The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032665	Streptococcus pyogenes strain MGAS27961 chromosome, complete genome	1853912	36552	48865	1853912		Synechococcus_phage(28.57%)	8	NA	NA
AZZ61764.1|36552_40278_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	26.3	1.1e-38
AZZ61765.1|40438_41893_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	2.8e-54
AZZ61766.1|41920_42943_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	R9TMC7	Synechococcus_phage	42.1	2.4e-63
AZZ61767.1|43110_43665_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.6	6.8e-25
AZZ61768.1|43848_45396_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	52.4	3.4e-45
AZZ61769.1|45453_46578_-	CHAP domain-containing protein	NA	F8HGP2	Streptococcus_phage	28.6	7.7e-07
AZZ63399.1|46830_48096_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
AZZ61770.1|48373_48865_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.3	3.2e-18
>prophage 2
CP032665	Streptococcus pyogenes strain MGAS27961 chromosome, complete genome	1853912	782125	881709	1853912	head,integrase,tRNA,tail,portal,capsid,transposase,terminase	Streptococcus_phage(40.3%)	114	802096:802155	848263:848358
AZZ62402.1|782125_782350_-|transposase	transposase	transposase	NA	NA	NA	NA
AZZ62403.1|782669_783929_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
AZZ62404.1|784094_785798_+	alpha-glycosidase	NA	NA	NA	NA	NA
AZZ62405.1|785823_787959_+	cyclomaltodextrin glucanotransferase	NA	NA	NA	NA	NA
AZZ62406.1|788033_789341_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
AZZ62407.1|789337_790198_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
AZZ62408.1|790219_791035_+	maltodextrose utilization protein malA	NA	NA	NA	NA	NA
AZZ62409.1|791150_791951_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AZZ62410.1|792105_792942_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AZZ62411.1|792941_794303_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AZZ62412.1|794576_795824_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
AZZ62413.1|796066_797086_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.8	5.7e-17
AZZ62414.1|797201_798695_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
AZZ62415.1|798729_800994_+	glycogen/starch/alpha-glucan family phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	43.7	1.2e-11
AZZ62416.1|801250_801871_-	DUF3862 domain-containing protein	NA	NA	NA	NA	NA
802096:802155	attL	AACTCATGAACAAGACAAAAAGAAAAAACCTTGATGTAACAAGGTTTTAGTAAGTTATGA	NA	NA	NA	NA
AZZ62417.1|802233_803322_-|integrase	site-specific integrase	integrase	Q38159	Streptococcus_phage	98.6	3.0e-202
AZZ62418.1|803571_804381_-	MazF family toxin-antitoxin system	NA	J7KDP1	Streptococcus_phage	35.8	3.8e-24
AZZ62419.1|804393_805137_-	helix-turn-helix domain-containing protein	NA	A0A1S5S8T5	Streptococcus_phage	62.9	2.5e-75
AZZ62420.1|805629_805845_-	hypothetical protein	NA	J7KBX0	Streptococcus_phage	95.7	2.5e-28
AZZ62421.1|805903_806062_+	hypothetical protein	NA	J7KH24	Streptococcus_phage	90.4	8.4e-21
AZZ62422.1|806091_806691_-	hypothetical protein	NA	A0A097PAT4	Streptococcus_pyogenes_phage	100.0	3.1e-108
AZZ62423.1|806744_806954_+	hypothetical protein	NA	A0A097PAQ9	Streptococcus_pyogenes_phage	100.0	1.7e-32
AZZ62424.1|806942_807329_-	hypothetical protein	NA	A0A097PAT1	Streptococcus_pyogenes_phage	100.0	1.2e-65
AZZ62425.1|807402_807630_+	XRE family transcriptional regulator	NA	A0A141E1R7	Streptococcus_phage	57.3	2.9e-14
AZZ62426.1|807737_808247_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ62427.1|808301_808547_+	hypothetical protein	NA	A0A097PAP6	Streptococcus_pyogenes_phage	95.1	1.2e-34
AZZ62428.1|808505_808715_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ62429.1|808864_809104_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ62430.1|809270_809456_+	XRE family transcriptional regulator	NA	A0A1X9I6I3	Streptococcus_phage	72.1	3.3e-16
AZZ62431.1|809534_809831_+	hypothetical protein	NA	A0A097PAT8	Streptococcus_pyogenes_phage	98.0	3.1e-48
AZZ62432.1|809827_809965_+	hypothetical protein	NA	A0A097PAR2	Streptococcus_pyogenes_phage	100.0	3.4e-18
AZZ62433.1|810045_810375_+	hypothetical protein	NA	J7KBZ0	Streptococcus_phage	41.8	7.9e-13
AZZ62434.1|810374_810569_+	hypothetical protein	NA	J7KK69	Streptococcus_phage	54.2	3.9e-12
AZZ62435.1|810565_810850_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ62436.1|810846_811530_+	DNA-binding protein	NA	J7KC09	Streptococcus_phage	99.1	9.4e-125
AZZ62437.1|811565_812969_+	DEAD/DEAH box helicase	NA	A0A1P8BMH7	Lactococcus_phage	72.3	2.3e-194
AZZ62438.1|812973_813456_+	DUF669 domain-containing protein	NA	A0A1P8BM40	Lactococcus_phage	70.7	9.7e-60
AZZ62439.1|813473_815027_+	phage resistance protein	NA	A0A1P8BM51	Lactococcus_phage	70.6	5.7e-210
AZZ62440.1|815290_816160_+	hypothetical protein	NA	A0A1P8BME8	Lactococcus_phage	65.6	5.8e-103
AZZ62441.1|816113_816464_+	VRR-NUC domain-containing protein	NA	A0A1P8VVL5	Streptococcus_phage	88.5	9.9e-46
AZZ62442.1|816447_816804_+	hypothetical protein	NA	A0A097PAU4	Streptococcus_pyogenes_phage	100.0	2.9e-61
AZZ62443.1|816800_817046_+	hypothetical protein	NA	A0A097PBE9	Streptococcus_pyogenes_phage	95.1	2.1e-39
AZZ62444.1|817045_817282_+	DUF3310 domain-containing protein	NA	A0A097PAQ7	Streptococcus_pyogenes_phage	100.0	2.4e-40
AZZ62445.1|817445_817730_+	hypothetical protein	NA	A0A097PAV1	Streptococcus_pyogenes_phage	86.2	2.6e-36
AZZ62446.1|817731_818364_+	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	68.6	5.1e-85
AZZ63437.1|818368_818848_+	DUF1642 domain-containing protein	NA	A0A141E0J6	Streptococcus_phage	41.9	6.5e-24
AZZ62447.1|819296_819731_+	ArpU family transcriptional regulator	NA	J7KDQ1	Streptococcus_phage	97.9	6.2e-74
AZZ62448.1|820308_821223_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ62449.1|821241_821703_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ62450.1|821840_822218_-	HicB family protein	NA	I3NLB2	Bifidobacterium_phage	44.0	3.3e-15
AZZ62451.1|822269_822455_-	addiction module toxin, HicA family	NA	D6PSW1	Lactobacillus_phage	54.0	1.7e-09
AZZ63438.1|822517_822985_+|terminase	terminase small subunit	terminase	A0A141E1Y3	Streptococcus_phage	70.8	1.1e-52
AZZ62452.1|822962_824270_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4IYR5	uncultured_Caudovirales_phage	75.7	2.0e-184
AZZ62453.1|824281_825784_+|portal	phage portal protein	portal	C9W9H5	Streptococcus_virus	54.5	1.9e-141
AZZ62454.1|825764_827327_+|head	phage head morphogenesis protein	head	U6E9F1	Streptococcus_phage	44.2	2.5e-48
AZZ62455.1|827330_827516_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ62456.1|827585_827900_+	hypothetical protein	NA	M1PLI3	Streptococcus_phage	72.8	6.8e-38
AZZ62457.1|827902_828169_+	hypothetical protein	NA	A0A097PAR8	Streptococcus_pyogenes_phage	70.5	1.9e-25
AZZ62458.1|828312_828846_+	DUF4355 domain-containing protein	NA	A0A141E0S7	Streptococcus_phage	80.7	6.8e-14
AZZ62459.1|828855_829236_+|head	head decoration protein	head	A0A0K2CNR0	Brevibacillus_phage	32.5	1.8e-05
AZZ62460.1|829238_830321_+|capsid	minor capsid protein E	capsid	A0A2H4J022	uncultured_Caudovirales_phage	57.1	3.4e-105
AZZ62461.1|830330_830573_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ62462.1|830586_830940_+	hypothetical protein	NA	A0A2H4J002	uncultured_Caudovirales_phage	49.6	9.7e-25
AZZ62463.1|830936_831245_+	hypothetical protein	NA	A0A2P1JTW8	Anoxybacillus_phage	40.2	7.4e-13
AZZ62464.1|831225_831591_+	HK97 gp10 family phage protein	NA	A0A097BY98	Enterococcus_phage	46.3	5.9e-17
AZZ62465.1|831587_831977_+|capsid	phage capsid protein	capsid	B5SP36	Lactococcus_phage	68.2	4.2e-45
AZZ63439.1|832031_832655_+|tail	phage major tail protein, TP901-1 family	tail	D7RWD5	Brochothrix_phage	50.5	3.2e-39
AZZ62466.1|832708_833062_+	hypothetical protein	NA	Q77RZ7	Lactococcus_phage	48.6	5.5e-20
AZZ63440.1|833136_833433_+	hypothetical protein	NA	A0A0S2MYH1	Enterococcus_phage	42.2	1.3e-09
AZZ62467.1|833447_837083_+|tail	phage tail protein	tail	C5IUK3	Streptococcus_phage	41.4	1.2e-85
AZZ62468.1|837114_837894_+|tail	phage tail protein	tail	A3F655	Streptococcus_phage	54.0	1.9e-65
AZZ62469.1|837890_839945_+	hypothetical protein	NA	A3F656	Streptococcus_phage	84.1	0.0e+00
AZZ62470.1|839941_841156_+	hypothetical protein	NA	A3F657	Streptococcus_phage	49.5	5.0e-44
AZZ62471.1|841142_841472_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ62472.1|841482_843378_+	hyaluronidase	NA	Q938J9	Temperate_phage	52.5	5.9e-76
AZZ62473.1|843391_843553_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ62474.1|843555_844173_+	hypothetical protein	NA	A3F662	Streptococcus_phage	94.6	9.8e-89
AZZ62475.1|844183_844480_+	hypothetical protein	NA	Q938J6	Temperate_phage	98.0	3.7e-46
AZZ62476.1|844476_844662_+	hypothetical protein	NA	Q938J5	Temperate_phage	96.7	6.6e-25
AZZ62477.1|844773_846108_+	lysin	NA	Q5MY96	Streptococcus_phage	93.0	1.3e-247
AZZ62478.1|846183_846891_-	exotoxin type C	NA	A0A097PAT7	Streptococcus_pyogenes_phage	27.1	3.9e-09
AZZ62479.1|847001_847760_-	DNAse	NA	NA	NA	NA	NA
AZZ62480.1|847999_848188_+	Paratox	NA	A3F673	Streptococcus_phage	76.3	2.1e-18
AZZ62481.1|848778_849393_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	52.3	6.2e-51
848263:848358	attR	AACTCATGAACAAGACAAAAAGAAAAAACCTTGATGTAACAAGGTTTTAGTAAGTTATGATTACTTACGGTAAGCATTGATGGAGCTGGTGGGAGT	NA	NA	NA	NA
AZZ62482.1|849519_850305_-	ABC transporter permease	NA	NA	NA	NA	NA
AZZ62483.1|850314_851013_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.3	6.6e-09
AZZ62484.1|851012_851384_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ62485.1|851568_854679_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	29.7	5.4e-119
AZZ62486.1|854758_855772_+	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
AZZ62487.1|855834_857337_+	pyruvate kinase	NA	NA	NA	NA	NA
AZZ62488.1|857554_858112_+	signal peptidase I	NA	NA	NA	NA	NA
AZZ62489.1|858287_860102_+	glutamine--fructose-6-phosphate aminotransferase	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	38.7	1.2e-97
AZZ62490.1|860297_860633_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
AZZ62491.1|860739_861381_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AZZ62492.1|861390_862020_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.5	9.8e-28
AZZ62493.1|862035_862872_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZZ62494.1|863240_864014_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ62495.1|864383_865619_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
AZZ62496.1|865738_867061_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
AZZ62497.1|867589_869908_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.2	2.7e-131
AZZ62498.1|870270_870519_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AZZ62499.1|870555_871167_+	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
AZZ62500.1|871177_871366_+	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
AZZ62501.1|871378_871918_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
AZZ62502.1|871958_872159_+	CsbD family protein	NA	J7KJ36	Streptococcus_phage	50.0	1.8e-07
AZZ62503.1|872166_872658_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
AZZ62504.1|872820_873462_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ62505.1|873604_874147_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ62506.1|874264_874966_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	4.9e-36
AZZ62507.1|874980_877617_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
AZZ62508.1|877708_878305_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AZZ62509.1|878315_879272_+	aromatic acid exporter family protein	NA	NA	NA	NA	NA
AZZ62510.1|879368_880709_+	DUF2130 domain-containing protein	NA	NA	NA	NA	NA
AZZ62511.1|880824_881709_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
>prophage 3
CP032665	Streptococcus pyogenes strain MGAS27961 chromosome, complete genome	1853912	1201625	1212229	1853912		Streptococcus_phage(57.14%)	9	NA	NA
AZZ62807.1|1201625_1202768_-	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	27.3	1.4e-24
AZZ62808.1|1203002_1203443_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ62809.1|1203472_1204741_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AZZ62810.1|1204828_1206181_-	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.7	1.0e-29
AZZ62811.1|1206402_1206744_-	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	41.1	2.6e-19
AZZ62812.1|1206804_1207971_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.8	4.5e-34
AZZ62813.1|1208064_1208751_-	3-dehydroquinase	NA	W6LP76	Streptococcus_phage	68.9	7.0e-88
AZZ62814.1|1208747_1209911_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	64.9	4.5e-143
AZZ62815.1|1210018_1212229_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	68.8	2.5e-267
>prophage 4
CP032665	Streptococcus pyogenes strain MGAS27961 chromosome, complete genome	1853912	1490147	1496021	1853912		Streptococcus_phage(100.0%)	8	NA	NA
AZZ63058.1|1490147_1490975_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	79.9	1.7e-128
AZZ63059.1|1491048_1491405_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	65.8	6.3e-40
AZZ63060.1|1491703_1492333_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AZZ63061.1|1492379_1492772_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ63062.1|1492798_1493662_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	75.0	1.7e-115
AZZ63063.1|1493666_1493990_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	59.4	1.3e-28
AZZ63064.1|1494492_1495368_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	46.6	2.1e-68
AZZ63065.1|1495385_1496021_-	thymidylate kinase	NA	M1PSC7	Streptococcus_phage	63.4	2.7e-65
>prophage 5
CP032665	Streptococcus pyogenes strain MGAS27961 chromosome, complete genome	1853912	1758688	1770823	1853912	integrase,holin	Streptococcus_phage(60.0%)	18	1755034:1755048	1775541:1775555
1755034:1755048	attL	TTCTTCTTCGCTTTC	NA	NA	NA	NA
AZZ63294.1|1758688_1759909_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	23.8	1.6e-05
AZZ63467.1|1759919_1761902_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.1	1.3e-62
AZZ63468.1|1761996_1763142_-|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	44.9	3.5e-84
AZZ63295.1|1763396_1763540_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AZZ63296.1|1764401_1765169_-	helix-turn-helix domain-containing protein	NA	Q76TK4	Streptococcus_pyogenes_phage	83.1	3.6e-72
AZZ63297.1|1765322_1765529_+	XRE family transcriptional regulator	NA	X2KUC2	Streptococcus_phage	47.0	2.4e-07
AZZ63298.1|1765562_1765763_+	XRE family transcriptional regulator	NA	A0A1S5SE31	Streptococcus_phage	56.7	3.4e-11
AZZ63299.1|1765783_1766191_+	hypothetical protein	NA	A0A1X9I5V7	Streptococcus_phage	69.4	1.3e-49
AZZ63300.1|1766602_1767130_+	hypothetical protein	NA	R9QNB1	Lactococcus_phage	40.2	9.7e-21
AZZ63301.1|1767356_1767551_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AZZ63302.1|1767750_1767942_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AZZ63303.1|1768082_1768535_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ63304.1|1768622_1768805_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ63305.1|1768816_1769149_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ63469.1|1769148_1769340_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ63306.1|1769351_1769681_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ63307.1|1769683_1769956_+	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	60.0	3.6e-19
AZZ63308.1|1769956_1770823_+	hypothetical protein	NA	A0A1X9I6L2	Streptococcus_phage	73.8	6.1e-121
1775541:1775555	attR	GAAAGCGAAGAAGAA	NA	NA	NA	NA
>prophage 6
CP032665	Streptococcus pyogenes strain MGAS27961 chromosome, complete genome	1853912	1807000	1816988	1853912	integrase	Streptococcus_phage(75.0%)	15	1806574:1806588	1814136:1814150
1806574:1806588	attL	AATCCTTGAAGCTGT	NA	NA	NA	NA
AZZ63356.1|1807000_1807174_-	DUF2758 domain-containing protein	NA	A0A1X9I5U0	Streptococcus_phage	59.6	1.9e-10
AZZ63357.1|1807460_1809074_-	phage resistance protein	NA	A0A1P8BMF9	Lactococcus_phage	53.1	2.4e-147
AZZ63358.1|1809063_1809585_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ63359.1|1809594_1809963_-	hypothetical protein	NA	A0A1X9I6M4	Streptococcus_phage	47.1	2.6e-12
AZZ63470.1|1809871_1810063_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ63360.1|1810062_1810395_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ63361.1|1810406_1810589_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ63362.1|1810809_1811079_-	phage antirepressor protein	NA	NA	NA	NA	NA
AZZ63363.1|1811108_1811675_-	phage repressor protein	NA	A0A0A7S0G2	Clostridium_phage	42.9	5.0e-23
AZZ63364.1|1811690_1811879_-	XRE family transcriptional regulator	NA	A0A1X9I5U7	Streptococcus_phage	59.7	1.7e-12
AZZ63365.1|1812047_1812491_+	XRE family transcriptional regulator	NA	A0A1X9I723	Streptococcus_phage	48.6	1.8e-07
AZZ63366.1|1812670_1813834_+|integrase	site-specific integrase	integrase	A0A1X9I6A9	Streptococcus_phage	70.5	2.8e-161
AZZ63367.1|1813990_1814602_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
1814136:1814150	attR	ACAGCTTCAAGGATT	NA	NA	NA	NA
AZZ63368.1|1815331_1815604_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ63369.1|1815620_1816988_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	63.7	1.0e-154
