_833855_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.6	1.3e-130
AZZ01414.1|833937_835575_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.0	1.2e-154
>prophage 60
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	848009	853305	4876986		Erysipelothrix_phage(33.33%)	3	NA	NA
AZZ01426.1|848009_849305_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	28.0	1.8e-36
AZZ01427.1|849362_852119_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.3	3.0e-52
AZZ01428.1|852162_853305_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.0	2.0e-47
>prophage 61
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	860725	861574	4876986		Vibrio_phage(100.0%)	1	NA	NA
AZZ01438.1|860725_861574_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	2.7e-41
>prophage 62
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	866440	867256	4876986		Bacillus_phage(100.0%)	1	NA	NA
AZZ01442.1|866440_867256_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	31.2	9.2e-10
>prophage 63
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	878799	895378	4876986	tRNA	environmental_halophage(16.67%)	10	NA	NA
AZZ01454.1|878799_880005_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.0	1.2e-71
AZZ01455.1|880004_880448_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
AZZ01456.1|880747_881635_+	EamA family transporter RarD	NA	NA	NA	NA	NA
AZZ01457.1|881686_882493_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.8	1.1e-15
AZZ01458.1|882602_883700_-	murein transglycosylase A	NA	NA	NA	NA	NA
AZZ01459.1|884199_885453_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.9	1.9e-14
AZZ01460.1|885685_887017_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
AZZ01461.1|887119_888955_-	exodeoxyribonuclease V subunit alpha	NA	A0A2P0VMS9	Tetraselmis_virus	25.2	8.4e-19
AZZ01462.1|888951_892497_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	21.6	1.4e-09
AZZ01463.1|892489_895378_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	23.8	1.6e-61
>prophage 64
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	900860	907815	4876986		Cronobacter_phage(33.33%)	6	NA	NA
AZZ01470.1|900860_901655_-	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	63.2	2.6e-118
AZZ01471.1|901661_902537_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AZZ01472.1|902752_904999_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	25.1	1.3e-10
AZZ01473.1|905011_905542_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AZZ01474.1|906224_906920_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
AZZ01475.1|907101_907815_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	6.9e-46
>prophage 65
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	918645	921179	4876986		Aichi_virus(50.0%)	2	NA	NA
AZZ01484.1|918645_920064_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.7	2.7e-25
AZZ01485.1|920417_921179_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	5.9e-19
>prophage 66
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	935883	946424	4876986	tRNA	Enterobacteria_phage(16.67%)	10	NA	NA
AZZ01500.1|935883_936420_-	porin family protein	NA	A5LH44	Enterobacteria_phage	30.7	5.6e-16
AZZ01501.1|936465_936651_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ01502.1|937586_938393_+	DUF1460 domain-containing protein	NA	NA	NA	NA	NA
AZZ01503.1|938677_939436_-	LysM peptidoglycan-binding domain-containing protein	NA	I2E8W3	Clostridium_phage	39.5	1.2e-11
AZZ01504.1|939700_940246_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
AZZ01505.1|940321_941839_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.1	4.8e-89
AZZ01506.1|941848_942947_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
AZZ01507.1|943051_944785_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.4	3.1e-63
AZZ01508.1|944790_945504_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AZZ01509.1|945527_946424_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.9	7.9e-31
>prophage 67
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	950408	956112	4876986		Pandoravirus(50.0%)	4	NA	NA
AZZ01517.1|950408_951842_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.0	8.8e-32
AZZ01518.1|951889_952783_-	transporter	NA	NA	NA	NA	NA
AZZ01519.1|952866_953013_-	immunoglobulin	NA	NA	NA	NA	NA
AZZ01520.1|953238_956112_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.2	2.4e-262
>prophage 68
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	964381	965614	4876986		Catovirus(100.0%)	1	NA	NA
AZZ01529.1|964381_965614_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.9	1.8e-102
>prophage 69
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	976790	977447	4876986		Bacillus_virus(100.0%)	1	NA	NA
AZZ01543.1|976790_977447_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
>prophage 70
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	985464	986937	4876986		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AZZ01551.1|985464_986937_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	33.2	1.2e-47
>prophage 71
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	992816	993971	4876986		Staphylococcus_phage(100.0%)	1	NA	NA
AZZ01558.1|992816_993971_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
>prophage 72
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1011278	1012361	4876986		Geobacillus_virus(100.0%)	1	NA	NA
AZZ01580.1|1011278_1012361_+	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
>prophage 73
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1017523	1018708	4876986		Enterobacteria_phage(100.0%)	1	NA	NA
AZZ01584.1|1017523_1018708_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	53.1	1.7e-121
>prophage 74
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1033963	1034860	4876986		Moraxella_phage(100.0%)	1	NA	NA
AZZ01597.1|1033963_1034860_-	WYL domain-containing protein	NA	A0A0R6PH67	Moraxella_phage	27.3	2.1e-31
>prophage 75
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1040313	1050586	4876986		Acinetobacter_phage(20.0%)	8	NA	NA
AZZ01602.1|1040313_1041948_-	SAM-dependent DNA methyltransferase	NA	J7I0U9	Acinetobacter_phage	30.9	2.6e-32
AZZ01603.1|1042011_1045425_-	DUF4145 domain-containing protein	NA	Q6NDX2	Leptospira_phage	26.2	8.5e-17
AZZ01604.1|1045708_1045906_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ01605.1|1046846_1047113_-	hypothetical protein	NA	A0A1L2CUJ8	Pectobacterium_phage	71.6	1.0e-26
AZZ01606.1|1047256_1047583_+	killer suppression protein HigA	NA	NA	NA	NA	NA
AZZ01607.1|1047579_1048662_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A075BTZ7	Microcystis_phage	38.6	5.5e-10
AZZ01608.1|1048664_1049609_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ01609.1|1049605_1050586_-	thymidylate synthase	NA	A0A218MLB7	uncultured_virus	34.2	7.3e-22
>prophage 76
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1056955	1058170	4876986		Salmonella_phage(100.0%)	1	NA	NA
AZZ01615.1|1056955_1058170_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
>prophage 77
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1062140	1062944	4876986		Hepacivirus(100.0%)	1	NA	NA
AZZ01621.1|1062140_1062944_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
>prophage 78
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1080977	1086585	4876986	transposase	Salmonella_phage(40.0%)	6	NA	NA
AZZ01640.1|1080977_1081796_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.0	1.6e-46
AZZ01641.1|1081887_1082373_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	9.0e-13
AZZ01642.1|1082388_1082865_+	DNA repair protein RadC	NA	NA	NA	NA	NA
AZZ01643.1|1082933_1083155_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
AZZ01644.1|1084194_1085070_-	class A extended-spectrum beta-lactamase CTX-M-55	NA	A0A1B0VBP7	Salmonella_phage	82.1	2.4e-125
AZZ01645.1|1085322_1086585_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
>prophage 79
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1105836	1106715	4876986		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AZZ01669.1|1105836_1106715_-	amidohydrolase	NA	M1HPY5	Paramecium_bursaria_Chlorella_virus	28.9	1.2e-07
>prophage 80
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1110114	1111587	4876986		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AZZ01672.1|1110114_1111587_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.8	6.0e-44
>prophage 81
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1127014	1132154	4876986		uncultured_Caudovirales_phage(50.0%)	6	NA	NA
AZZ01688.1|1127014_1128658_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	56.7	1.1e-09
AZZ01689.1|1128964_1129459_-	TIGR00645 family protein	NA	NA	NA	NA	NA
AZZ01690.1|1129737_1130253_-	RNA helicase	NA	NA	NA	NA	NA
AZZ01691.1|1130344_1130755_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ01692.1|1130741_1131146_+	cytoplasmic protein	NA	NA	NA	NA	NA
AZZ01693.1|1131269_1132154_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	48.2	1.5e-66
>prophage 82
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1138095	1143800	4876986		Staphylococcus_phage(33.33%)	6	NA	NA
AZZ01699.1|1138095_1138923_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	46.0	8.6e-64
AZZ01700.1|1139119_1140574_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
AZZ01701.1|1140618_1141074_+	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	36.8	2.4e-20
AZZ01702.1|1141027_1141228_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ01703.1|1141231_1141426_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ01704.1|1141628_1143800_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.8	2.0e-104
>prophage 83
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1149637	1153337	4876986		Bacillus_virus(50.0%)	3	NA	NA
AZZ01710.1|1149637_1151896_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.7	2.0e-86
AZZ01711.1|1152006_1152873_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZZ01712.1|1152944_1153337_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	48.1	1.6e-20
>prophage 84
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1156652	1158545	4876986		Bacillus_virus(100.0%)	1	NA	NA
AZZ01717.1|1156652_1158545_-	DNA topoisomerase 4 subunit B	NA	G3M9Z3	Bacillus_virus	34.8	5.3e-93
>prophage 85
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1162945	1164786	4876986		Erwinia_phage(50.0%)	2	NA	NA
AZZ01723.1|1162945_1163617_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	1.7e-33
AZZ01724.1|1163622_1164786_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.9	1.8e-88
>prophage 86
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1170542	1171196	4876986		Staphylococcus_phage(100.0%)	1	NA	NA
AZZ01730.1|1170542_1171196_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.8	1.6e-44
>prophage 87
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1175273	1176707	4876986		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AZZ01736.1|1175273_1176707_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.0	8.8e-40
>prophage 88
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1181935	1261159	4876986	head,transposase,tail,plate,terminase,lysis,portal,protease,tRNA,capsid,integrase,holin	Salmonella_phage(39.08%)	103	1191746:1191795	1252353:1252402
AZZ01740.1|1181935_1183177_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	47.9	5.0e-92
AZZ01741.1|1183280_1184102_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
AZZ01742.1|1184199_1184559_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
AZZ01743.1|1184665_1185277_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
AZZ05143.1|1185284_1185623_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ01744.1|1185526_1186540_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
AZZ01745.1|1186767_1186983_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AZZ01746.1|1187218_1188964_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
AZZ01747.1|1189113_1190961_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
AZZ01748.1|1191084_1191591_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
1191746:1191795	attL	GACTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCAAAT	NA	NA	NA	NA
AZZ05144.1|1192383_1192605_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ05145.1|1192763_1194464_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.2e-223
AZZ01749.1|1194466_1195012_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	1.4e-59
AZZ01750.1|1194983_1195709_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
AZZ01751.1|1195698_1196229_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
AZZ01752.1|1196231_1198244_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
AZZ01753.1|1198253_1198841_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	81.5	2.1e-88
AZZ01754.1|1198833_1200018_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.1	2.0e-178
AZZ01755.1|1200014_1200344_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
AZZ01756.1|1200340_1202311_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.8	2.1e-270
AZZ01757.1|1202498_1202756_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
AZZ01758.1|1202742_1202931_-	hypothetical protein	NA	F1BUL1	Cronobacter_phage	80.6	1.1e-22
AZZ01759.1|1202902_1203235_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	71.8	6.7e-36
AZZ01760.1|1203234_1203576_-	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
AZZ01761.1|1203572_1203866_-|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
AZZ01762.1|1203875_1204331_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
AZZ01763.1|1204327_1205455_-	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.5	3.3e-175
AZZ01764.1|1205451_1206159_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.1	3.4e-101
AZZ01765.1|1206155_1206662_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
AZZ05146.1|1206658_1207147_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	2.3e-64
AZZ01766.1|1207207_1207909_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	2.7e-87
AZZ01767.1|1207912_1208935_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
AZZ01768.1|1208996_1209797_-|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	54.8	3.2e-76
AZZ01769.1|1209957_1211733_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	83.1	1.7e-290
AZZ01770.1|1211729_1212791_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.3	3.0e-162
AZZ01771.1|1212787_1213111_+	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
AZZ01772.1|1213084_1213291_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ01773.1|1213410_1215432_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.8	2.1e-297
AZZ01774.1|1215428_1216289_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	82.4	4.9e-131
AZZ01775.1|1216278_1216608_-	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	45.2	3.0e-12
AZZ01776.1|1216604_1217201_-	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	72.3	3.8e-74
AZZ05147.1|1217191_1217368_-	DUF2732 family protein	NA	NA	NA	NA	NA
AZZ01777.1|1217514_1217916_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.9e-48
AZZ01778.1|1217915_1218341_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.9e-23
AZZ01779.1|1218330_1218558_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ01780.1|1218567_1219071_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
AZZ01781.1|1219101_1219323_-	regulator	NA	NA	NA	NA	NA
AZZ01782.1|1219442_1220021_+	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	39.5	1.5e-27
AZZ01783.1|1220049_1220943_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ01784.1|1220929_1221967_+|integrase	integrase	integrase	F1BUS9	Erwinia_phage	65.6	7.1e-124
AZZ01785.1|1222225_1222600_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ01786.1|1222615_1222834_-	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	80.6	5.2e-29
AZZ01787.1|1222902_1224003_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	92.6	3.4e-185
AZZ01788.1|1223999_1224485_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	1.5e-71
AZZ01789.1|1224481_1227259_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.5	2.6e-117
AZZ01790.1|1227251_1227371_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AZZ01791.1|1227385_1227688_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	94.9	1.5e-42
AZZ01792.1|1227742_1228258_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	98.2	6.7e-91
AZZ01793.1|1228267_1229440_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	95.1	1.1e-213
AZZ05148.1|1229573_1229984_-|tail	phage tail protein	tail	A0A291LAV4	Bordetella_phage	28.6	2.6e-05
AZZ01794.1|1230009_1231911_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	76.8	5.1e-96
AZZ01795.1|1231918_1232446_-|tail	phage tail protein I	tail	Q37841	Escherichia_phage	84.1	8.1e-84
AZZ01796.1|1232438_1233347_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	92.1	8.3e-145
AZZ01797.1|1233333_1233693_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	92.4	1.4e-55
AZZ01798.1|1233689_1234268_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	97.9	2.6e-107
AZZ01799.1|1234336_1234783_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	90.4	1.7e-66
AZZ01800.1|1234775_1235207_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
AZZ01801.1|1235302_1235728_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AZZ01802.1|1235727_1236105_-	peptidase	NA	A0A1S6KZZ2	Salmonella_phage	95.2	2.4e-58
AZZ01803.1|1236109_1236619_-	lysozyme	NA	E5G6N1	Salmonella_phage	79.9	1.7e-75
AZZ01804.1|1236599_1236815_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
AZZ01805.1|1236818_1237022_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AZZ01806.1|1237021_1237489_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	58.7	1.3e-48
AZZ01807.1|1237587_1238241_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	56.1	5.2e-56
AZZ01808.1|1238244_1239393_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	69.1	1.6e-132
AZZ01809.1|1239408_1240236_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	56.0	1.3e-72
AZZ01810.1|1240385_1242149_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	87.7	3.2e-312
AZZ01811.1|1242148_1243198_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	80.6	7.1e-156
AZZ01812.1|1243251_1243431_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ05149.1|1243510_1244005_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	41.3	1.2e-28
AZZ01813.1|1244629_1244863_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	2.2e-33
AZZ01814.1|1244874_1245063_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	6.1e-26
AZZ01815.1|1245224_1247618_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	90.3	0.0e+00
AZZ05150.1|1247614_1248466_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	71.9	8.1e-118
AZZ01816.1|1248462_1248690_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	1.9e-34
AZZ01817.1|1248689_1248923_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	80.5	5.4e-24
AZZ01818.1|1248990_1249332_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	86.7	2.6e-51
AZZ01819.1|1249295_1249496_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.9	8.7e-31
AZZ01820.1|1249503_1250013_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	93.5	1.0e-83
AZZ01821.1|1250047_1250284_-	regulator	NA	NA	NA	NA	NA
AZZ01822.1|1250385_1251000_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.6	7.8e-38
AZZ01823.1|1251041_1251224_+	hypothetical protein	NA	A0A0R6PIB1	Moraxella_phage	55.9	4.5e-10
AZZ01824.1|1251226_1252240_+|integrase	integrase	integrase	F1BUS9	Erwinia_phage	60.2	4.8e-117
AZZ01825.1|1253150_1254262_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.0	4.9e-06
1252353:1252402	attR	GACTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCAAAT	NA	NA	NA	NA
AZZ01826.1|1254304_1254877_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ01827.1|1254964_1256626_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	94.2	1.5e-311
AZZ01828.1|1256609_1256966_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	93.2	3.3e-57
AZZ01829.1|1257106_1257550_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	63.9	1.2e-51
AZZ01830.1|1257550_1257841_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	57.7	1.8e-29
AZZ01831.1|1257833_1258172_-|head,tail	head-tail adaptor	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	46.8	6.6e-23
AZZ01832.1|1258168_1259398_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	86.2	2.8e-212
AZZ01833.1|1259399_1259960_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	84.7	2.2e-87
AZZ01834.1|1260004_1261159_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	67.5	7.8e-148
>prophage 89
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1265847	1266096	4876986		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AZZ01841.1|1265847_1266096_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	55.7	1.4e-09
>prophage 90
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1271272	1276557	4876986		uncultured_Caudovirales_phage(33.33%)	3	NA	NA
AZZ01848.1|1271272_1272841_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	2.2e-12
AZZ01849.1|1273227_1274748_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	47.8	8.4e-33
AZZ01850.1|1275126_1276557_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	29.0	3.0e-32
>prophage 91
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1282746	1283715	4876986		Enterobacteria_phage(100.0%)	1	NA	NA
AZZ01856.1|1282746_1283715_+	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.9	5.0e-39
>prophage 92
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1296910	1299205	4876986		Tetraselmis_virus(100.0%)	1	NA	NA
AZZ01874.1|1296910_1299205_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	9.7e-158
>prophage 93
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1305681	1306827	4876986		Streptococcus_phage(100.0%)	1	NA	NA
AZZ01879.1|1305681_1306827_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	40.6	1.6e-47
>prophage 94
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1317514	1324163	4876986		Streptococcus_phage(25.0%)	9	NA	NA
AZZ01890.1|1317514_1318378_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	42.6	1.5e-50
AZZ01891.1|1318441_1320484_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
AZZ01892.1|1320441_1320837_+	YraN family protein	NA	NA	NA	NA	NA
AZZ01893.1|1320858_1321449_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.9	7.1e-12
AZZ01894.1|1321458_1322034_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
AZZ01895.1|1322100_1322736_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
AZZ01896.1|1322866_1323385_+	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	28.2	9.0e-11
AZZ01897.1|1323364_1323808_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ01898.1|1323845_1324163_+	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	50.0	8.4e-12
>prophage 95
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1329943	1331833	4876986		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AZZ01905.1|1329943_1331833_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	7.7e-52
>prophage 96
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1337368	1344025	4876986		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
AZZ01910.1|1337368_1340047_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	1.9e-24
AZZ01911.1|1340071_1341574_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
AZZ01912.1|1341601_1342066_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
AZZ01913.1|1342681_1344025_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	93.7	4.8e-64
>prophage 97
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1347488	1350376	4876986	protease	Pandoravirus(50.0%)	2	NA	NA
AZZ01917.1|1347488_1348337_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	30.3	1.4e-21
AZZ01918.1|1348441_1350376_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.3	9.2e-117
>prophage 98
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1357098	1358589	4876986		Indivirus(50.0%)	2	NA	NA
AZZ01926.1|1357098_1358070_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	7.8e-08
AZZ01927.1|1358301_1358589_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	68.7	3.5e-17
>prophage 99
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1362698	1377604	4876986		Staphylococcus_phage(28.57%)	17	NA	NA
AZZ01934.1|1362698_1363511_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	30.2	9.7e-20
AZZ01935.1|1363723_1364701_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
AZZ01936.1|1364714_1365701_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.2	1.1e-38
AZZ01937.1|1365721_1366288_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	74.3	3.6e-53
AZZ01938.1|1366284_1366860_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AZZ01939.1|1366828_1367383_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AZZ01940.1|1367389_1368115_+	lipopolysaccharide ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	7.1e-22
AZZ01941.1|1368162_1369596_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
AZZ01942.1|1369618_1369906_+	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
AZZ01943.1|1370023_1370515_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AZZ01944.1|1370560_1371415_+	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
AZZ01945.1|1371411_1371684_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
AZZ01946.1|1371932_1372565_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
AZZ01947.1|1372639_1373368_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AZZ01948.1|1373364_1374018_-	isoprenoid biosynthesis protein ElbB	NA	NA	NA	NA	NA
AZZ01949.1|1374244_1376581_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.6	6.0e-38
AZZ01950.1|1376674_1377604_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	34.2	1.5e-16
>prophage 100
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1384370	1385474	4876986		Salmonella_phage(100.0%)	1	NA	NA
AZZ01953.1|1384370_1385474_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	88.1	1.9e-74
>prophage 101
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1390265	1394300	4876986	protease	Burkholderia_virus(50.0%)	4	NA	NA
AZZ01959.1|1390265_1391756_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	21.9	2.7e-07
AZZ01960.1|1391871_1392765_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
AZZ01961.1|1392899_1393691_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
AZZ01962.1|1393799_1394300_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.8	2.5e-26
>prophage 102
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1399168	1400536	4876986	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AZZ01968.1|1399168_1400536_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.3	2.7e-22
>prophage 103
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1407530	1408799	4876986		Oenococcus_phage(100.0%)	1	NA	NA
AZZ01976.1|1407530_1408799_-	SLC13/DASS family transporter	NA	Q6A201	Oenococcus_phage	33.0	1.1e-59
>prophage 104
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1427255	1428299	4876986		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AZZ01994.1|1427255_1428299_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 105
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1440384	1443766	4876986		Ostreococcus_lucimarinus_virus(50.0%)	3	NA	NA
AZZ02007.1|1440384_1441269_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	32.8	1.3e-25
AZZ02008.1|1441351_1441516_+	DUF2556 domain-containing protein	NA	NA	NA	NA	NA
AZZ02009.1|1441666_1443766_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	33.5	7.1e-22
>prophage 106
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1457847	1462167	4876986	tRNA	Pandoravirus(33.33%)	6	NA	NA
AZZ02016.1|1457847_1458420_-	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	A0A291ATS8	Pandoravirus	27.3	9.9e-11
AZZ02017.1|1458424_1458967_-	DNA topoisomerase	NA	NA	NA	NA	NA
AZZ02018.1|1458993_1459467_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
AZZ02019.1|1459438_1460563_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AZZ02020.1|1460694_1461204_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	6.7e-19
AZZ02021.1|1461219_1462167_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	8.4e-07
>prophage 107
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1482060	1487631	4876986		Tupanvirus(33.33%)	7	NA	NA
AZZ02059.1|1482060_1483245_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.6e-13
AZZ02060.1|1483316_1485431_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	8.1e-58
AZZ02061.1|1485527_1485998_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
AZZ02062.1|1486093_1486468_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
AZZ02063.1|1486593_1486881_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
AZZ02064.1|1486888_1487245_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
AZZ02065.1|1487244_1487631_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	40.6	2.1e-20
>prophage 108
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1493592	1495500	4876986		Tupanvirus(100.0%)	1	NA	NA
AZZ02073.1|1493592_1495500_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.5	1.1e-74
>prophage 109
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1499938	1503935	4876986		environmental_Halophage(50.0%)	3	NA	NA
AZZ05157.1|1499938_1502026_+	hypothetical protein	NA	H9YQA8	environmental_Halophage	89.1	4.2e-67
AZZ02081.1|1502068_1503286_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AZZ02082.1|1503371_1503935_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
>prophage 110
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1521661	1522498	4876986		Vibrio_phage(100.0%)	1	NA	NA
AZZ02096.1|1521661_1522498_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	48.7	1.9e-66
>prophage 111
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1539538	1543301	4876986		Bacillus_phage(66.67%)	3	NA	NA
AZZ02112.1|1539538_1541158_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	53.3	1.2e-141
AZZ02113.1|1541232_1542585_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	22.9	9.5e-12
AZZ02114.1|1542581_1543301_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 112
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1549913	1550828	4876986	transposase	Sodalis_phage(100.0%)	1	NA	NA
AZZ02120.1|1549913_1550828_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	45.5	3.7e-68
>prophage 113
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1556888	1559282	4876986		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
AZZ02126.1|1556888_1559282_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	4.7e-14
>prophage 114
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1564291	1567405	4876986		Ralstonia_phage(50.0%)	2	NA	NA
AZZ05159.1|1564291_1565506_-	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	60.8	2.2e-137
AZZ02130.1|1565851_1567405_-	TROVE domain-containing protein	NA	R4TL80	Halovirus	25.5	4.4e-29
>prophage 115
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1581642	1584090	4876986		Dickeya_phage(100.0%)	1	NA	NA
AZZ02143.1|1581642_1584090_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	82.1	3.6e-33
>prophage 116
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1605729	1607537	4876986		Enterococcus_phage(50.0%)	2	NA	NA
AZZ02162.1|1605729_1606470_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	1.4e-09
AZZ02163.1|1606466_1607537_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.5	2.0e-20
>prophage 117
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1611363	1612846	4876986		Planktothrix_phage(50.0%)	2	NA	NA
AZZ02168.1|1611363_1612077_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	30.7	3.7e-15
AZZ02169.1|1612078_1612846_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.4	7.5e-14
>prophage 118
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1618637	1630297	4876986		Dickeya_phage(28.57%)	12	NA	NA
AZZ02176.1|1618637_1619492_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	42.3	7.0e-45
AZZ02177.1|1619737_1620793_-	cell division protein FtsX	NA	NA	NA	NA	NA
AZZ02178.1|1620785_1621454_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	24.6	1.9e-13
AZZ02179.1|1621456_1622932_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
AZZ02180.1|1623057_1623654_+	16S rRNA (guanine(966)-N(2))-methyltransferase	NA	NA	NA	NA	NA
AZZ02181.1|1623640_1623913_+	DUF1145 family protein	NA	NA	NA	NA	NA
AZZ02182.1|1623934_1624306_-	DUF2500 domain-containing protein	NA	NA	NA	NA	NA
AZZ02183.1|1624447_1625074_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	64.6	3.8e-32
AZZ02184.1|1625154_1627353_+	zinc/cadmium/lead-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.1	7.7e-112
AZZ02185.1|1627549_1629193_+	methyl-accepting chemotaxis citrate transducer	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.5	5.5e-14
AZZ05160.1|1629216_1629462_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	6.1e-10
AZZ02186.1|1629631_1630297_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	55.3	1.3e-57
>prophage 119
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1635677	1638419	4876986		Staphylococcus_phage(100.0%)	1	NA	NA
AZZ02192.1|1635677_1638419_-	ABC transporter ATP-binding protein/permease	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	4.6e-21
>prophage 120
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1646683	1648726	4876986		Indivirus(100.0%)	1	NA	NA
AZZ02200.1|1646683_1648726_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.2	3.6e-47
>prophage 121
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1667868	1668771	4876986		Burkholderia_virus(100.0%)	1	NA	NA
AZZ02217.1|1667868_1668771_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.5	3.4e-05
>prophage 122
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1697500	1699494	4876986		Bacillus_virus(50.0%)	2	NA	NA
AZZ02238.1|1697500_1698514_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.9	9.6e-17
AZZ02239.1|1698510_1699494_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.3	3.3e-14
>prophage 123
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1717476	1723814	4876986		Escherichia_phage(33.33%)	6	NA	NA
AZZ02255.1|1717476_1719810_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	30.4	2.0e-73
AZZ02256.1|1719962_1720625_+	OmpA family lipoprotein	NA	NA	NA	NA	NA
AZZ02257.1|1720850_1721825_+	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	26.7	1.2e-16
AZZ02258.1|1721874_1722585_-	DUF3053 domain-containing protein	NA	NA	NA	NA	NA
AZZ02259.1|1723023_1723314_+	HTH-type transcriptional regulator	NA	NA	NA	NA	NA
AZZ02260.1|1723601_1723814_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 124
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1727834	1729022	4876986		Mannheimia_phage(50.0%)	2	NA	NA
AZZ02265.1|1727834_1728605_+	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	28.6	7.8e-19
AZZ02266.1|1728830_1729022_-	hypothetical protein	NA	A0A2I6AZV9	Macacine_betaherpesvirus	69.8	1.5e-19
>prophage 125
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1733088	1734084	4876986		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AZZ02271.1|1733088_1734084_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.1	2.8e-13
>prophage 126
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1754963	1760765	4876986	tRNA	Streptococcus_phage(50.0%)	4	NA	NA
AZZ05164.1|1754963_1756043_+	restriction endonuclease	NA	A0A1S5SAB0	Streptococcus_phage	39.7	2.2e-67
AZZ02291.1|1756078_1757617_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AZZ02292.1|1757785_1758667_+	ROK family protein	NA	NA	NA	NA	NA
AZZ02293.1|1758914_1760765_-|tRNA	selenocysteinyl-tRNA-specific translation elongation factor SelB	tRNA	A0A2K9KZ60	Tupanvirus	24.3	5.0e-11
>prophage 127
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1784028	1793528	4876986		Rhizobium_phage(16.67%)	9	NA	NA
AZZ02313.1|1784028_1784280_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	53.4	2.2e-15
AZZ02314.1|1784365_1784797_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AZZ02315.1|1785044_1786589_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AZZ02316.1|1786598_1787882_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	30.3	6.1e-08
AZZ02317.1|1787885_1788848_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AZZ02318.1|1788834_1789869_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.3	1.4e-07
AZZ02319.1|1790161_1791187_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	86.5	1.6e-19
AZZ02320.1|1791196_1792393_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	30.0	1.9e-35
AZZ02321.1|1792595_1793528_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	36.4	8.5e-36
>prophage 128
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1807888	1812438	4876986		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
AZZ02335.1|1807888_1808368_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.5e-28
AZZ02336.1|1808391_1809201_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.8	1.0e-24
AZZ02337.1|1809298_1809466_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
AZZ02338.1|1809486_1809723_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
AZZ02339.1|1809940_1810606_-	JAB domain-containing protein	NA	NA	NA	NA	NA
AZZ02340.1|1810778_1812002_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.8	5.5e-43
AZZ05165.1|1811982_1812438_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.1	1.2e-48
>prophage 129
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1818416	1823442	4876986		Pseudomonas_phage(33.33%)	4	NA	NA
AZZ02348.1|1818416_1820102_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	21.7	3.1e-20
AZZ02349.1|1820358_1820982_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.6	2.8e-19
AZZ02350.1|1821036_1821312_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AZZ02351.1|1821330_1823442_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 130
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1827690	1829082	4876986		environmental_Halophage(100.0%)	1	NA	NA
AZZ02355.1|1827690_1829082_+	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	95.9	6.7e-69
>prophage 131
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1835271	1845920	4876986		Enterobacteria_phage(100.0%)	12	NA	NA
AZZ02359.1|1835271_1836462_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	85.0	1.8e-195
AZZ02360.1|1836454_1838551_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ02361.1|1838552_1839206_+	DUF2290 domain-containing protein	NA	NA	NA	NA	NA
AZZ02362.1|1839410_1839983_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	1.1e-94
AZZ02363.1|1839997_1840243_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	98.8	1.5e-40
AZZ02364.1|1840239_1840974_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.8	5.2e-129
AZZ02365.1|1841525_1841792_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
AZZ02366.1|1841788_1842388_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	81.8	1.3e-50
AZZ02367.1|1842380_1842668_+	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	96.8	3.3e-47
AZZ02368.1|1842660_1843116_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
AZZ02369.1|1843251_1843572_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ02370.1|1843586_1845920_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.6	0.0e+00
>prophage 132
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1851664	1854532	4876986		Escherichia_phage(100.0%)	1	NA	NA
AZZ02376.1|1851664_1854532_+	intestinal colonization autotransporter adhesin MisL	NA	A0A2L1IV18	Escherichia_phage	44.1	6.6e-95
>prophage 133
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1858445	1864479	4876986	transposase	Paramecium_bursaria_Chlorella_virus(33.33%)	4	NA	NA
AZZ02382.1|1858445_1861172_-	magnesium-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.1	1.6e-34
AZZ02383.1|1861391_1862087_-	MgtC family protein	NA	G3MA03	Bacillus_virus	42.4	2.8e-15
AZZ02384.1|1862592_1863495_+	EamA family transporter	NA	NA	NA	NA	NA
AZZ02385.1|1863537_1864479_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.8	9.4e-67
>prophage 134
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1872844	1877325	4876986		Pandoravirus(50.0%)	5	NA	NA
AZZ02394.1|1872844_1874227_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	28.9	2.0e-41
AZZ02395.1|1874286_1875480_-	purine ribonucleoside efflux pump NepI	NA	NA	NA	NA	NA
AZZ02396.1|1875694_1876054_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AZZ02397.1|1876037_1876361_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AZZ02398.1|1876545_1877325_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.4	1.5e-38
>prophage 135
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1894041	1898998	4876986		Micromonas_pusilla_virus(50.0%)	5	NA	NA
AZZ02416.1|1894041_1895730_-	acetolactate synthase large subunit	NA	G8DDL3	Micromonas_pusilla_virus	30.7	7.1e-57
AZZ02417.1|1895836_1895935_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
AZZ02418.1|1896568_1896658_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
AZZ02419.1|1896750_1897611_+	EamA family transporter	NA	NA	NA	NA	NA
AZZ02420.1|1897813_1898998_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	24.1	2.2e-12
>prophage 136
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1907501	1908453	4876986		Synechococcus_phage(50.0%)	2	NA	NA
AZZ02428.1|1907501_1907930_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	38.2	1.7e-15
AZZ02429.1|1908039_1908453_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	37.0	1.0e-17
>prophage 137
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1916096	1927311	4876986		Brazilian_cedratvirus(25.0%)	8	NA	NA
AZZ05169.1|1916096_1916714_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	6.9e-10
AZZ02439.1|1916719_1918120_-	c-type cytochrome	NA	NA	NA	NA	NA
AZZ02440.1|1918309_1918942_-	molecular chaperone TorD	NA	NA	NA	NA	NA
AZZ02441.1|1918934_1921487_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.7	4.8e-73
AZZ02442.1|1921476_1922661_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
AZZ05170.1|1922790_1923483_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	3.8e-17
AZZ02443.1|1923455_1924496_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
AZZ02444.1|1924575_1927311_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.2	2.1e-34
>prophage 138
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1933201	1940819	4876986		Bacillus_virus(33.33%)	7	NA	NA
AZZ02450.1|1933201_1935616_-	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	34.6	2.2e-115
AZZ02451.1|1935644_1936718_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
AZZ02452.1|1936915_1938016_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	34.7	4.1e-53
AZZ02453.1|1938020_1939421_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AZZ02454.1|1940081_1940222_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
AZZ02455.1|1940238_1940598_+	ribonuclease P protein component	NA	NA	NA	NA	NA
AZZ02456.1|1940561_1940819_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 139
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1951849	1959600	4876986		Moraxella_phage(33.33%)	8	NA	NA
AZZ02464.1|1951849_1953313_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.1	1.2e-63
AZZ02465.1|1953392_1954202_+	WG repeat-containing protein	NA	NA	NA	NA	NA
AZZ02466.1|1954214_1954880_+	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
AZZ02467.1|1954974_1955700_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
AZZ02468.1|1955714_1956488_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	30.6	2.0e-14
AZZ02469.1|1956574_1957465_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
AZZ02470.1|1957464_1958424_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
AZZ02471.1|1958559_1959600_-	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	35.9	1.2e-46
>prophage 140
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1964008	1967397	4876986		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
AZZ02475.1|1964008_1965838_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	42.9	1.5e-129
AZZ02476.1|1966026_1967397_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	38.7	2.5e-36
>prophage 141
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1980283	1981276	4876986		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
AZZ02491.1|1980283_1981276_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.3	3.2e-49
>prophage 142
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	1984569	1988587	4876986		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
AZZ02494.1|1984569_1986438_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	1.5e-63
AZZ02495.1|1986654_1987074_+	D-ribose pyranase	NA	NA	NA	NA	NA
AZZ05173.1|1987081_1988587_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	24.6	5.1e-14
>prophage 143
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2003984	2005631	4876986		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AZZ02507.1|2003984_2005631_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	1.2e-64
>prophage 144
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2010991	2011333	4876986		Pseudomonas_phage(100.0%)	1	NA	NA
AZZ02512.1|2010991_2011333_+	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	38.5	2.2e-05
>prophage 145
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2015903	2022134	4876986		Vibrio_phage(25.0%)	5	NA	NA
AZZ05176.1|2015903_2016632_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	31.2	3.5e-21
AZZ02517.1|2016731_2018756_+	ATP-dependent DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.3	1.1e-112
AZZ02518.1|2018795_2020277_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
AZZ02519.1|2020395_2021661_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.7	3.7e-42
AZZ02520.1|2021804_2022134_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 146
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2026258	2031762	4876986		Enterobacteria_phage(40.0%)	6	NA	NA
AZZ02524.1|2026258_2027389_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	27.7	2.3e-27
AZZ02525.1|2027385_2028648_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HFY9	Paramecium_bursaria_Chlorella_virus	27.5	2.7e-24
AZZ02526.1|2028647_2029715_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.8	6.9e-98
AZZ02527.1|2029747_2029972_+	sugar nucleotidyltransferase	NA	I7I009	Enterobacteria_phage	52.2	2.0e-07
AZZ02528.1|2029922_2030627_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
AZZ02529.1|2030631_2031762_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	40.9	3.3e-18
>prophage 147
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2050758	2054674	4876986		Bacillus_phage(100.0%)	3	NA	NA
AZZ02547.1|2050758_2051661_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	31.0	7.7e-26
AZZ02548.1|2051660_2052377_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
AZZ02549.1|2052511_2054674_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.1	1.7e-116
>prophage 148
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2059546	2061376	4876986		Catovirus(100.0%)	1	NA	NA
AZZ05179.1|2059546_2061376_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.4	2.6e-81
>prophage 149
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2075606	2079041	4876986		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
AZZ02571.1|2075606_2077247_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	28.5	3.4e-40
AZZ02572.1|2077452_2077707_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
AZZ02573.1|2077710_2078259_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
AZZ02574.1|2078261_2079041_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	30.7	1.5e-25
>prophage 150
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2089968	2090583	4876986		Streptococcus_phage(100.0%)	1	NA	NA
AZZ02582.1|2089968_2090583_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	39.3	1.1e-18
>prophage 151
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2103027	2105814	4876986		Enterococcus_phage(100.0%)	1	NA	NA
AZZ02590.1|2103027_2105814_+	DNA polymerase I	NA	A0A0C5K9B9	Enterococcus_phage	27.0	1.3e-47
>prophage 152
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2111171	2112221	4876986		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
AZZ02597.1|2111171_2112221_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	1.5e-09
>prophage 153
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2130660	2133455	4876986		Staphylococcus_phage(50.0%)	3	NA	NA
AZZ02613.1|2130660_2131557_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	100.0	1.5e-66
AZZ02614.1|2131721_2132618_+	sugar kinase	NA	NA	NA	NA	NA
AZZ02615.1|2132651_2133455_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.8	7.6e-25
>prophage 154
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2141654	2144705	4876986		Escherichia_phage(100.0%)	1	NA	NA
AZZ02627.1|2141654_2144705_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	24.1	4.6e-06
>prophage 155
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2163436	2167663	4876986		Bacillus_thuringiensis_phage(33.33%)	6	NA	NA
AZZ02645.1|2163436_2164057_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
AZZ02646.1|2164063_2164816_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
AZZ02647.1|2164827_2165223_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
AZZ02648.1|2165343_2165547_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ02649.1|2165594_2166968_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
AZZ02650.1|2166964_2167663_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 156
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2180726	2182262	4876986		Staphylococcus_phage(100.0%)	1	NA	NA
AZZ02664.1|2180726_2182262_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
>prophage 157
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2193096	2197707	4876986		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
AZZ02677.1|2193096_2193942_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
AZZ02678.1|2194340_2194580_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
AZZ02679.1|2194801_2195287_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AZZ02680.1|2195379_2196309_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AZZ02681.1|2196375_2197707_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
>prophage 158
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2221134	2221797	4876986		Synechococcus_phage(100.0%)	1	NA	NA
AZZ02698.1|2221134_2221797_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	8.4e-30
>prophage 159
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2237871	2239716	4876986		Acinetobacter_phage(100.0%)	1	NA	NA
AZZ02711.1|2237871_2239716_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	30.0	2.2e-11
>prophage 160
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2248451	2251545	4876986		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
AZZ02716.1|2248451_2249402_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.5	7.9e-29
AZZ02717.1|2249610_2249784_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ02718.1|2250360_2251545_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.6e-13
>prophage 161
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2255665	2266116	4876986		Chrysochromulina_ericina_virus(33.33%)	6	NA	NA
AZZ02725.1|2255665_2259694_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
AZZ02726.1|2259770_2263994_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.1	5.0e-67
AZZ02727.1|2264035_2264362_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ02728.1|2264347_2264707_-	cytoplasmic protein	NA	NA	NA	NA	NA
AZZ05187.1|2264818_2265022_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ02729.1|2265087_2266116_+	type III secretion system effector arginine glycosyltransferase SseK1	NA	Q8HAB2	Salmonella_phage	61.1	1.1e-103
>prophage 162
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2274533	2276296	4876986		Klosneuvirus(50.0%)	3	NA	NA
AZZ02739.1|2274533_2275205_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	1.6e-20
AZZ02740.1|2275246_2275837_+	DUF416 family protein	NA	NA	NA	NA	NA
AZZ02741.1|2276023_2276296_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	57.8	5.5e-20
>prophage 163
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2281780	2283370	4876986		Prochlorococcus_phage(100.0%)	1	NA	NA
AZZ02747.1|2281780_2283370_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.1	4.9e-68
>prophage 164
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2297531	2301215	4876986		Dickeya_phage(100.0%)	1	NA	NA
AZZ02753.1|2297531_2301215_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 165
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2307110	2327339	4876986	plate,tail	Burkholderia_phage(38.1%)	25	NA	NA
AZZ02761.1|2307110_2307839_-	hypothetical protein	NA	A0A292GAQ8	Xanthomonas_phage	28.2	3.5e-13
AZZ02762.1|2308576_2309032_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ02763.1|2309028_2309730_-	DUF4376 domain-containing protein	NA	K7PMH7	Enterobacteria_phage	45.9	7.6e-29
AZZ02764.1|2309732_2311178_-	short-chain fatty acid transporter	NA	A0A0M3ULH6	Salmonella_phage	38.1	5.0e-75
AZZ02765.1|2311180_2311813_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
AZZ02766.1|2311805_2312921_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	51.7	1.5e-100
AZZ02767.1|2312911_2313271_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	63.3	3.1e-34
AZZ02768.1|2313434_2314982_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	2.5e-48
AZZ02769.1|2314981_2315911_-	glycosyltransferase	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
AZZ02770.1|2315907_2316270_-	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
AZZ02771.1|2316597_2317320_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
AZZ02772.1|2317329_2318373_-	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.9	2.9e-77
AZZ02773.1|2318360_2318570_-	hypothetical protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
AZZ02774.1|2318569_2319523_-	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
AZZ02775.1|2319522_2321889_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.9	2.7e-70
AZZ02776.1|2321985_2322114_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AZZ02777.1|2322073_2322391_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AZZ02778.1|2322442_2322967_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
AZZ02779.1|2322966_2324394_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	1.4e-194
AZZ02780.1|2324383_2324581_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
AZZ02781.1|2324577_2325033_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ02782.1|2325192_2325507_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
AZZ02783.1|2325519_2326125_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	61.0	1.0e-61
AZZ02784.1|2326127_2326415_-	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
AZZ02785.1|2326991_2327339_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 166
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2339926	2341036	4876986		Mycoplasma_phage(100.0%)	1	NA	NA
AZZ02795.1|2339926_2341036_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
>prophage 167
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2348294	2348903	4876986		Lactococcus_phage(100.0%)	1	NA	NA
AZZ02802.1|2348294_2348903_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 168
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2355638	2358165	4876986		Salmonella_phage(50.0%)	2	NA	NA
AZZ02810.1|2355638_2357054_+	replicative DNA helicase DnaB	NA	A0A1B0VG30	Salmonella_phage	78.4	7.0e-199
AZZ02811.1|2357085_2358165_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.1	1.2e-28
>prophage 169
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2362260	2365864	4876986		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
AZZ02818.1|2362260_2365086_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.7	0.0e+00
AZZ02819.1|2365050_2365167_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ02820.1|2365333_2365864_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	77.2	3.9e-54
>prophage 170
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2388245	2390312	4876986		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AZZ02826.1|2388245_2390312_+	peptidase domain-containing ABC transporter	NA	F2Y2R6	Organic_Lake_phycodnavirus	23.7	6.3e-15
>prophage 171
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2395197	2396547	4876986		Moraxella_phage(100.0%)	1	NA	NA
AZZ02832.1|2395197_2396547_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.4	6.7e-159
>prophage 172
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2402765	2404724	4876986		Staphylococcus_phage(100.0%)	1	NA	NA
AZZ02839.1|2402765_2404724_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.2	2.2e-89
>prophage 173
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2414350	2422721	4876986		Escherichia_phage(25.0%)	8	NA	NA
AZZ02849.1|2414350_2416498_-	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	24.5	1.0e-31
AZZ02850.1|2416863_2417772_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	37.1	7.8e-34
AZZ05194.1|2418029_2418494_-	aminoalkylphosphonate N-acetyltransferase	NA	NA	NA	NA	NA
AZZ02851.1|2418615_2419059_-	VOC family metalloprotein YjdN	NA	NA	NA	NA	NA
AZZ02852.1|2419178_2419514_-	phnA family protein	NA	NA	NA	NA	NA
AZZ02853.1|2419981_2421484_+	proline/glycine betaine transporter ProP	NA	Q6JIH2	Burkholderia_virus	30.5	3.5e-55
AZZ02854.1|2421553_2421643_+	LpxT activity modulator PmrR	NA	NA	NA	NA	NA
AZZ05195.1|2421650_2422721_-	two-component system sensor histidine kinase PmrB	NA	W8CYF6	Bacillus_phage	25.3	6.0e-09
>prophage 174
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2440940	2445414	4876986		Escherichia_phage(100.0%)	4	NA	NA
AZZ05197.1|2440940_2443340_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	81.3	0.0e+00
AZZ02867.1|2443353_2443980_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	91.3	3.2e-119
AZZ02868.1|2443972_2444746_+	dimethyl sulfoxide reductase	NA	A0A077SK59	Escherichia_phage	79.8	7.9e-104
AZZ02869.1|2444760_2445414_+	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	72.4	1.8e-80
>prophage 175
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2460744	2461791	4876986		Synechococcus_phage(100.0%)	1	NA	NA
AZZ02884.1|2460744_2461791_+	galactitol-1-phosphate 5-dehydrogenase	NA	E3SJ82	Synechococcus_phage	24.9	2.8e-11
>prophage 176
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2474343	2476327	4876986		Cronobacter_phage(50.0%)	2	NA	NA
AZZ02892.1|2474343_2474637_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	1.2e-12
AZZ02893.1|2474680_2476327_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.7	1.2e-189
>prophage 177
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2481393	2481927	4876986		Morganella_phage(100.0%)	1	NA	NA
AZZ02901.1|2481393_2481927_-	outer membrane lipoprotein Blc	NA	A0A1W6JNX6	Morganella_phage	54.8	1.2e-47
>prophage 178
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2485653	2486631	4876986		Tupanvirus(100.0%)	1	NA	NA
AZZ02906.1|2485653_2486631_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.1	1.7e-26
>prophage 179
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2494355	2494901	4876986		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AZZ02912.1|2494355_2494901_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.6	4.5e-29
>prophage 180
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2499803	2502989	4876986		Vibrio_phage(50.0%)	2	NA	NA
AZZ02917.1|2499803_2501123_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	29.2	1.8e-15
AZZ02918.1|2501132_2502989_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.8	5.8e-60
>prophage 181
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2508534	2512941	4876986		Pithovirus(50.0%)	3	NA	NA
AZZ02925.1|2508534_2509833_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.6	8.4e-66
AZZ02926.1|2510039_2510465_+	HTH-type transcriptional repressor NsrR	NA	NA	NA	NA	NA
AZZ02927.1|2510502_2512941_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	2.2e-67
>prophage 182
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2517804	2518968	4876986		Ralstonia_phage(100.0%)	1	NA	NA
AZZ02935.1|2517804_2518968_+	glutathionylspermidine synthase preATP-grasp family protein	NA	B2ZXR7	Ralstonia_phage	43.8	1.5e-82
>prophage 183
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2554665	2556421	4876986		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AZZ02975.1|2554665_2555196_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	4.2e-56
AZZ02976.1|2555422_2556421_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.4	1.3e-69
>prophage 184
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2568344	2571588	4876986		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
AZZ02990.1|2568344_2568587_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	51.2	5.6e-16
AZZ02991.1|2568576_2568861_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	71.3	1.3e-32
AZZ02992.1|2568864_2569329_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	55.8	6.1e-51
AZZ02993.1|2569449_2571588_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.7	6.9e-267
>prophage 185
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2575254	2581803	4876986	transposase	Enterobacteria_phage(33.33%)	7	NA	NA
AZZ02996.1|2575254_2576202_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.5	1.2e-13
AZZ02997.1|2576346_2576445_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
AZZ02998.1|2576585_2579294_+	magnesium-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	25.2	2.0e-45
AZZ02999.1|2579409_2579856_-|transposase	transposase	transposase	NA	NA	NA	NA
AZZ03000.1|2579930_2580317_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
AZZ03001.1|2580393_2580855_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AZZ03002.1|2580867_2581803_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.2	6.5e-52
>prophage 186
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2593900	2598847	4876986	tRNA	Klosneuvirus(50.0%)	3	NA	NA
AZZ03016.1|2593900_2596756_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.4	1.2e-141
AZZ03017.1|2596755_2597238_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AZZ03018.1|2597335_2598847_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.7	8.3e-49
>prophage 187
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2606657	2609412	4876986		Acanthamoeba_polyphaga_mimivirus(50.0%)	2	NA	NA
AZZ03026.1|2606657_2607677_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.1	1.3e-42
AZZ03027.1|2608146_2609412_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	40.4	1.4e-73
>prophage 188
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2613463	2619647	4876986		Enterobacteria_phage(75.0%)	8	NA	NA
AZZ03029.1|2613463_2613736_-	hypothetical protein	NA	A0A2I8TV89	Erwinia_phage	46.9	8.3e-08
AZZ03030.1|2613737_2614292_-	phage polarity suppression protein	NA	NA	NA	NA	NA
AZZ03031.1|2614288_2615041_-	septation initiation protein	NA	NA	NA	NA	NA
AZZ03032.1|2615952_2616213_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	66.3	1.3e-23
AZZ03033.1|2616212_2616758_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	65.7	7.7e-29
AZZ05204.1|2616757_2616979_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ03034.1|2616978_2617302_+	DNA replication protein	NA	NA	NA	NA	NA
AZZ03035.1|2617316_2619647_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	73.2	0.0e+00
>prophage 189
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2641509	2642463	4876986	transposase	Sodalis_phage(100.0%)	1	NA	NA
AZZ03059.1|2641509_2642463_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.5	8.1e-66
>prophage 190
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2651115	2652777	4876986		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AZZ03068.1|2651115_2652777_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	72.3	6.0e-08
>prophage 191
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2656039	2657319	4876986		Shigella_phage(50.0%)	2	NA	NA
AZZ03071.1|2656039_2656777_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.2	1.2e-64
AZZ03072.1|2656779_2657319_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	65.6	2.2e-28
>prophage 192
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2662284	2663349	4876986		Bacillus_virus(100.0%)	1	NA	NA
AZZ03078.1|2662284_2663349_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	33.1	4.2e-15
>prophage 193
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2667126	2670025	4876986		Streptococcus_phage(50.0%)	3	NA	NA
AZZ03084.1|2667126_2668716_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	3.1e-30
AZZ03085.1|2669117_2669735_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
AZZ03086.1|2669845_2670025_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	66.0	1.5e-10
>prophage 194
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2675572	2676895	4876986		Geobacillus_virus(100.0%)	1	NA	NA
AZZ03090.1|2675572_2676895_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	41.4	1.8e-79
>prophage 195
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2689045	2694209	4876986		Enterococcus_phage(33.33%)	3	NA	NA
AZZ03101.1|2689045_2690278_+	trifunctional nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase/transcriptional regulator NadR	NA	A0A0C5K935	Enterococcus_phage	45.2	1.1e-88
AZZ03102.1|2690395_2692063_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.7	1.7e-42
AZZ03103.1|2692235_2694209_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	36.4	1.8e-11
>prophage 196
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2698158	2699583	4876986		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
AZZ03111.1|2698158_2699583_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.1	2.1e-09
>prophage 197
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2718334	2730644	4876986		Cyanophage(20.0%)	12	NA	NA
AZZ03128.1|2718334_2719288_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.0	9.7e-11
AZZ03129.1|2719398_2719989_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
AZZ03130.1|2720045_2720612_-	acetate uptake transporter	NA	NA	NA	NA	NA
AZZ03131.1|2720761_2721475_-	acidic protein MsyB	NA	NA	NA	NA	NA
AZZ03132.1|2721510_2721915_-	DUF2541 family protein	NA	NA	NA	NA	NA
AZZ03133.1|2722263_2724180_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	48.9	5.8e-148
AZZ03134.1|2724265_2725405_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	36.0	4.2e-29
AZZ03135.1|2725685_2726633_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ03136.1|2726759_2727104_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ03137.1|2727164_2727698_-	hypothetical protein	NA	A0A0U2I1S0	Escherichia_phage	56.6	1.2e-53
AZZ03138.1|2727714_2728158_-	transcriptional regulator	NA	NA	NA	NA	NA
AZZ03139.1|2728538_2730644_+	chitinase	NA	A0A1L5JGH0	Plodia_interpunctella_granulovirus	28.5	5.2e-33
>prophage 198
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2750805	2752299	4876986		Tetraselmis_virus(100.0%)	1	NA	NA
AZZ03156.1|2750805_2752299_+	DUF229 domain-containing protein	NA	A0A2P0VMN7	Tetraselmis_virus	30.6	9.1e-32
>prophage 199
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2756864	2758031	4876986		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AZZ03160.1|2756864_2758031_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.1	7.5e-90
>prophage 200
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2764529	2767364	4876986	tRNA	Tupanvirus(100.0%)	1	NA	NA
AZZ03167.1|2764529_2767364_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	5.0e-79
>prophage 201
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2786369	2787518	4876986		Halovirus(100.0%)	1	NA	NA
AZZ03185.1|2786369_2787518_+	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.1	2.0e-50
>prophage 202
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2793055	2798695	4876986		Hepacivirus(50.0%)	4	NA	NA
AZZ03190.1|2793055_2794609_-	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	24.8	1.5e-29
AZZ05212.1|2794671_2795889_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
AZZ03191.1|2796000_2797143_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AZZ03192.1|2797177_2798695_-	L-carnitine/gamma-butyrobetaine antiporter	NA	A0A2I7QNT1	Vibrio_phage	22.2	1.4e-08
>prophage 203
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2806450	2808340	4876986		Catovirus(100.0%)	1	NA	NA
AZZ03201.1|2806450_2808340_+	phosphatase	NA	A0A1V0SA98	Catovirus	24.7	5.0e-27
>prophage 204
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2811477	2812911	4876986		Bacillus_phage(50.0%)	2	NA	NA
AZZ03204.1|2811477_2811957_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	47.1	2.3e-29
AZZ03205.1|2812062_2812911_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0E3T919	Enterococcus_phage	47.8	5.8e-07
>prophage 205
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2820640	2826072	4876986		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
AZZ03213.1|2820640_2823547_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.1	2.9e-21
AZZ03214.1|2823720_2826072_-	DNA polymerase II	NA	A0A1B2RW58	Lymphocystis_disease_virus	25.5	5.5e-15
>prophage 206
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2833847	2834555	4876986		Bacillus_virus(100.0%)	1	NA	NA
AZZ03222.1|2833847_2834555_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	38.3	1.4e-22
>prophage 207
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2842604	2844176	4876986		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
AZZ03230.1|2842604_2844176_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.1	6.9e-06
>prophage 208
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2876220	2877264	4876986		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AZZ03257.1|2876220_2877264_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.6	5.9e-102
>prophage 209
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2881521	2882085	4876986		Sphingobium_phage(100.0%)	1	NA	NA
AZZ03262.1|2881521_2882085_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	30.0	2.6e-11
>prophage 210
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2893176	2894601	4876986		Erysipelothrix_phage(100.0%)	1	NA	NA
AZZ05216.1|2893176_2894601_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.2e-41
>prophage 211
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2910787	2920491	4876986		Escherichia_phage(25.0%)	9	NA	NA
AZZ03286.1|2910787_2911555_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	35.7	1.7e-29
AZZ03287.1|2911584_2912379_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
AZZ03288.1|2912399_2913260_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
AZZ03289.1|2913366_2913714_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ03290.1|2913915_2915526_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	59.8	3.0e-20
AZZ03291.1|2915603_2917994_-	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
AZZ03292.1|2918199_2918736_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	1.0e-17
AZZ03293.1|2918793_2919456_-	carbonate dehydratase	NA	NA	NA	NA	NA
AZZ03294.1|2919564_2920491_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.7	5.9e-21
>prophage 212
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2938513	2939932	4876986		unidentified_phage(100.0%)	1	NA	NA
AZZ03312.1|2938513_2939932_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.8	1.9e-26
>prophage 213
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2942948	2945423	4876986		Bodo_saltans_virus(100.0%)	1	NA	NA
AZZ03317.1|2942948_2945423_+	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	28.0	1.2e-33
>prophage 214
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2950616	2951414	4876986		Planktothrix_phage(100.0%)	1	NA	NA
AZZ03320.1|2950616_2951414_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	3.5e-14
>prophage 215
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2964782	2965127	4876986		Lake_Baikal_phage(100.0%)	1	NA	NA
AZZ03330.1|2964782_2965127_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	1.0e-26
>prophage 216
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2969110	2970538	4876986	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AZZ03335.1|2969110_2970538_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.2	4.2e-26
>prophage 217
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2983975	2984734	4876986		Flavobacterium_phage(100.0%)	1	NA	NA
AZZ03347.1|2983975_2984734_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	42.2	1.9e-25
>prophage 218
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	2993545	2997648	4876986		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
AZZ03356.1|2993545_2994142_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.3	1.5e-25
AZZ03357.1|2994165_2997648_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	2.8e-209
>prophage 219
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3011635	3012667	4876986		Planktothrix_phage(100.0%)	1	NA	NA
AZZ03373.1|3011635_3012667_-	D-methionine ABC transporter, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
>prophage 220
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3019443	3020247	4876986		Indivirus(100.0%)	1	NA	NA
AZZ03375.1|3019443_3020247_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.0	4.6e-38
>prophage 221
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3024297	3028508	4876986		Lactobacillus_phage(33.33%)	5	NA	NA
AZZ03380.1|3024297_3025665_-	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	33.0	1.4e-10
AZZ03381.1|3025736_3026492_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AZZ03382.1|3026526_3027249_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZZ03383.1|3027245_3027713_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	4.7e-51
AZZ03384.1|3027776_3028508_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	6.4e-39
>prophage 222
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3035567	3038207	4876986		Vibrio_phage(100.0%)	1	NA	NA
AZZ03391.1|3035567_3038207_+	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	35.7	2.3e-78
>prophage 223
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3083665	3084244	4876986		Caulobacter_phage(100.0%)	1	NA	NA
AZZ03427.1|3083665_3084244_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.8	1.3e-13
>prophage 224
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3087458	3088598	4876986		Mycobacterium_phage(100.0%)	1	NA	NA
AZZ03431.1|3087458_3088598_+	RNA ligase RtcB family protein	NA	A0A222ZM82	Mycobacterium_phage	30.7	1.0e-30
>prophage 225
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3093371	3097069	4876986		Streptococcus_phage(66.67%)	3	NA	NA
AZZ03437.1|3093371_3094424_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	2.6e-113
AZZ03438.1|3094706_3095810_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
AZZ03439.1|3095821_3097069_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.9	1.2e-98
>prophage 226
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3109349	3109874	4876986		Escherichia_phage(100.0%)	1	NA	NA
AZZ03450.1|3109349_3109874_+	outer membrane protein	NA	B0FEG7	Escherichia_phage	29.2	1.3e-09
>prophage 227
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3117521	3127233	4876986		Streptococcus_phage(33.33%)	6	NA	NA
AZZ03457.1|3117521_3119810_+	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.2	2.7e-91
AZZ03458.1|3119821_3120286_+	Au(I) sensor transcriptional regulator GolS	NA	NA	NA	NA	NA
AZZ03459.1|3120363_3120558_+	copper chaperone	NA	NA	NA	NA	NA
AZZ03460.1|3120850_3122104_+	MFS transporter	NA	NA	NA	NA	NA
AZZ03461.1|3122292_3124251_+	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	32.2	1.3e-81
AZZ05226.1|3124260_3127233_+	type III restriction-modification system endonuclease	NA	Q71TG1	Escherichia_phage	26.2	3.5e-83
>prophage 228
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3140649	3142536	4876986		Staphylococcus_phage(100.0%)	1	NA	NA
AZZ03474.1|3140649_3142536_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.2	1.2e-52
>prophage 229
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3157044	3158157	4876986		Bacillus_phage(100.0%)	1	NA	NA
AZZ03488.1|3157044_3158157_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	33.1	7.3e-18
>prophage 230
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3161849	3171770	4876986		Bacillus_phage(60.0%)	7	NA	NA
AZZ03495.1|3161849_3162761_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	1.2e-103
AZZ03496.1|3162886_3163795_+	fructokinase	NA	NA	NA	NA	NA
AZZ03497.1|3163816_3164989_-	MFS transporter AraJ	NA	NA	NA	NA	NA
AZZ03498.1|3165161_3168302_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	3.4e-12
AZZ03499.1|3168298_3169501_-	exonuclease subunit SbcD	NA	A0A0A0PQ58	Bacillus_phage	25.3	5.7e-08
AZZ03500.1|3169715_3170405_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	3.3e-37
AZZ03501.1|3170474_3171770_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.7	7.7e-27
>prophage 231
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3179741	3184081	4876986	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
AZZ03507.1|3179741_3180869_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.8	9.5e-90
AZZ03508.1|3180891_3181224_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	3.7e-10
AZZ03509.1|3181251_3183099_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
AZZ03510.1|3183109_3184081_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	38.1	2.3e-44
>prophage 232
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3188760	3190423	4876986		Indivirus(50.0%)	2	NA	NA
AZZ03516.1|3188760_3189864_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.2	2.5e-50
AZZ03517.1|3189952_3190423_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.0	1.0e-29
>prophage 233
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3199945	3201055	4876986		Bacillus_virus(100.0%)	1	NA	NA
AZZ03528.1|3199945_3201055_-	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	32.8	2.8e-25
>prophage 234
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3222133	3227301	4876986	protease	Agrobacterium_phage(25.0%)	4	NA	NA
AZZ03547.1|3222133_3222757_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
AZZ03548.1|3223008_3224280_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.5	1.2e-130
AZZ03549.1|3224465_3226820_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.5	2.1e-224
AZZ03550.1|3227028_3227301_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.9e-20
>prophage 235
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3230595	3231291	4876986		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AZZ03554.1|3230595_3231291_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.4	1.2e-87
>prophage 236
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3235691	3239238	4876986		Bacillus_phage(100.0%)	2	NA	NA
AZZ03559.1|3235691_3237464_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.8	4.7e-51
AZZ03560.1|3237456_3239238_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	2.4e-39
>prophage 237
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3256856	3267876	4876986	transposase	Sodalis_phage(20.0%)	13	NA	NA
AZZ03577.1|3256856_3257780_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	2.1e-63
AZZ03578.1|3257849_3258017_-	DUF2496 domain-containing protein	NA	NA	NA	NA	NA
AZZ05231.1|3258030_3258546_-	primosomal replication protein N''	NA	NA	NA	NA	NA
AZZ03579.1|3258626_3259004_+	DUF454 family protein	NA	NA	NA	NA	NA
AZZ03580.1|3259156_3259708_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.2	1.0e-28
AZZ03581.1|3259821_3261750_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	2.3e-43
AZZ03582.1|3261795_3262125_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AZZ03583.1|3262124_3262730_+	recombination protein RecR	NA	NA	NA	NA	NA
AZZ03584.1|3262840_3264715_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.9	1.7e-115
AZZ03585.1|3265072_3265717_+	adenylate kinase	NA	NA	NA	NA	NA
AZZ03586.1|3265729_3265936_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ03587.1|3265945_3266908_+	ferrochelatase	NA	NA	NA	NA	NA
AZZ03588.1|3266904_3267876_-	acetylesterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	27.4	6.6e-15
>prophage 238
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3276975	3282194	4876986		uncultured_virus(50.0%)	5	NA	NA
AZZ03596.1|3276975_3279477_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	37.1	3.9e-112
AZZ03597.1|3279586_3280003_+	HTH-type transcriptional regulator CueR	NA	NA	NA	NA	NA
AZZ03598.1|3280003_3280456_-	NfeD family protein	NA	NA	NA	NA	NA
AZZ03599.1|3280452_3281370_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
AZZ03600.1|3281516_3282194_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	32.5	3.9e-22
>prophage 239
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3285469	3286156	4876986		Planktothrix_phage(100.0%)	1	NA	NA
AZZ03605.1|3285469_3286156_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	2.7e-31
>prophage 240
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3291009	3292026	4876986		Planktothrix_phage(100.0%)	1	NA	NA
AZZ03609.1|3291009_3292026_+	virulence-associated ABC transporter ATP-binding protein SfbB	NA	G9BWD6	Planktothrix_phage	38.2	1.3e-32
>prophage 241
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3296497	3298279	4876986		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AZZ03615.1|3296497_3298279_+	glyoxylate carboligase	NA	A0A0P0CRC5	Ostreococcus_lucimarinus_virus	27.0	2.7e-38
>prophage 242
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3305729	3306878	4876986		Streptococcus_phage(100.0%)	1	NA	NA
AZZ03622.1|3305729_3306878_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	39.0	2.7e-47
>prophage 243
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3318150	3322584	4876986	tRNA	Moumouvirus(50.0%)	6	NA	NA
AZZ03634.1|3318150_3319536_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.5	1.1e-44
AZZ03635.1|3319579_3320404_-	DUF2145 domain-containing protein	NA	NA	NA	NA	NA
AZZ03636.1|3320400_3320838_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ03637.1|3320830_3321376_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AZZ03638.1|3321503_3321716_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
AZZ03639.1|3321717_3322584_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.5	4.2e-29
>prophage 244
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3332831	3340799	4876986	transposase	Salmonella_phage(60.0%)	9	NA	NA
AZZ03652.1|3332831_3333930_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.2	1.4e-45
AZZ03653.1|3334100_3335558_-	hypothetical protein	NA	A0A192Y7W8	Salmonella_phage	59.4	1.4e-154
AZZ03654.1|3335559_3336480_-	glycosyltransferase	NA	I1TED8	Salmonella_phage	95.1	6.6e-166
AZZ03655.1|3336476_3336839_-	GtrA family protein	NA	I1TED9	Salmonella_phage	97.5	3.3e-60
AZZ05232.1|3337263_3337473_-	copper-binding protein	NA	NA	NA	NA	NA
AZZ05233.1|3337708_3338038_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
AZZ03656.1|3338137_3338353_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AZZ03657.1|3338403_3339258_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZZ03658.1|3339473_3340799_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.7	2.7e-104
>prophage 245
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3344989	3346252	4876986	transposase	Salmonella_phage(100.0%)	1	NA	NA
AZZ03663.1|3344989_3346252_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
>prophage 246
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3367166	3373285	4876986		Tupanvirus(50.0%)	3	NA	NA
AZZ03682.1|3367166_3371051_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	26.8	3.2e-60
AZZ03683.1|3371300_3372437_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
AZZ03684.1|3372490_3373285_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	23.9	2.9e-08
>prophage 247
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3387756	3389582	4876986		uncultured_marine_virus(50.0%)	2	NA	NA
AZZ03696.1|3387756_3388374_-	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	51.3	2.3e-53
AZZ03697.1|3388346_3389582_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	34.3	2.3e-60
>prophage 248
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3392958	3399506	4876986		Bacillus_virus(33.33%)	6	NA	NA
AZZ03701.1|3392958_3394524_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.0	3.2e-43
AZZ03702.1|3394856_3395417_+	molecular chaperone	NA	NA	NA	NA	NA
AZZ03703.1|3395409_3397689_+	DMSO reductase	NA	A0A077SK27	Escherichia_phage	25.5	1.3e-45
AZZ03704.1|3397685_3398243_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
AZZ03705.1|3398242_3399010_+	hydrogenase	NA	NA	NA	NA	NA
AZZ03706.1|3399077_3399506_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.3e-18
>prophage 249
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3414621	3416151	4876986		Morganella_phage(33.33%)	3	NA	NA
AZZ03721.1|3414621_3414831_+	cold shock-like protein CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	5.9e-22
AZZ03722.1|3414889_3415273_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	48.6	1.7e-22
AZZ03723.1|3415362_3416151_+	deaminated glutathione amidase	NA	M1H2P4	Paramecium_bursaria_Chlorella_virus	23.9	1.3e-05
>prophage 250
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3420106	3422591	4876986		Stx2-converting_phage(50.0%)	2	NA	NA
AZZ03729.1|3420106_3421318_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.7	3.4e-101
AZZ03730.1|3421457_3422591_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	4.8e-09
>prophage 251
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3430818	3433401	4876986	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
AZZ03740.1|3430818_3433401_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.4	2.8e-185
>prophage 252
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3444234	3449037	4876986		Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
AZZ03751.1|3444234_3445914_-	molecular chaperone HscC	NA	F2Y0P3	Organic_Lake_phycodnavirus	35.9	2.3e-76
AZZ03752.1|3445989_3447228_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ03753.1|3447259_3448195_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
AZZ03754.1|3448311_3449037_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	8.7e-28
>prophage 253
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3454937	3456023	4876986		Pseudomonas_phage(100.0%)	1	NA	NA
AZZ03760.1|3454937_3456023_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.6	6.6e-48
>prophage 254
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3460641	3462306	4876986		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AZZ03764.1|3460641_3462306_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.0	4.7e-85
>prophage 255
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3466960	3477173	4876986	tRNA	Vibrio_phage(25.0%)	7	NA	NA
AZZ03769.1|3466960_3468913_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	2.9e-09
AZZ03770.1|3469123_3470791_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	95.8	0.0e+00
AZZ03771.1|3471451_3472858_+	chitoporin	NA	NA	NA	NA	NA
AZZ03772.1|3472907_3473240_+	lipoprotein	NA	NA	NA	NA	NA
AZZ03773.1|3473288_3474593_-	tricarballylate/proton symporter TcuC	NA	Q6JIH2	Burkholderia_virus	34.9	1.2e-59
AZZ03774.1|3474643_3475783_-	tricarballylate utilization protein TcuB	NA	NA	NA	NA	NA
AZZ03775.1|3475769_3477173_-	FAD-dependent tricarballylate dehydrogenase TcuA	NA	A0A2P0ZL82	Lactobacillus_phage	25.9	1.0e-08
>prophage 256
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3488257	3488935	4876986		Bacillus_phage(100.0%)	1	NA	NA
AZZ03787.1|3488257_3488935_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	5.8e-26
>prophage 257
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3492205	3499638	4876986		Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
AZZ03789.1|3492205_3494254_-	K(+)-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.5	1.4e-27
AZZ03790.1|3494274_3495954_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AZZ03791.1|3495953_3496043_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
AZZ03792.1|3496379_3496586_+	DUF2517 family protein	NA	NA	NA	NA	NA
AZZ03793.1|3496696_3498118_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	31.9	6.0e-57
AZZ03794.1|3498156_3499638_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.7	1.1e-45
>prophage 258
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3503546	3510739	4876986		Escherichia_phage(33.33%)	8	NA	NA
AZZ03800.1|3503546_3504113_+	DNA recombinase	NA	A0A2L1IV36	Escherichia_phage	54.4	4.3e-51
AZZ03801.1|3504572_3504908_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ03802.1|3504909_3505650_+	transport protein	NA	NA	NA	NA	NA
AZZ03803.1|3505935_3507087_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	41.9	3.7e-81
AZZ03804.1|3507086_3507980_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AZZ03805.1|3507992_3509150_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AZZ03806.1|3509254_3510025_+	ABC transporter permease	NA	NA	NA	NA	NA
AZZ03807.1|3510028_3510739_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	26.3	2.2e-07
>prophage 259
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3515843	3516635	4876986		Kaumoebavirus(100.0%)	1	NA	NA
AZZ03811.1|3515843_3516635_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.1	4.0e-10
>prophage 260
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3542779	3548312	4876986		Vibrio_phage(25.0%)	6	NA	NA
AZZ03831.1|3542779_3543499_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	35.3	1.1e-22
AZZ03832.1|3543495_3544434_-	zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.1	1.4e-25
AZZ03833.1|3544544_3544931_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ03834.1|3545250_3546303_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	47.1	3.7e-80
AZZ03835.1|3546456_3547536_+	iron ABC transporter permease	NA	NA	NA	NA	NA
AZZ03836.1|3547535_3548312_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.5	4.9e-13
>prophage 261
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3552620	3560238	4876986		Tupanvirus(33.33%)	8	NA	NA
AZZ03841.1|3552620_3553637_-	UDP-glucose 4-epimerase	NA	A0A2K9L5H6	Tupanvirus	47.3	3.3e-81
AZZ03842.1|3553859_3554768_-	DUF2167 domain-containing protein	NA	NA	NA	NA	NA
AZZ03843.1|3554938_3556414_-	molybdate ABC transporter ATP-binding protein ModF	NA	W5SAS9	Pithovirus	30.2	4.4e-10
AZZ03844.1|3556481_3557270_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
AZZ03845.1|3557398_3557548_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
AZZ03846.1|3557714_3558488_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZZ03847.1|3558487_3559177_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
AZZ03848.1|3559179_3560238_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	34.3	5.1e-21
>prophage 262
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3568674	3572103	4876986		Catovirus(50.0%)	3	NA	NA
AZZ03855.1|3568674_3570195_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	40.0	1.7e-81
AZZ03856.1|3570279_3570756_-	kinase inhibitor	NA	NA	NA	NA	NA
AZZ03857.1|3570813_3572103_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.5	1.3e-18
>prophage 263
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3578963	3582231	4876986		Phage_Gifsy-2(50.0%)	2	NA	NA
AZZ03864.1|3578963_3581231_+	type III secretion system effector E3 ubiquitin transferase SlrP	NA	Q9MBL9	Phage_Gifsy-2	43.0	8.2e-16
AZZ03865.1|3581322_3582231_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	29.9	7.8e-26
>prophage 264
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3593946	3595683	4876986		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
AZZ03880.1|3593946_3595683_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.9	3.5e-19
>prophage 265
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3600952	3601798	4876986		Micromonas_pusilla_virus(100.0%)	1	NA	NA
AZZ03886.1|3600952_3601798_+	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	32.3	1.7e-06
>prophage 266
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3605640	3611325	4876986		Diachasmimorpha_longicaudata_entomopoxvirus(33.33%)	5	NA	NA
AZZ03888.1|3605640_3607002_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.2	3.8e-53
AZZ03889.1|3607209_3609354_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.7	7.4e-43
AZZ03890.1|3609383_3610358_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
AZZ03891.1|3610513_3610774_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AZZ03892.1|3611058_3611325_-	DksA/TraR family C4-type zinc finger protein	NA	E5E4B1	Acinetobacter_phage	52.8	2.2e-13
>prophage 267
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3614793	3620102	4876986		Planktothrix_phage(33.33%)	6	NA	NA
AZZ03895.1|3614793_3615516_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	43.2	1.9e-35
AZZ03896.1|3615512_3616172_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
AZZ03897.1|3616317_3617064_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
AZZ03898.1|3617539_3618043_-	DNA starvation/stationary phase protection protein	NA	A0A222YYG6	Streptomyces_phage	23.0	7.1e-05
AZZ03899.1|3618345_3619233_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
AZZ03900.1|3619586_3620102_+	outer membrane protein OmpX	NA	A5LH44	Enterobacteria_phage	34.2	1.1e-16
>prophage 268
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3625088	3626681	4876986		Tupanvirus(100.0%)	1	NA	NA
AZZ03906.1|3625088_3626681_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	27.9	2.1e-58
>prophage 269
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3631190	3633623	4876986		Citrobacter_phage(100.0%)	1	NA	NA
AZZ03909.1|3631190_3633623_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	2.1e-09
>prophage 270
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3637945	3639817	4876986		Planktothrix_phage(100.0%)	1	NA	NA
AZZ03914.1|3637945_3639817_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	28.5	1.3e-14
>prophage 271
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3647418	3649424	4876986		Stx2-converting_phage(50.0%)	2	NA	NA
AZZ03922.1|3647418_3648621_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.1	2.4e-99
AZZ03923.1|3648665_3649424_-	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	29.6	3.9e-15
>prophage 272
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3656995	3666165	4876986		Vibrio_phage(25.0%)	11	NA	NA
AZZ03930.1|3656995_3657259_-	glutaredoxin, GrxA family	NA	A0A2I7SAE2	Vibrio_phage	70.5	5.9e-27
AZZ03931.1|3657428_3657707_+	DUF1418 family protein	NA	NA	NA	NA	NA
AZZ03932.1|3657702_3658425_+	nitroreductase NfsA	NA	NA	NA	NA	NA
AZZ03933.1|3658482_3659385_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.0	3.5e-34
AZZ03934.1|3659481_3659958_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
AZZ05249.1|3660306_3661419_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AZZ03935.1|3661506_3662640_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	6.5e-30
AZZ03936.1|3662649_3663603_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AZZ03937.1|3663599_3664445_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AZZ05250.1|3664518_3664992_+	DUF2593 family protein	NA	NA	NA	NA	NA
AZZ03938.1|3665034_3666165_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	26.4	1.8e-24
>prophage 273
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3672964	3675715	4876986		Planktothrix_phage(50.0%)	4	NA	NA
AZZ03946.1|3672964_3673693_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.8	5.1e-28
AZZ03947.1|3673921_3674437_-	lipoprotein	NA	NA	NA	NA	NA
AZZ03948.1|3674564_3674888_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
AZZ03949.1|3674884_3675715_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.7	2.3e-08
>prophage 274
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3679304	3681023	4876986		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
AZZ03953.1|3679304_3681023_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.2	6.4e-29
>prophage 275
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3687808	3694172	4876986	protease	Dickeya_phage(20.0%)	5	NA	NA
AZZ03958.1|3687808_3688927_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
AZZ03959.1|3688923_3690870_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
AZZ03960.1|3690999_3691221_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AZZ03961.1|3691544_3691865_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AZZ03962.1|3691895_3694172_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
>prophage 276
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3699096	3715822	4876986	tRNA	Bacillus_phage(25.0%)	10	NA	NA
AZZ03969.1|3699096_3700818_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.5	3.8e-13
AZZ03970.1|3700818_3702585_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.1	2.7e-22
AZZ03971.1|3702699_3703668_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.8	1.7e-63
AZZ03972.1|3704214_3704709_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
AZZ03973.1|3704843_3708854_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.5	2.9e-88
AZZ05252.1|3708996_3709608_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
AZZ03974.1|3709617_3710961_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.6	1.6e-80
AZZ03975.1|3711219_3712512_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.9	7.3e-94
AZZ03976.1|3712749_3715194_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.5	7.0e-223
AZZ03977.1|3715204_3715822_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	4.3e-76
>prophage 277
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3720116	3724803	4876986		Tetraselmis_virus(100.0%)	4	NA	NA
AZZ03981.1|3720116_3720941_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	2.8e-22
AZZ05253.1|3721032_3721302_-	cytoplasmic protein	NA	NA	NA	NA	NA
AZZ03982.1|3721489_3722449_+	type III secretion system effector SopD2	NA	NA	NA	NA	NA
AZZ03983.1|3722520_3724803_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.0	1.1e-161
>prophage 278
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3728899	3729988	4876986		Streptococcus_phage(100.0%)	1	NA	NA
AZZ03987.1|3728899_3729988_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.5	2.8e-78
>prophage 279
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3735044	3739608	4876986		Bacillus_phage(66.67%)	3	NA	NA
AZZ03992.1|3735044_3735329_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.1e-10
AZZ03993.1|3735558_3737823_+	ComEC family protein	NA	Q332C0	Clostridium_botulinum_C_phage	23.0	3.0e-10
AZZ03994.1|3737859_3739608_+	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	30.5	3.2e-60
>prophage 280
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3744830	3850128	4876986	head,tail,terminase,portal,protease,tRNA,lysis,capsid,holin	Salmonella_phage(46.55%)	106	NA	NA
AZZ04001.1|3744830_3745634_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AZZ04002.1|3745626_3746949_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
AZZ04003.1|3746929_3747634_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
AZZ04004.1|3747633_3752100_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
AZZ04005.1|3752444_3754292_+	L,D-transpeptidase	NA	NA	NA	NA	NA
AZZ04006.1|3754551_3755100_+	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
AZZ04007.1|3755127_3755775_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AZZ04008.1|3755836_3757027_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
AZZ04009.1|3757211_3758303_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
AZZ04010.1|3758909_3760310_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.8	4.5e-81
AZZ04011.1|3760510_3760972_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AZZ04012.1|3761289_3762504_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
AZZ04013.1|3762749_3764186_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
AZZ04014.1|3764263_3765466_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AZZ04015.1|3765660_3766953_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	100.0	3.4e-253
AZZ04016.1|3766997_3767246_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AZZ04017.1|3767286_3767526_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
AZZ04018.1|3767568_3768726_-	enterohemolysin	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
AZZ04019.1|3768688_3771616_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.8	0.0e+00
AZZ04020.1|3771742_3772093_-	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	96.6	3.2e-60
AZZ04021.1|3772681_3772888_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	69.1	4.3e-17
AZZ04022.1|3772914_3773856_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ04023.1|3773961_3774357_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	72.5	3.5e-47
AZZ04024.1|3774461_3774698_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	73.1	9.0e-27
AZZ04025.1|3774663_3775038_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
AZZ04026.1|3775122_3776106_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
AZZ04027.1|3776108_3776858_+	DNA replication protein DnaC	NA	H6WRX8	Salmonella_phage	99.2	7.3e-139
AZZ04028.1|3776868_3777216_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	100.0	4.5e-59
AZZ04029.1|3777212_3777533_+	hypothetical protein	NA	H6WRY0	Salmonella_phage	65.5	6.7e-25
AZZ04030.1|3777532_3777778_+	hypothetical protein	NA	Q5G8U9	Enterobacteria_phage	88.9	3.0e-33
AZZ04031.1|3778088_3779306_+	hypothetical protein	NA	J9Q803	Salmonella_phage	53.3	3.1e-118
AZZ05254.1|3779286_3779355_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
AZZ04032.1|3779448_3779775_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ04033.1|3780022_3780256_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
AZZ04034.1|3780372_3780621_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
AZZ04035.1|3780655_3781258_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
AZZ05255.1|3781257_3781464_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
AZZ04036.1|3781466_3782078_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	4.2e-92
AZZ04037.1|3782074_3782221_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
AZZ04038.1|3782210_3783008_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	4.0e-151
AZZ04039.1|3783406_3783532_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ04040.1|3783667_3784117_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ05256.1|3785439_3785769_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
AZZ04041.1|3785752_3786205_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.7	4.6e-80
AZZ04042.1|3786222_3786672_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	90.4	6.1e-64
AZZ04043.1|3787000_3787504_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ04044.1|3787760_3788162_-	inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
AZZ04045.1|3788447_3788993_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
AZZ04046.1|3788964_3790896_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.3e-259
AZZ04047.1|3790879_3791083_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
AZZ04048.1|3791079_3792660_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
AZZ04049.1|3792649_3794146_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	1.1e-96
AZZ04050.1|3794158_3794506_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
AZZ04051.1|3794560_3795589_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
AZZ04052.1|3795646_3796012_+	DNA packaging protein	NA	NA	NA	NA	NA
AZZ04053.1|3796022_3796400_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	1.5e-28
AZZ04054.1|3796386_3796965_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
AZZ04055.1|3796961_3797363_+|tail	phage tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
AZZ04056.1|3797370_3798117_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
AZZ04057.1|3798167_3798563_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
AZZ04058.1|3798559_3798898_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
AZZ04059.1|3798869_3801965_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.7	4.8e-277
AZZ04060.1|3801967_3802297_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	71.3	7.3e-43
AZZ04061.1|3802306_3803005_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	75.9	1.6e-103
AZZ04062.1|3803011_3803749_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	84.2	9.8e-128
AZZ04063.1|3803646_3804294_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.1	1.6e-89
AZZ04064.1|3804355_3807718_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.5	0.0e+00
AZZ04065.1|3807756_3807999_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ04066.1|3808052_3810548_+|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	76.1	7.3e-159
AZZ04067.1|3810547_3811129_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.3e-94
AZZ04068.1|3811958_3813449_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	98.6	1.6e-254
AZZ04069.1|3814016_3814817_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ05257.1|3815292_3815499_-	DinI family protein	NA	S4TNM0	Salmonella_phage	100.0	1.8e-31
AZZ04070.1|3815925_3818538_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	3.7e-20
AZZ04071.1|3818745_3819756_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AZZ04072.1|3819921_3820464_+	cell division protein ZapC	NA	NA	NA	NA	NA
AZZ04073.1|3820460_3821570_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AZZ04074.1|3821668_3823777_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
AZZ04075.1|3823789_3825697_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	5.4e-53
AZZ04076.1|3825711_3826965_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
AZZ04077.1|3826969_3828610_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
AZZ04078.1|3828606_3829170_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
AZZ04079.1|3829425_3829593_+	ribosome modulation factor	NA	NA	NA	NA	NA
AZZ04080.1|3829692_3830211_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
AZZ04081.1|3830279_3832040_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
AZZ04082.1|3832225_3832678_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
AZZ04083.1|3832749_3833802_-	porin OmpA	NA	NA	NA	NA	NA
AZZ04084.1|3834158_3834668_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
AZZ04085.1|3834884_3835490_+	TfoX family DNA transformation protein	NA	NA	NA	NA	NA
AZZ04086.1|3835476_3837630_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AZZ04087.1|3837648_3838095_-	YccF domain-containing protein	NA	NA	NA	NA	NA
AZZ04088.1|3838218_3840273_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
AZZ04089.1|3840308_3840767_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AZZ04090.1|3840861_3841524_-	DUF2057 family protein	NA	NA	NA	NA	NA
AZZ04091.1|3841694_3842111_+	CoA-binding protein	NA	NA	NA	NA	NA
AZZ04092.1|3842155_3842473_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AZZ04093.1|3842530_3843742_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
AZZ04094.1|3843956_3844505_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AZZ04095.1|3844530_3845310_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZZ04096.1|3845358_3845640_+	acylphosphatase	NA	NA	NA	NA	NA
AZZ04097.1|3845636_3845966_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
AZZ04098.1|3846052_3846712_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AZZ04099.1|3847331_3848012_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	1.7e-81
AZZ04100.1|3848234_3849110_-	SPI-2 type III secretion system effector PipB	NA	NA	NA	NA	NA
AZZ04101.1|3849499_3849724_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ05258.1|3849759_3850128_+	hypothetical protein	NA	E5G6P3	Salmonella_phage	70.2	1.9e-07
>prophage 281
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3855852	3856533	4876986		Bacillus_phage(100.0%)	1	NA	NA
AZZ04108.1|3855852_3856533_-	DNA-binding response regulator HprR	NA	W8CYM9	Bacillus_phage	35.6	2.2e-33
>prophage 282
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3869894	3872136	4876986		Phage_258-320(50.0%)	4	NA	NA
AZZ04124.1|3869894_3870257_-	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	43.5	2.4e-23
AZZ04125.1|3870704_3870860_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ04126.1|3870910_3871216_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
AZZ04127.1|3871215_3872136_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	46.7	3.2e-11
>prophage 283
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3878421	3878589	4876986		Enterobacteria_phage(100.0%)	1	NA	NA
AZZ04136.1|3878421_3878589_+	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
>prophage 284
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3886533	3887388	4876986		Cronobacter_phage(100.0%)	1	NA	NA
AZZ04142.1|3886533_3887388_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	5.9e-92
>prophage 285
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3892045	3901754	4876986		Burkholderia_phage(33.33%)	11	NA	NA
AZZ04146.1|3892045_3892258_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
AZZ05259.1|3892268_3892457_+	cold-shock protein	NA	NA	NA	NA	NA
AZZ04147.1|3892715_3893927_-	porin	NA	Q1MVN1	Enterobacteria_phage	55.7	6.3e-108
AZZ04148.1|3894577_3894889_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ04149.1|3894968_3895664_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
AZZ04150.1|3895737_3897168_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AZZ04151.1|3897148_3897619_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
AZZ04152.1|3897607_3898528_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AZZ04153.1|3898703_3899615_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AZZ04154.1|3899631_3899877_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AZZ04155.1|3900041_3901754_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.6e-19
>prophage 286
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3929430	3930183	4876986		Bacillus_virus(100.0%)	1	NA	NA
AZZ04186.1|3929430_3930183_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	35.0	8.4e-26
>prophage 287
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3938447	3939113	4876986		Sphingomonas_phage(100.0%)	1	NA	NA
AZZ04195.1|3938447_3939113_+	YecA family protein	NA	H9NBT7	Sphingomonas_phage	62.1	1.5e-05
>prophage 288
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3954266	3958401	4876986		Bacillus_thuringiensis_phage(66.67%)	4	NA	NA
AZZ04213.1|3954266_3955928_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	25.0	5.8e-11
AZZ04214.1|3956081_3956948_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
AZZ04215.1|3956944_3957994_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
AZZ04216.1|3958011_3958401_+	two-component system response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.4	2.2e-06
>prophage 289
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3966353	3972913	4876986	tRNA	Tupanvirus(33.33%)	7	NA	NA
AZZ04222.1|3966353_3968087_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.4	4.9e-85
AZZ04223.1|3968323_3968893_+	VOC family protein	NA	NA	NA	NA	NA
AZZ04224.1|3968912_3969659_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AZZ04225.1|3969894_3970866_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AZZ04226.1|3970862_3971606_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.9	5.4e-25
AZZ04227.1|3971646_3972042_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ04228.1|3972094_3972913_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	80.3	4.5e-57
>prophage 290
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3976934	3984923	4876986		Bacillus_virus(50.0%)	9	NA	NA
AZZ04233.1|3976934_3977456_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
AZZ04234.1|3977457_3978057_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
AZZ05264.1|3978284_3978959_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ04235.1|3979318_3979930_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AZZ04236.1|3979938_3980949_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.9	2.4e-07
AZZ04237.1|3981027_3981813_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
AZZ04238.1|3981809_3982565_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	29.4	2.5e-17
AZZ04239.1|3982643_3983588_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
AZZ04240.1|3983603_3984923_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	2.6e-14
>prophage 291
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3988860	3990336	4876986		Cyanophage(100.0%)	1	NA	NA
AZZ04245.1|3988860_3990336_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	2.6e-79
>prophage 292
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	3998233	4006481	4876986	integrase,tail	Klebsiella_phage(40.0%)	11	3991460:3991472	4003174:4003186
3991460:3991472	attL	CCGGCGGCTCCAC	NA	NA	NA	NA
AZZ04253.1|3998233_3998932_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	40.4	2.8e-07
AZZ04254.1|3998955_3999612_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AZZ04255.1|3999719_3999950_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
AZZ04256.1|4000087_4000462_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AZZ04257.1|4000462_4001338_+	copper resistance D family protein	NA	NA	NA	NA	NA
AZZ04258.1|4001354_4001708_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AZZ04259.1|4002081_4002441_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	45.2	7.3e-20
AZZ04260.1|4002443_4002578_+|tail	phage tail protein	tail	NA	NA	NA	NA
AZZ04261.1|4002696_4005117_+	hypothetical protein	NA	Q9MBL9	Phage_Gifsy-2	72.7	1.5e-55
4003174:4003186	attR	CCGGCGGCTCCAC	NA	NA	NA	NA
AZZ04262.1|4005905_4006046_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ04263.1|4006214_4006481_-	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	44.4	5.2e-07
>prophage 293
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4012466	4015591	4876986		Enterobacteria_phage(50.0%)	5	NA	NA
AZZ04274.1|4012466_4012862_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	7.0e-16
AZZ04275.1|4013545_4014268_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
AZZ04276.1|4014552_4014717_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ05266.1|4014707_4014923_+	serine/threonine protein phosphatase	NA	NA	NA	NA	NA
AZZ04277.1|4014940_4015591_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	51.4	4.2e-58
>prophage 294
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4023096	4025145	4876986		Moraxella_phage(100.0%)	1	NA	NA
AZZ04285.1|4023096_4025145_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
>prophage 295
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4030522	4030732	4876986		Morganella_phage(100.0%)	1	NA	NA
AZZ04293.1|4030522_4030732_+	cold shock-like protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 296
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4038219	4039779	4876986		Moraxella_phage(100.0%)	1	NA	NA
AZZ04301.1|4038219_4039779_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.4	9.5e-40
>prophage 297
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4043748	4051061	4876986	tRNA	Pandoravirus(33.33%)	7	NA	NA
AZZ04305.1|4043748_4045113_-	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	35.0	4.3e-44
AZZ04306.1|4045193_4045373_+	YoaH family protein	NA	NA	NA	NA	NA
AZZ04307.1|4045378_4045723_-	RidA family protein	NA	NA	NA	NA	NA
AZZ04308.1|4045854_4047765_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.7	5.9e-92
AZZ04309.1|4047822_4048518_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AZZ04310.1|4048589_4049171_+	Slp family lipoprotein	NA	NA	NA	NA	NA
AZZ05267.1|4049375_4051061_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.2	1.3e-34
>prophage 298
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4087961	4090719	4876986		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AZZ04348.1|4087961_4089647_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.3	3.0e-23
AZZ04349.1|4089771_4090719_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	8.6e-44
>prophage 299
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4094066	4099723	4876986		Pseudomonas_phage(33.33%)	7	NA	NA
AZZ04353.1|4094066_4095149_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	8.7e-08
AZZ04354.1|4095148_4095982_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AZZ04355.1|4095978_4096368_+	SirB family protein	NA	NA	NA	NA	NA
AZZ04356.1|4096371_4097181_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
AZZ04357.1|4097218_4098073_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	38.8	1.9e-45
AZZ04358.1|4098125_4099226_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
AZZ04359.1|4099492_4099723_+	putative cation transport regulator ChaB	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	41.3	1.1e-05
>prophage 300
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4110060	4111596	4876986		Escherichia_phage(100.0%)	1	NA	NA
AZZ04367.1|4110060_4111596_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	4.8e-20
>prophage 301
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4115923	4122331	4876986		Synechococcus_phage(33.33%)	7	NA	NA
AZZ04372.1|4115923_4116766_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	48.8	7.5e-15
AZZ04373.1|4116816_4117275_-	YchJ family protein	NA	NA	NA	NA	NA
AZZ04374.1|4117385_4118291_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
AZZ04375.1|4118381_4119395_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
AZZ04376.1|4119597_4120506_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	8.2e-60
AZZ04377.1|4120637_4121051_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
AZZ04378.1|4121713_4122331_+	thymidine kinase	NA	A0A023W530	Serratia_phage	54.2	2.7e-54
>prophage 302
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4130713	4133606	4876986		Planktothrix_phage(33.33%)	3	NA	NA
AZZ04384.1|4130713_4131721_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.9	1.7e-13
AZZ04385.1|4131717_4132722_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.1	8.1e-16
AZZ04386.1|4132769_4133606_+	voltage-gated potassium channel	NA	A0A1B0Y2S3	Lactobacillus_phage	42.4	1.0e-08
>prophage 303
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4145270	4148228	4876986		Acinetobacter_phage(100.0%)	2	NA	NA
AZZ04400.1|4145270_4146629_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	3.0e-37
AZZ04401.1|4146632_4148228_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	39.1	2.0e-53
>prophage 304
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4153209	4158548	4876986	protease	Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
AZZ04407.1|4153209_4153971_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	22.2	7.5e-06
AZZ04408.1|4154208_4155255_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	29.5	1.6e-19
AZZ04409.1|4155296_4155548_-	DUF2498 family protein	NA	NA	NA	NA	NA
AZZ04410.1|4155950_4158548_+	DNA topoisomerase 1	NA	A0A2K9L5F8	Tupanvirus	35.4	2.4e-88
>prophage 305
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4163641	4164232	4876986		Staphylococcus_phage(100.0%)	1	NA	NA
AZZ04416.1|4163641_4164232_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	2.9e-42
>prophage 306
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4169816	4173995	4876986		Bacillus_virus(50.0%)	2	NA	NA
AZZ04424.1|4169816_4171799_-	cyclic di-GMP phosphodiesterase	NA	G3MA91	Bacillus_virus	32.6	1.0e-17
AZZ04425.1|4172060_4173995_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	23.8	6.5e-06
>prophage 307
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4179498	4180305	4876986		Bacillus_virus(100.0%)	1	NA	NA
AZZ04431.1|4179498_4180305_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
>prophage 308
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4197586	4208384	4876986		Escherichia_phage(66.67%)	9	NA	NA
AZZ04451.1|4197586_4198201_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	33.3	5.8e-25
AZZ04452.1|4198242_4199100_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	32.2	3.8e-22
AZZ04453.1|4199101_4199719_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	4.0e-74
AZZ04454.1|4199729_4202159_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	46.4	3.9e-197
AZZ04455.1|4202519_4203443_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ04456.1|4203767_4204547_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZZ04457.1|4204791_4205979_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	32.3	2.1e-47
AZZ04458.1|4206123_4207428_+	transporter	NA	NA	NA	NA	NA
AZZ04459.1|4207607_4208384_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	25.2	2.4e-12
>prophage 309
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4212652	4213522	4876986		Staphylococcus_phage(100.0%)	1	NA	NA
AZZ04463.1|4212652_4213522_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	43.2	3.9e-51
>prophage 310
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4217072	4217930	4876986		Streptococcus_phage(100.0%)	1	NA	NA
AZZ04467.1|4217072_4217930_-	helix-turn-helix domain-containing protein	NA	D0R0F8	Streptococcus_phage	29.1	6.9e-08
>prophage 311
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4228143	4240212	4876986	tRNA	Escherichia_phage(28.57%)	13	NA	NA
AZZ04479.1|4228143_4228659_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.5	2.3e-22
AZZ04480.1|4228916_4229480_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
AZZ04481.1|4229460_4229640_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ04482.1|4229890_4231045_+	chemoreceptor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.3	2.6e-10
AZZ04483.1|4231190_4232174_+	zinc transporter ZntB	NA	NA	NA	NA	NA
AZZ04484.1|4232449_4232632_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ04485.1|4232660_4234034_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
AZZ04486.1|4234077_4235013_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	9.4e-144
AZZ05276.1|4235107_4235245_-	hypothetical protein	NA	A0A0U2JGI6	Escherichia_phage	97.8	8.0e-20
AZZ04487.1|4235689_4239112_+	DUF4765 family protein	NA	A0A0N7KZG3	Stx2-converting_phage	50.5	0.0e+00
AZZ04488.1|4239283_4239394_+	multidrug transporter	NA	NA	NA	NA	NA
AZZ04489.1|4239386_4239725_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AZZ04490.1|4239777_4240212_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
>prophage 312
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4245324	4246314	4876986		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AZZ04494.1|4245324_4246314_-	2-hydroxyacid dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	42.5	1.2e-69
>prophage 313
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4251106	4256520	4876986		Catovirus(50.0%)	3	NA	NA
AZZ04500.1|4251106_4255009_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	30.7	5.0e-53
AZZ04501.1|4255072_4255873_+	YdcF family protein	NA	NA	NA	NA	NA
AZZ04502.1|4255989_4256520_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	9.1e-19
>prophage 314
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4260280	4261012	4876986		Planktothrix_phage(100.0%)	1	NA	NA
AZZ04506.1|4260280_4261012_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	2.6e-24
>prophage 315
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4267574	4274664	4876986		Synechococcus_phage(33.33%)	6	NA	NA
AZZ04514.1|4267574_4268693_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.8	8.9e-32
AZZ04515.1|4268647_4268863_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ04516.1|4268861_4270487_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.1	6.5e-07
AZZ04517.1|4270547_4271471_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ04518.1|4271763_4273107_+	VOC family protein	NA	NA	NA	NA	NA
AZZ04519.1|4273155_4274664_+	carboxylesterase/lipase family protein	NA	L7Y5U6	Megavirus	38.0	3.2e-32
>prophage 316
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4290766	4292731	4876986		Phage_TP(100.0%)	1	NA	NA
AZZ04537.1|4290766_4292731_+	U32 family peptidase	NA	Q6DW11	Phage_TP	26.7	8.6e-22
>prophage 317
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4310327	4312448	4876986		Salmonella_phage(100.0%)	1	NA	NA
AZZ04554.1|4310327_4312448_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.9	3.7e-135
>prophage 318
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4320389	4321934	4876986		Escherichia_phage(100.0%)	1	NA	NA
AZZ04564.1|4320389_4321934_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	44.6	1.9e-19
>prophage 319
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4330096	4331179	4876986		Enterobacteria_phage(100.0%)	1	NA	NA
AZZ04570.1|4330096_4331179_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	71.8	3.3e-140
>prophage 320
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4337543	4338554	4876986		Tupanvirus(100.0%)	1	NA	NA
AZZ04576.1|4337543_4338554_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.9	8.6e-26
>prophage 321
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4362923	4363208	4876986		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AZZ04596.1|4362923_4363208_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	54.8	2.6e-20
>prophage 322
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4382238	4383357	4876986		Enterobacteria_phage(100.0%)	1	NA	NA
AZZ04615.1|4382238_4383357_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.5	1.6e-113
>prophage 323
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4392242	4392677	4876986		Streptococcus_phage(100.0%)	1	NA	NA
AZZ04625.1|4392242_4392677_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.1e-09
>prophage 324
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4401963	4421246	4876986		Escherichia_phage(40.0%)	19	NA	NA
AZZ04637.1|4401963_4402167_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	2.9e-13
AZZ04638.1|4402233_4403700_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.0	1.9e-42
AZZ04639.1|4403843_4405223_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	28.9	1.8e-29
AZZ04640.1|4405276_4406296_-	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
AZZ04641.1|4406306_4407521_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.7	2.0e-45
AZZ04642.1|4407642_4407969_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	52.9	2.2e-23
AZZ04643.1|4408121_4408463_+	DUF1283 family protein	NA	NA	NA	NA	NA
AZZ04644.1|4408498_4409059_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AZZ04645.1|4409099_4409810_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AZZ04646.1|4409913_4410222_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AZZ04647.1|4410378_4412817_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.7	7.3e-220
AZZ04648.1|4412915_4415351_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.1	4.6e-206
AZZ04649.1|4415361_4415979_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	7.3e-76
AZZ04650.1|4415980_4416838_+	dimethylsulfoxide reductase	NA	NA	NA	NA	NA
AZZ04651.1|4416880_4417495_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.8	2.1e-27
AZZ04652.1|4417799_4418510_+	osmoprotectant ABC transporter permease OsmY	NA	NA	NA	NA	NA
AZZ04653.1|4418538_4419441_+	osmoprotectant ABC transporter substrate-binding protein OsmX	NA	NA	NA	NA	NA
AZZ04654.1|4419450_4420098_+	osmoprotectant ABC transporter permease OsmW	NA	NA	NA	NA	NA
AZZ04655.1|4420097_4421246_+	osmoprotectant ABC transporter ATP-binding protein OsmV	NA	G9BWD6	Planktothrix_phage	33.9	2.2e-25
>prophage 325
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4438959	4443382	4876986		Enterobacteria_phage(50.0%)	3	NA	NA
AZZ04672.1|4438959_4440111_+	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	58.8	1.2e-116
AZZ04673.1|4440263_4441970_+	amidohydrolase	NA	NA	NA	NA	NA
AZZ04674.1|4442080_4443382_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	22.4	2.2e-13
>prophage 326
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4465592	4466867	4876986	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
AZZ04695.1|4465592_4466867_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 327
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4473783	4474305	4876986		Salmonella_phage(100.0%)	1	NA	NA
AZZ04704.1|4473783_4474305_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	60.3	4.0e-51
>prophage 328
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4479379	4486803	4876986		Streptococcus_phage(20.0%)	8	NA	NA
AZZ04712.1|4479379_4480234_+	peptidoglycan endopeptidase	NA	A0A1S5SEZ8	Streptococcus_phage	41.0	1.2e-15
AZZ04713.1|4480360_4480942_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.5	6.9e-44
AZZ04714.1|4481024_4481114_-	YnhF family membrane protein	NA	NA	NA	NA	NA
AZZ04715.1|4481409_4482435_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.1e-31
AZZ04716.1|4482431_4483364_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ04717.1|4483476_4484682_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
AZZ04718.1|4484971_4486120_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.9	2.5e-85
AZZ04719.1|4486161_4486803_-	riboflavin synthase subunit alpha	NA	A0A2I2L4R9	Orpheovirus	38.3	1.1e-23
>prophage 329
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4514366	4515095	4876986		Enterobacteria_phage(100.0%)	1	NA	NA
AZZ04749.1|4514366_4515095_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	46.4	9.2e-46
>prophage 330
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4530328	4533538	4876986		environmental_halophage(50.0%)	3	NA	NA
AZZ04764.1|4530328_4531549_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	40.8	1.7e-92
AZZ04765.1|4531545_4532817_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AZZ04766.1|4532791_4533538_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	31.4	3.4e-11
>prophage 331
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4556679	4576306	4876986	tRNA	Tupanvirus(22.22%)	19	NA	NA
AZZ04786.1|4556679_4558320_+	cyclohexanecarboxylate-CoA ligase	NA	A0A1V0SBX8	Catovirus	24.1	2.3e-20
AZZ04787.1|4558361_4560740_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	2.5e-172
AZZ04788.1|4561076_4561910_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
AZZ04789.1|4562065_4563112_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.3	1.7e-80
AZZ04790.1|4563268_4563460_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
AZZ04791.1|4563495_4564938_-	YdiU family protein	NA	NA	NA	NA	NA
AZZ04792.1|4564999_4565710_-	anti-FlhDC factor YdiV	NA	NA	NA	NA	NA
AZZ04793.1|4566023_4566488_-	lipoprotein	NA	A0A1V0DZX6	Clostridioides_phage	39.4	2.0e-14
AZZ04794.1|4566564_4567314_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	4.6e-08
AZZ04795.1|4567313_4567865_-	glutathione peroxidase	NA	NA	NA	NA	NA
AZZ04796.1|4567956_4568937_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
AZZ04797.1|4569139_4569439_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AZZ04798.1|4569443_4571831_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AZZ04799.1|4571846_4572830_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
AZZ05288.1|4572966_4573011_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
AZZ04800.1|4573131_4573488_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AZZ04801.1|4573538_4573736_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AZZ04802.1|4573831_4574374_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	4.8e-15
AZZ04803.1|4574377_4576306_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.6	1.6e-129
>prophage 332
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4586585	4588838	4876986		Tupanvirus(100.0%)	1	NA	NA
AZZ04815.1|4586585_4588838_+	catalase HPII	NA	A0A2K9L0T1	Tupanvirus	49.6	2.5e-142
>prophage 333
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4595005	4595833	4876986		Bacillus_virus(100.0%)	1	NA	NA
AZZ04823.1|4595005_4595833_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	5.0e-72
>prophage 334
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4602530	4603757	4876986		Klosneuvirus(100.0%)	1	NA	NA
AZZ04829.1|4602530_4603757_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.8	2.1e-26
>prophage 335
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4607344	4609294	4876986		Streptococcus_phage(100.0%)	1	NA	NA
AZZ04834.1|4607344_4609294_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	28.7	2.4e-40
>prophage 336
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4614179	4614836	4876986		Tupanvirus(100.0%)	1	NA	NA
AZZ04839.1|4614179_4614836_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	35.8	9.6e-18
>prophage 337
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4624246	4627667	4876986		Bacillus_phage(100.0%)	3	NA	NA
AZZ04848.1|4624246_4625533_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.3e-10
AZZ04849.1|4625682_4625880_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ04850.1|4626173_4627667_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	28.3	1.5e-10
>prophage 338
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4642634	4643432	4876986		Brazilian_cedratvirus(100.0%)	1	NA	NA
AZZ04872.1|4642634_4643432_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	4.7e-11
>prophage 339
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4647979	4648510	4876986		Escherichia_phage(100.0%)	1	NA	NA
AZZ04875.1|4647979_4648510_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	2.8e-36
>prophage 340
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4653150	4656479	4876986		Enterobacterial_phage(50.0%)	7	NA	NA
AZZ04883.1|4653150_4653708_-	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	33.0	2.2e-15
AZZ04884.1|4653741_4653939_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ04885.1|4654274_4654466_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ04886.1|4654514_4654778_+	virulence factor	NA	NA	NA	NA	NA
AZZ04887.1|4654909_4655122_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
AZZ04888.1|4655537_4656059_+	lipoprotein EnvE	NA	NA	NA	NA	NA
AZZ05296.1|4656239_4656479_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	84.8	1.2e-31
>prophage 341
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4660982	4662233	4876986		Phage_21(100.0%)	1	NA	NA
AZZ04892.1|4660982_4662233_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
>prophage 342
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4665760	4667131	4876986		Bodo_saltans_virus(100.0%)	1	NA	NA
AZZ04898.1|4665760_4667131_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	4.2e-108
>prophage 343
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4673451	4675435	4876986		Bacillus_virus(50.0%)	2	NA	NA
AZZ04904.1|4673451_4674588_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	34.0	2.1e-28
AZZ04905.1|4674571_4675435_+	spermidine/putrescine ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	26.2	2.0e-10
>prophage 344
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4679021	4682747	4876986		Vibrio_phage(50.0%)	4	NA	NA
AZZ04909.1|4679021_4679843_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	33.5	1.0e-21
AZZ04910.1|4679861_4680773_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AZZ04911.1|4680801_4682046_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
AZZ04912.1|4682045_4682747_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.7	2.4e-35
>prophage 345
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4688932	4689190	4876986		Erwinia_phage(100.0%)	1	NA	NA
AZZ04916.1|4688932_4689190_-	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	37.1	2.1e-05
>prophage 346
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4702353	4702995	4876986		Pseudomonas_phage(100.0%)	1	NA	NA
AZZ04930.1|4702353_4702995_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	35.7	4.2e-26
>prophage 347
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4706269	4707396	4876986		Ralstonia_phage(50.0%)	2	NA	NA
AZZ04934.1|4706269_4706506_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
AZZ04935.1|4706661_4707396_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.5	1.3e-15
>prophage 348
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4721213	4722164	4876986		Bacillus_phage(100.0%)	1	NA	NA
AZZ04949.1|4721213_4722164_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A160LKR7	Bacillus_phage	36.5	2.2e-10
>prophage 349
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4738176	4738422	4876986		Salmonella_phage(100.0%)	1	NA	NA
AZZ04970.1|4738176_4738422_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	52.6	4.1e-14
>prophage 350
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4743080	4744001	4876986		Morganella_phage(100.0%)	1	NA	NA
AZZ04976.1|4743080_4744001_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	40.5	1.1e-54
>prophage 351
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4753064	4753604	4876986		Scale_drop_disease_virus(100.0%)	1	NA	NA
AZZ04984.1|4753064_4753604_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	49.0	2.9e-28
>prophage 352
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4757758	4758592	4876986		Pelagibacter_phage(100.0%)	1	NA	NA
AZZ04992.1|4757758_4758592_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.5	3.3e-39
>prophage 353
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4766944	4768199	4876986	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
AZZ05003.1|4766944_4768199_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	2.2e-18
>prophage 354
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4774838	4777167	4876986		Enterobacteria_phage(50.0%)	4	NA	NA
AZZ05010.1|4774838_4776101_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	36.6	5.1e-68
AZZ05011.1|4776194_4776455_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZZ05012.1|4776558_4776819_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZZ05013.1|4776939_4777167_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	61.9	2.0e-15
>prophage 355
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4783656	4785119	4876986		Stenotrophomonas_phage(50.0%)	2	NA	NA
AZZ05019.1|4783656_4783947_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	47.4	3.4e-07
AZZ05020.1|4784594_4785119_+	peptidase	NA	G9L6C4	Escherichia_phage	77.7	1.3e-36
>prophage 356
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4793791	4797053	4876986		Erwinia_phage(50.0%)	3	NA	NA
AZZ05025.1|4793791_4794256_-	hypothetical protein	NA	A0A218M4J4	Erwinia_phage	34.7	1.5e-09
AZZ05302.1|4794892_4796350_-	EmmdR/YeeO family multidrug/toxin efflux MATE transporter	NA	NA	NA	NA	NA
AZZ05026.1|4796750_4797053_+	DUF4102 domain-containing protein	NA	A7X7X0	Dichelobacter_phage	51.9	2.9e-09
>prophage 357
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4800338	4800815	4876986		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AZZ05030.1|4800338_4800815_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	52.5	5.1e-37
>prophage 358
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4806837	4807653	4876986		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
AZZ05038.1|4806837_4807653_-	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	25.6	1.6e-09
>prophage 359
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4821165	4821960	4876986		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
AZZ05304.1|4821165_4821960_-	propanediol diffusion facilitator PduF	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	26.8	2.1e-11
>prophage 360
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4841661	4846588	4876986		Escherichia_phage(66.67%)	4	NA	NA
AZZ05078.1|4841661_4842834_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	87.2	5.8e-199
AZZ05079.1|4842957_4843722_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
AZZ05080.1|4843718_4844297_-	thiosulfate reductase electron transport protein PhsB	NA	A0A077SL61	Escherichia_phage	38.2	3.9e-23
AZZ05081.1|4844311_4846588_-	thiosulfate reductase PhsA	NA	A0A077SK27	Escherichia_phage	27.0	6.5e-37
>prophage 361
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4855273	4856173	4876986		Cellulophaga_phage(100.0%)	1	NA	NA
AZZ05087.1|4855273_4856173_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	100.0	1.7e-12
>prophage 362
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4863616	4866425	4876986		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
AZZ05096.1|4863616_4864783_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	53.7	6.3e-113
AZZ05097.1|4865018_4866425_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.2e-36
>prophage 363
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4869510	4870950	4876986		Hokovirus(100.0%)	1	NA	NA
AZZ05100.1|4869510_4870950_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.9	6.3e-54
>prophage 364
CP034819	Salmonella sp. SSDFZ54 chromosome, complete genome	4876986	4876231	4876762	4876986		Enterobacteria_phage(100.0%)	1	NA	NA
AZZ05105.1|4876231_4876762_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.5	1.4e-51
>prophage 1
CP034820	Salmonella sp. SSDFZ54 plasmid pTB501, complete sequence	188527	134855	154875	188527	integrase,transposase	Escherichia_phage(37.5%)	17	134792:134851	163182:163245
134792:134851	attL	CGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
AZZ05432.1|134855_135560_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AZZ05433.1|135661_136141_+	transcriptional regulator	NA	NA	NA	NA	NA
AZZ05434.1|136210_139363_-	multidrug efflux RND transporter permease subunit OqxB2	NA	NA	NA	NA	NA
AZZ05435.1|139386_140562_-	multidrug efflux RND transporter periplasmic adaptor subunit OqxA2	NA	NA	NA	NA	NA
AZZ05436.1|140881_141586_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AZZ05437.1|142232_142523_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
AZZ05438.1|142634_143132_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
AZZ05439.1|143276_144290_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AZZ05488.1|144258_144843_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AZZ05440.1|144968_145529_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AZZ05441.1|145531_148498_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AZZ05489.1|148506_148908_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ05442.1|148992_149697_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
AZZ05443.1|150621_151506_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AZZ05444.1|151722_152937_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
AZZ05445.1|152964_153270_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ05446.1|153381_154875_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
163182:163245	attR	CGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCAC	NA	NA	NA	NA
>prophage 1
CP034821	Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence	146389	0	146254	146389	terminase,tail,lysis,transposase,head,holin,plate,portal	Salmonella_phage(43.36%)	167	NA	NA
AZZ05496.1|76_457_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	100.0	1.9e-63
AZZ05497.1|456_678_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
AZZ05498.1|750_1140_-	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	100.0	8.3e-70
AZZ05499.1|1314_1899_+	DNA-binding protein	NA	A0A1B0V861	Salmonella_phage	100.0	1.7e-111
AZZ05500.1|1899_2256_+	hypothetical protein	NA	A0A1B0VCG1	Salmonella_phage	100.0	2.4e-63
AZZ05501.1|2675_2867_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ05502.1|3331_3694_-	hypothetical protein	NA	A0A1B0VBR1	Salmonella_phage	100.0	9.8e-57
AZZ05503.1|3690_4623_-	hypothetical protein	NA	A0A1B0VDS6	Salmonella_phage	100.0	1.3e-182
AZZ05504.1|4604_4979_-	hypothetical protein	NA	A0A1B0VBU7	Salmonella_phage	100.0	4.4e-68
AZZ05505.1|4985_5279_-	hypothetical protein	NA	A0A077SK23	Escherichia_phage	92.8	3.1e-45
AZZ05506.1|5457_5691_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	100.0	2.5e-37
AZZ05507.1|5767_6028_-	eaa protein	NA	A0A1B0V7L4	Salmonella_phage	100.0	3.8e-42
AZZ05508.1|6024_6885_-	DUF551 domain-containing protein	NA	A0A1B0V865	Salmonella_phage	100.0	3.1e-165
AZZ05509.1|6886_7567_-	ead/Ea22-like family protein	NA	A0A1B0VCG7	Salmonella_phage	100.0	2.4e-128
AZZ05510.1|7563_8208_-	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	100.0	5.2e-133
AZZ05511.1|8200_8461_-	hypothetical protein	NA	Q1MVG1	Enterobacteria_phage	100.0	5.2e-44
AZZ05512.1|8453_9035_-	hypothetical protein	NA	A0A077SLQ8	Escherichia_phage	100.0	2.0e-112
AZZ05513.1|9229_9736_-	3'-phosphatase	NA	A0A1B0VAK0	Salmonella_phage	100.0	4.8e-94
AZZ05514.1|9808_11071_-	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	100.0	5.4e-235
AZZ05515.1|11072_11291_-	hypothetical protein	NA	Q71TI9	Escherichia_phage	100.0	3.4e-36
AZZ05516.1|11372_12074_-	hypothetical protein	NA	Q1MVG6	Enterobacteria_phage	100.0	4.2e-144
AZZ05517.1|12070_12748_-	serine/threonine protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	100.0	7.6e-135
AZZ05518.1|12744_13371_-	norphogenetic protein	NA	A0A077SK52	Escherichia_phage	98.6	8.9e-122
AZZ05519.1|13268_13931_-	norphogenetic protein	NA	Q71T83	Escherichia_phage	100.0	4.5e-124
AZZ05520.1|13872_14028_-	norphogenetic protein	NA	Q71TJ4	Escherichia_phage	100.0	7.0e-20
AZZ05521.1|14094_14673_-	VRR-NUC domain-containing protein	NA	A0A1B0VBR8	Salmonella_phage	100.0	2.0e-107
AZZ05522.1|14675_14921_-	hypothetical protein	NA	A0A1B0VDU5	Salmonella_phage	100.0	1.5e-40
AZZ05523.1|15067_15445_+	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
AZZ05524.1|15454_16672_+|tail	phage tail protein	tail	A0A1B0VAL1	Salmonella_phage	100.0	6.4e-225
AZZ05525.1|16675_17404_+|tail	phage tail protein	tail	Q71TJ9	Escherichia_phage	100.0	4.2e-139
AZZ05526.1|17390_18176_+|plate	baseplate	plate	A0A1B0V7N6	Salmonella_phage	100.0	7.2e-145
AZZ05527.1|18177_19194_+|tail	phage tail tape measure protein	tail	A0A1B0V7N3	Salmonella_phage	100.0	4.5e-192
AZZ05528.1|19186_19819_+|plate	baseplate protein	plate	Q1MVH8	Enterobacteria_phage	100.0	9.0e-90
AZZ05529.1|19865_20864_-	hypothetical protein	NA	A0A077SL52	Escherichia_phage	99.7	9.6e-195
AZZ05530.1|20863_22228_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	100.0	1.2e-253
AZZ05531.1|22695_22860_-	DUF3927 domain-containing protein	NA	A0A1B0VDU8	Salmonella_phage	100.0	1.2e-17
AZZ05532.1|22859_23285_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	100.0	1.8e-70
AZZ05533.1|23476_23668_+	hypothetical protein	NA	Q71T98	Escherichia_phage	100.0	6.0e-29
AZZ05534.1|24844_27268_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	99.8	0.0e+00
AZZ05535.1|27264_28170_-	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.7	1.6e-159
AZZ05536.1|28162_28447_-	hypothetical protein	NA	Q71TA2	Escherichia_phage	100.0	3.5e-49
AZZ05537.1|28721_28901_+	hypothetical protein	NA	A0A1B0V758	Salmonella_phage	100.0	3.1e-27
AZZ05538.1|28909_29698_+	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	100.0	1.9e-121
AZZ05539.1|29737_30160_+	ppfA	NA	A0A1B0VCB0	Salmonella_phage	100.0	2.7e-58
AZZ05540.1|30337_30730_+	hypothetical protein	NA	A0A1B0VBK3	Salmonella_phage	100.0	2.4e-72
AZZ05541.1|31064_31949_+	RepB family plasmid replication initiator protein	NA	A0A1B0VDL5	Salmonella_phage	100.0	9.5e-162
AZZ05542.1|33219_34416_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
AZZ05543.1|34432_35434_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	100.0	2.8e-178
AZZ05544.1|35659_37366_+	hypothetical protein	NA	Q71TM1	Escherichia_phage	100.0	0.0e+00
AZZ05545.1|37426_39016_+	hypothetical protein	NA	A0A1B0V7E4	Salmonella_phage	100.0	2.5e-306
AZZ05546.1|39025_39841_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	100.0	6.8e-114
AZZ05547.1|39876_40458_+	hypothetical protein	NA	A0A1B0VCB5	Salmonella_phage	100.0	1.3e-103
AZZ05548.1|40469_40979_+|plate	baseplate protein	plate	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
AZZ05549.1|41150_41747_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	100.0	6.3e-109
AZZ05658.1|41926_42157_-	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	100.0	2.7e-36
AZZ05550.1|42237_42753_-	hypothetical protein	NA	A0A1B0VBR9	Salmonella_phage	100.0	6.4e-94
AZZ05551.1|42848_43691_-	Replication protein repL	NA	A0A1B0VAC8	Salmonella_phage	100.0	1.9e-151
AZZ05552.1|43720_44521_-	DNA-binding protein	NA	Q1MVK4	Enterobacteria_phage	100.0	1.9e-148
AZZ05659.1|44539_44764_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ05553.1|45160_46210_-	phage antirepressor Ant	NA	A0A1B0V7F1	Salmonella_phage	100.0	2.2e-189
AZZ05554.1|46206_46428_-	host cell division inhibitor Icd-like protein	NA	A0A077SLM6	Escherichia_phage	100.0	1.3e-38
AZZ05555.1|47047_47560_+	hypothetical protein	NA	A0A077SK39	Escherichia_phage	100.0	4.5e-55
AZZ05556.1|47563_48103_+	hypothetical protein	NA	A0A077SL46	Escherichia_phage	100.0	1.8e-46
AZZ05557.1|48183_48750_+	hypothetical protein	NA	A0A077SK12	Escherichia_phage	98.9	3.3e-99
AZZ05558.1|48760_49372_+|tail	phage tail protein	tail	A0A1B0VFV3	Salmonella_phage	100.0	9.9e-110
AZZ05559.1|49386_50268_+	morphogenetic protein	NA	A0A1B0VBL3	Salmonella_phage	100.0	1.3e-174
AZZ05560.1|50349_53763_+	lytic transglycosylase domain-containing protein	NA	A0A1B0VDM8	Salmonella_phage	100.0	0.0e+00
AZZ05561.1|53762_54119_+	hypothetical protein	NA	Q71TP1	Escherichia_phage	99.2	3.8e-61
AZZ05562.1|55022_55727_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AZZ05563.1|56332_56641_+	molecular chaperone GroEL	NA	NA	NA	NA	NA
AZZ05564.1|57054_58035_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	51.4	1.7e-79
AZZ05565.1|58027_58444_+	recombinase	NA	NA	NA	NA	NA
AZZ05566.1|58445_59720_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.4	5.8e-144
AZZ05567.1|59719_60157_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
AZZ05568.1|60153_60402_-	protein ImpC	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
AZZ05569.1|60512_60782_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ05660.1|60819_61722_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AZZ05570.1|62106_62790_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	3.9e-30
AZZ05571.1|62790_63012_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ05572.1|63024_63459_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AZZ05573.1|63509_64280_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ05574.1|64254_64776_+	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
AZZ05575.1|64696_65197_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	26.5	7.1e-05
AZZ05576.1|65335_65635_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ05577.1|65656_65902_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ05578.1|65924_66359_+	post-segregation killing protein PndC	NA	NA	NA	NA	NA
AZZ05579.1|66451_66718_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ05580.1|66782_67688_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.0	3.3e-61
AZZ05581.1|67749_67944_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ05582.1|67974_68226_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZZ05583.1|68259_68457_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ05584.1|68465_68681_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ05661.1|68805_69654_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AZZ05585.1|69919_70387_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ05586.1|70990_71338_-	molybdopterin-guanine dinucleotide biosynthesis protein MobC	NA	NA	NA	NA	NA
AZZ05587.1|71587_71902_+	mobilization protein	NA	NA	NA	NA	NA
AZZ05588.1|71930_74684_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ05589.1|74719_77041_-	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
AZZ05590.1|77094_77580_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.9	6.8e-53
AZZ05591.1|77645_77927_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ05592.1|77973_78561_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ05593.1|78616_79825_-	DsbC family protein	NA	NA	NA	NA	NA
AZZ05594.1|79897_81091_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ05595.1|81106_83320_-	type IA DNA topoisomerase	NA	NA	NA	NA	NA
AZZ05662.1|83610_83763_+	Hok/Gef family protein	NA	NA	NA	NA	NA
AZZ05596.1|83831_84077_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ05597.1|84434_84731_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ05598.1|84836_85787_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ05599.1|85855_88000_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ05600.1|88034_88259_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ05601.1|88261_88825_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ05602.1|88821_90033_-	conjugal transfer protein	NA	NA	NA	NA	NA
AZZ05603.1|90229_93292_-	ATP-binding protein	NA	NA	NA	NA	NA
AZZ05604.1|93291_93999_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ05605.1|94011_94548_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.2	3.2e-19
AZZ05606.1|94598_95021_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ05607.1|95059_95593_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ05608.1|95592_96477_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ05609.1|96469_97765_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ05610.1|97768_98710_-	conjugal transfer protein	NA	NA	NA	NA	NA
AZZ05611.1|98726_99425_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ05612.1|99432_99822_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ05613.1|99878_103394_-	DNA primase	NA	A0A1B0VML8	Pseudomonas_phage	29.4	4.2e-19
AZZ05614.1|103693_103981_-	conjugal transfer protein	NA	NA	NA	NA	NA
AZZ05615.1|103990_105148_-	plasmid transfer ATPase TraJ	NA	NA	NA	NA	NA
AZZ05616.1|105147_105960_-	conjugal transfer protein	NA	NA	NA	NA	NA
AZZ05617.1|105962_106412_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ05618.1|106457_106721_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ05619.1|107356_108559_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
AZZ05620.1|108644_109469_-	conjugal transfer protein TraE	NA	NA	NA	NA	NA
AZZ05621.1|109619_109898_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ05622.1|109888_110593_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AZZ05623.1|111383_111965_+	recombinase family protein	NA	A0A1B0VBM1	Salmonella_phage	100.0	5.6e-102
AZZ05624.1|112096_112321_-	recombinase family protein	NA	A0A1B0VDN8	Salmonella_phage	100.0	5.0e-35
AZZ05625.1|112448_112712_+	hypothetical protein	NA	Q71TD9	Escherichia_phage	67.1	1.1e-22
AZZ05626.1|112786_113116_+|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
AZZ05627.1|113112_113556_+|lysis	lysis protein	lysis	A0A077SK09	Escherichia_phage	99.3	2.9e-82
AZZ05628.1|113542_114145_+	odaE	NA	A0A1B0V7G7	Salmonella_phage	99.5	2.7e-99
AZZ05629.1|114146_116066_+	hypothetical protein	NA	A0A1B0V7H1	Salmonella_phage	100.0	0.0e+00
AZZ05630.1|116062_116428_+	ddrA	NA	A0A1B0V846	Salmonella_phage	100.0	6.4e-48
AZZ05631.1|116467_117676_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	99.3	8.5e-230
AZZ05632.1|117775_120763_+	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	99.2	0.0e+00
AZZ05633.1|120752_121064_+	hypothetical protein	NA	A0A077SLG5	Escherichia_phage	100.0	1.8e-46
AZZ05634.1|121093_121888_-	hypothetical protein	NA	Q71TF1	Escherichia_phage	95.1	2.2e-141
AZZ05635.1|122085_122574_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	100.0	5.0e-88
AZZ05636.1|122742_123300_+	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
AZZ05637.1|123435_123612_+|holin	antiholin	holin	Q71TR5	Escherichia_phage	91.4	3.9e-27
AZZ05638.1|123591_124611_-|head	head processing protein	head	A0A1B0V7I1	Salmonella_phage	100.0	2.9e-178
AZZ05639.1|124603_126313_-|portal	phage portal protein	portal	A0A1B0V850	Salmonella_phage	99.8	0.0e+00
AZZ05640.1|126388_133156_+	helicase	NA	Q1MVN7	Enterobacteria_phage	98.6	0.0e+00
AZZ05641.1|133189_133630_+	peptide-binding protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
AZZ05642.1|133626_133875_+	modulator protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
AZZ05643.1|133912_135034_-	GTP pyrophosphokinase	NA	A0A1B0VBT5	Salmonella_phage	100.0	2.2e-211
AZZ05644.1|135146_135788_-	maturation control protein	NA	A0A1B0VAG4	Salmonella_phage	99.5	2.2e-115
AZZ05645.1|135976_136537_-	recombinase	NA	Q5QBN4	Enterobacteria_phage	100.0	5.9e-101
AZZ05646.1|136784_137096_-	lysogeny establishment protein	NA	Q5QBN5	Enterobacteria_phage	100.0	2.1e-47
AZZ05647.1|137146_138178_-	recombinase	NA	Q5QBN6	Enterobacteria_phage	100.0	1.3e-194
AZZ05648.1|138185_138407_-	creatininase	NA	Q5QBN7	Enterobacteria_phage	100.0	4.5e-36
AZZ05649.1|138818_138932_+	peptidase	NA	Q5XLQ7	Enterobacteria_phage	100.0	3.2e-14
AZZ05650.1|138950_139046_+	peptidase	NA	Q38402	Escherichia_phage	100.0	2.8e-11
AZZ05651.1|139011_139221_+	c1 repressor inactivator	NA	Q5XLQ8	Enterobacteria_phage	100.0	4.8e-32
AZZ05652.1|139331_140183_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	98.9	6.8e-157
AZZ05653.1|140215_141328_-	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	87.7	1.4e-178
AZZ05654.1|141905_143390_-|terminase	terminase	terminase	Q5QBP2	Enterobacteria_phage	100.0	2.5e-292
AZZ05655.1|143389_144583_-|terminase	terminase	terminase	Q5QBP3	Enterobacteria_phage	100.0	5.7e-210
AZZ05656.1|144669_145122_-	Late promoter-activating protein	NA	Q71T63	Escherichia_phage	99.3	6.7e-79
AZZ05657.1|145210_146254_-	DUF968 domain-containing protein	NA	A0A1B0VBU2	Salmonella_phage	100.0	1.0e-207
