The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP022444	Klebsiella sp. LY chromosome, complete genome	5158003	6865	14296	5158003	coat	Enterobacteria_phage(100.0%)	10	NA	NA
AZZ16847.1|6865_7093_-|coat	phage coat protein	coat	D0U160	Enterobacteria_phage	58.7	3.2e-13
AZZ16848.1|7285_7579_-	DNA-binding protein G5P	NA	NA	NA	NA	NA
AZZ21514.1|7595_8711_-	Replication-associated protein G2P	NA	NA	NA	NA	NA
AZZ16849.1|8840_9047_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16850.1|9214_9556_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16851.1|10039_11326_-	general secretion pathway protein GspD	NA	J7HXF0	Enterobacteria_phage	53.8	1.5e-120
AZZ16852.1|11306_12371_-	assembly protein	NA	A7BJY0	Enterobacteria_phage	65.8	3.6e-131
AZZ16853.1|12370_12712_-|coat	phage coat protein	coat	A7BJW9	Enterobacteria_phage	59.8	1.1e-28
AZZ16854.1|12714_13995_-	attachment protein	NA	A7BJW8	Enterobacteria_phage	62.5	5.9e-112
AZZ16855.1|14068_14296_-|coat	phage coat protein	coat	D0U160	Enterobacteria_phage	58.7	3.2e-13
>prophage 2
CP022444	Klebsiella sp. LY chromosome, complete genome	5158003	853913	860836	5158003		Bacillus_phage(33.33%)	6	NA	NA
AZZ17601.1|853913_855410_+	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	28.3	8.6e-30
AZZ17602.1|855406_856129_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AZZ17603.1|856447_857809_+	U32 family peptidase	NA	Q6DW11	Phage_TP	94.0	9.7e-206
AZZ21559.1|858054_858948_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.3	1.8e-14
AZZ17604.1|859188_859962_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
AZZ21560.1|859972_860836_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 3
CP022444	Klebsiella sp. LY chromosome, complete genome	5158003	3779253	3820784	5158003	terminase,integrase,tRNA,lysis	Escherichia_phage(44.19%)	60	3782137:3782182	3828893:3828938
AZZ20237.1|3779253_3780639_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
AZZ20238.1|3780684_3780897_-	ribosome-associated protein	NA	NA	NA	NA	NA
AZZ20239.1|3780898_3781765_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
AZZ20240.1|3781803_3782127_+	hypothetical protein	NA	NA	NA	NA	NA
3782137:3782182	attL	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCAT	NA	NA	NA	NA
AZZ20241.1|3782199_3783360_-|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	90.8	2.8e-206
AZZ20242.1|3783590_3783809_-	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	52.2	2.6e-12
AZZ20243.1|3783805_3784342_-	hypothetical protein	NA	J9Q748	Salmonella_phage	74.3	3.6e-71
AZZ20244.1|3784338_3784560_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ20245.1|3784556_3785609_-	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	64.0	1.0e-141
AZZ20246.1|3785605_3786262_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	1.8e-112
AZZ20247.1|3786258_3786687_-	regulator	NA	M9NYX4	Enterobacteria_phage	81.0	3.4e-64
AZZ20248.1|3786683_3787364_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	91.2	1.6e-121
AZZ20249.1|3787360_3788206_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	61.2	1.5e-68
AZZ20250.1|3788221_3788506_-	hypothetical protein	NA	G8C7T1	Escherichia_phage	78.7	1.5e-39
AZZ20251.1|3788513_3789485_-	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	89.0	7.0e-65
AZZ20252.1|3789572_3789767_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ20253.1|3790228_3790663_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ20254.1|3790682_3791378_-	phage repressor protein C	NA	K7P7I4	Enterobacteria_phage	62.0	3.1e-75
AZZ20255.1|3791480_3791702_+	helix-turn-helix domain-containing protein	NA	Q716D6	Shigella_phage	55.1	4.1e-13
AZZ20256.1|3791741_3792026_+	hypothetical protein	NA	K7PHN8	Enterobacterial_phage	57.4	1.8e-21
AZZ20257.1|3792199_3793099_+	DNA replication protein	NA	F1C5C3	Cronobacter_phage	55.2	1.9e-88
AZZ20258.1|3793088_3794519_+	helicase DnaB	NA	Q9MCT4	Escherichia_phage	66.7	3.4e-185
AZZ20259.1|3794518_3794812_+	protein ren	NA	O48423	Enterobacteria_phage	65.6	2.5e-26
AZZ20260.1|3794808_3795375_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	32.0	6.6e-07
AZZ20261.1|3795371_3795578_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	98.5	3.6e-32
AZZ20262.1|3795574_3795865_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ20263.1|3795864_3796077_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	43.9	2.4e-10
AZZ20264.1|3796242_3796944_+	hypothetical protein	NA	R9TQX3	Aeromonas_phage	75.0	2.9e-20
AZZ20265.1|3797438_3797672_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ20266.1|3797720_3797978_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	71.4	5.4e-25
AZZ20267.1|3798178_3798610_+	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	45.2	3.6e-29
AZZ20268.1|3798602_3799187_+	endonuclease	NA	A0A2D1GLP6	Escherichia_phage	58.2	5.1e-55
AZZ20269.1|3799167_3799338_+	hypothetical protein	NA	G8C7V4	Escherichia_phage	71.4	1.3e-14
AZZ20270.1|3799330_3799912_+	protein NinG	NA	E7C9S3	Salmonella_phage	49.8	2.1e-40
AZZ20271.1|3799908_3800133_+	protein ninY	NA	Q76H69	Enterobacteria_phage	63.0	2.0e-23
AZZ20272.1|3800129_3800270_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ20273.1|3800266_3800767_+	antiterminator	NA	G8C7V7	Escherichia_phage	92.1	1.9e-87
AZZ20274.1|3801594_3801843_+|lysis	lysis protein	lysis	NA	NA	NA	NA
AZZ20275.1|3801845_3802376_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	78.9	9.3e-80
AZZ20276.1|3802372_3802762_+	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	48.4	2.4e-24
AZZ20277.1|3803027_3803402_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ20278.1|3803462_3804203_+	hypothetical protein	NA	A0A1I9KFG9	Aeromonas_phage	27.4	2.6e-11
AZZ20279.1|3804206_3805538_+|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	60.0	2.4e-153
AZZ20280.1|3805549_3806965_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	36.7	7.2e-87
AZZ20281.1|3806961_3807792_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	41.9	3.1e-53
AZZ20282.1|3807804_3809418_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AZZ20283.1|3809433_3810294_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ20284.1|3810307_3811339_+	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	45.5	7.4e-73
AZZ20285.1|3811410_3811893_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ20286.1|3811889_3812318_+	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	38.6	4.2e-22
AZZ20287.1|3812314_3812749_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ20288.1|3812732_3813671_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	37.6	8.5e-52
AZZ20289.1|3813675_3815070_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	35.7	3.3e-68
AZZ20290.1|3815073_3815511_+	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	36.8	3.3e-22
AZZ20291.1|3815514_3816087_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ20292.1|3816144_3818097_+	transglycosylase	NA	I6ZXX9	Escherichia_phage	41.6	2.2e-17
AZZ20293.1|3818099_3818825_+	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	37.5	7.1e-30
AZZ20294.1|3818821_3819097_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ20295.1|3819096_3820065_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ20296.1|3820067_3820784_+	hypothetical protein	NA	A0A0U2JTX5	Escherichia_phage	31.2	4.4e-24
3828893:3828938	attR	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCAT	NA	NA	NA	NA
>prophage 4
CP022444	Klebsiella sp. LY chromosome, complete genome	5158003	4293290	4302752	5158003	protease,tRNA	Dickeya_phage(16.67%)	8	NA	NA
AZZ20715.1|4293290_4294406_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AZZ20716.1|4294402_4296343_+	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	41.0	3.8e-38
AZZ20717.1|4296419_4296641_-	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AZZ20718.1|4296966_4297284_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AZZ20719.1|4297314_4299594_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	2.8e-165
AZZ20720.1|4299717_4299936_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AZZ20721.1|4300286_4300991_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AZZ20722.1|4301030_4302752_-	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.5	9.9e-14
>prophage 5
CP022444	Klebsiella sp. LY chromosome, complete genome	5158003	4543297	4635697	5158003	tRNA,capsid,tail,integrase,holin,terminase,head,portal	Klebsiella_phage(38.18%)	106	4615285:4615302	4639816:4639833
AZZ21698.1|4543297_4544404_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AZZ20929.1|4544460_4544919_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AZZ20930.1|4544935_4545586_-	23S rRNA pseudouridine(2457) synthase	NA	NA	NA	NA	NA
AZZ20931.1|4545826_4547077_+	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	92.6	1.1e-19
AZZ20932.1|4547194_4548322_-|integrase	integrase	integrase	O21925	Phage_21	58.4	3.3e-119
AZZ20933.1|4548302_4548548_-	excisionase	NA	NA	NA	NA	NA
AZZ20934.1|4548600_4550739_-	exodeoxyribonuclease VIII	NA	S4TNL0	Salmonella_phage	42.7	2.5e-99
AZZ20935.1|4550880_4551225_-	transcriptional regulator	NA	NA	NA	NA	NA
AZZ20936.1|4551267_4551462_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AZZ20937.1|4551852_4552167_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ20938.1|4552487_4552937_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	64.6	1.3e-37
AZZ20939.1|4553012_4553234_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	75.3	1.2e-28
AZZ20940.1|4553236_4553791_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ20941.1|4553842_4554826_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	55.2	8.9e-44
AZZ20942.1|4554818_4555283_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	71.5	3.1e-63
AZZ20943.1|4555296_4555737_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AZZ20944.1|4556141_4556741_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ20945.1|4556870_4558487_+	Patatin	NA	NA	NA	NA	NA
AZZ20946.1|4558549_4559386_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ20947.1|4559437_4560580_+	TIR domain-containing protein	NA	NA	NA	NA	NA
AZZ20948.1|4560583_4561171_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ20949.1|4561467_4562019_+	TIR domain-containing protein	NA	NA	NA	NA	NA
AZZ20950.1|4562429_4562663_+	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	1.7e-25
AZZ21699.1|4562725_4562965_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	58.6	1.9e-16
AZZ20951.1|4563005_4563398_+	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	1.0e-11
AZZ20952.1|4563394_4563598_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ20953.1|4563597_4564629_+	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	49.3	4.7e-96
AZZ20954.1|4564641_4564983_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	85.0	1.1e-54
AZZ21700.1|4565007_4566042_-	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	41.2	8.2e-64
AZZ21701.1|4566061_4567816_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ20955.1|4568210_4568387_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0R6PD93	Moraxella_phage	56.4	1.4e-08
AZZ20956.1|4568434_4568842_+	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	78.0	6.3e-52
AZZ20957.1|4569553_4569769_+|holin	holin	holin	A5LH82	Enterobacteria_phage	87.3	7.9e-30
AZZ20958.1|4569768_4570266_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	85.2	4.3e-79
AZZ20959.1|4570262_4570613_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	39.8	1.8e-10
AZZ20960.1|4571692_4571881_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ20961.1|4571987_4572209_+	DNA gyrase subunit B	NA	NA	NA	NA	NA
AZZ20962.1|4572362_4572725_+	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	81.7	3.4e-57
AZZ20963.1|4572676_4572994_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ20964.1|4572990_4573422_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.3	1.8e-41
AZZ20965.1|4573671_4574106_+|terminase	terminase	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
AZZ20966.1|4574105_4575827_+|terminase	terminase	terminase	Q7Y413	Yersinia_phage	57.4	1.1e-190
AZZ20967.1|4575820_4576000_+	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
AZZ20968.1|4575999_4577259_+|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.2	1.6e-223
AZZ20969.1|4577295_4578216_+	serine peptidase	NA	Q6UAX7	Klebsiella_phage	87.9	4.8e-148
AZZ20970.1|4578293_4579580_+|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.5	2.0e-216
AZZ20971.1|4579638_4579899_+	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	63.9	1.5e-22
AZZ20972.1|4579879_4580197_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	2.6e-45
AZZ20973.1|4580193_4580532_+|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
AZZ20974.1|4580512_4580902_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
AZZ20975.1|4580898_4581300_+	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	1.7e-62
AZZ20976.1|4581331_4581793_+|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
AZZ20977.1|4581850_4582216_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
AZZ20978.1|4582236_4582449_+	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	87.5	1.4e-31
AZZ20979.1|4582448_4585805_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.0	0.0e+00
AZZ20980.1|4585804_4586143_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	2.4e-57
AZZ20981.1|4586139_4586895_+|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.9	4.6e-125
AZZ20982.1|4586896_4587607_+	peptidase P60	NA	Q6UAW4	Klebsiella_phage	90.3	1.9e-136
AZZ20983.1|4587648_4588071_+	hypothetical protein	NA	J9Q806	Salmonella_phage	49.3	2.9e-28
AZZ20984.1|4588097_4588691_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	77.2	8.0e-80
AZZ20985.1|4588753_4597570_+	hypothetical protein	NA	Q6UAW1	Klebsiella_phage	44.7	0.0e+00
AZZ20986.1|4597631_4599056_+|tail	phage tail protein	tail	A0A0P0IDN1	Klebsiella_phage	53.0	1.3e-96
AZZ20987.1|4599478_4600537_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.8	6.1e-14
AZZ20988.1|4600893_4601586_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AZZ20989.1|4602235_4602388_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
AZZ20990.1|4602660_4603374_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ20991.1|4603370_4603763_-	amino acid-binding protein	NA	NA	NA	NA	NA
AZZ20992.1|4603755_4604079_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AZZ20993.1|4604215_4604689_-	peroxiredoxin	NA	NA	NA	NA	NA
AZZ20994.1|4604846_4605488_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ20995.1|4605778_4606324_+	cysteine hydrolase	NA	NA	NA	NA	NA
AZZ20996.1|4606378_4606606_-	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
AZZ20997.1|4606717_4607911_-	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
AZZ20998.1|4608103_4608307_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ20999.1|4608541_4608727_+	stress-induced acidophilic repeat motif-containing protein	NA	NA	NA	NA	NA
AZZ21000.1|4608817_4609312_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AZZ21001.1|4609338_4609845_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AZZ21002.1|4609861_4610749_+	Mn-containing catalase	NA	NA	NA	NA	NA
AZZ21702.1|4610803_4612210_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AZZ21003.1|4612206_4613217_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AZZ21004.1|4613573_4613771_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ21005.1|4614338_4614971_+	DNA-binding protein	NA	NA	NA	NA	NA
4615285:4615302	attL	GCATAAAAATGCCAAAAA	NA	NA	NA	NA
AZZ21006.1|4615606_4616293_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AZZ21007.1|4616428_4616839_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ21008.1|4616924_4618427_-	3,4-dihydroxybenzoate decarboxylase	NA	NA	NA	NA	NA
AZZ21009.1|4618548_4619448_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ21010.1|4619444_4621229_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	4.5e-17
AZZ21011.1|4621302_4622511_-	HD domain-containing protein	NA	NA	NA	NA	NA
AZZ21012.1|4622814_4623858_+	L-asparaginase	NA	NA	NA	NA	NA
AZZ21013.1|4624516_4625431_+	lipid A biosynthesis palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	49.6	1.2e-71
AZZ21014.1|4625520_4626159_+	leucine efflux protein	NA	NA	NA	NA	NA
AZZ21015.1|4626289_4626553_+	DUF2534 domain-containing protein	NA	NA	NA	NA	NA
AZZ21016.1|4626612_4626738_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ21017.1|4626930_4627032_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ21018.1|4627089_4628103_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	33.1	9.3e-12
AZZ21019.1|4628367_4629351_-|integrase	integrase	integrase	Q83VS6	Escherichia_phage	79.8	8.4e-151
AZZ21020.1|4629466_4629766_-	XRE family transcriptional regulator	NA	Q1JS83	Enterobacteria_phage	85.9	3.0e-43
AZZ21021.1|4629887_4630166_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	87.6	2.0e-41
AZZ21022.1|4630186_4630405_+	DUF4761 domain-containing protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	4.7e-06
AZZ21023.1|4630420_4630798_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ21024.1|4630813_4631086_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ21025.1|4631154_4631379_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ21026.1|4631375_4631942_+	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	32.1	4.7e-13
AZZ21703.1|4631950_4632178_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	41.0	1.9e-05
AZZ21027.1|4632174_4633110_+	adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	55.4	1.2e-82
AZZ21028.1|4633147_4635697_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	58.7	1.1e-247
4639816:4639833	attR	GCATAAAAATGCCAAAAA	NA	NA	NA	NA
>prophage 6
CP022444	Klebsiella sp. LY chromosome, complete genome	5158003	4640183	4671158	5158003	tRNA,capsid,tail,plate,terminase,portal	Enterobacteria_phage(69.57%)	36	NA	NA
AZZ21033.1|4640183_4641245_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.7	1.2e-142
AZZ21034.1|4641238_4642966_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	67.9	9.0e-233
AZZ21035.1|4643122_4643962_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.9	9.5e-95
AZZ21036.1|4643971_4645006_+|capsid	major capsid protein	capsid	A0A0M3ULA3	Salmonella_phage	50.0	4.8e-96
AZZ21037.1|4645055_4645922_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	58.5	5.8e-71
AZZ21038.1|4646026_4646542_+|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	49.4	1.4e-40
AZZ21039.1|4646541_4646742_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
AZZ21040.1|4646732_4647017_+|tail	phage tail protein	tail	NA	NA	NA	NA
AZZ21041.1|4647013_4647559_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	44.1	1.3e-31
AZZ21704.1|4647570_4647900_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AZZ21042.1|4648081_4648549_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.1	1.0e-45
AZZ21043.1|4648545_4649181_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	52.4	7.8e-57
AZZ21044.1|4649177_4649765_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	59.5	5.9e-59
AZZ21045.1|4649761_4650112_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	56.5	1.2e-27
AZZ21046.1|4650113_4651037_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	43.2	2.2e-52
AZZ21047.1|4651026_4654053_+|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
AZZ21048.1|4654049_4654262_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ21049.1|4654261_4655359_+|tail	phage tail protein	tail	G4KKN6	Yersinia_phage	47.8	5.2e-08
AZZ21050.1|4655607_4655925_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ21051.1|4656122_4658264_-	AAA family ATPase	NA	NA	NA	NA	NA
AZZ21052.1|4658556_4659042_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	66.2	4.0e-53
AZZ21053.1|4659057_4662033_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.4	8.3e-218
AZZ21705.1|4662019_4662178_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
AZZ21054.1|4662177_4662495_-|tail	phage tail protein	tail	B9A7B2	Serratia_phage	54.8	1.0e-17
AZZ21055.1|4662540_4663056_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
AZZ21056.1|4663055_4664228_-|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	70.5	6.5e-158
AZZ21057.1|4664382_4665522_+	hypothetical protein	NA	B9A7A9	Serratia_phage	72.0	2.1e-145
AZZ21706.1|4665565_4665817_+	hypothetical protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
AZZ21058.1|4666082_4666322_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AZZ21707.1|4666311_4666668_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AZZ21059.1|4666654_4667164_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AZZ21060.1|4667309_4668002_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ21061.1|4668033_4669218_-	cyanate MFS transporter	NA	NA	NA	NA	NA
AZZ21708.1|4669318_4670110_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZZ21062.1|4670093_4670540_-	DUF441 family protein	NA	NA	NA	NA	NA
AZZ21063.1|4670657_4671158_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
>prophage 7
CP022444	Klebsiella sp. LY chromosome, complete genome	5158003	5053877	5064763	5158003		Escherichia_phage(87.5%)	9	NA	NA
AZZ21417.1|5053877_5054498_-	class II aldolase	NA	A0A077SK32	Escherichia_phage	95.6	3.1e-111
AZZ21418.1|5054490_5055756_-	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	92.4	1.3e-217
AZZ21419.1|5055767_5056670_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	97.3	2.3e-155
AZZ21420.1|5056930_5057692_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	98.4	2.0e-131
AZZ21421.1|5057712_5058573_-	class A broad-spectrum beta-lactamase OKP-B-8	NA	A0A077SL40	Escherichia_phage	88.8	1.8e-141
AZZ21722.1|5058869_5059130_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
AZZ21422.1|5059216_5060305_+	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	96.7	1.9e-204
AZZ21423.1|5060335_5061601_-	MFS transporter	NA	NA	NA	NA	NA
AZZ21424.1|5061655_5064763_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.7	0.0e+00
>prophage 1
CP022442	Klebsiella sp. LY plasmid unnamed1, complete sequence	95324	6206	14433	95324	transposase	Enterobacteria_phage(50.0%)	8	NA	NA
AZZ16802.1|6206_6758_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	31.7	4.0e-17
AZZ16691.1|6861_7170_-	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	31.7	1.1e-08
AZZ16803.1|7166_7817_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
AZZ16692.1|8006_11012_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
AZZ16693.1|11175_11733_+	recombinase	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
AZZ16694.1|11915_12776_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AZZ16695.1|13034_13511_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AZZ16696.1|13557_14433_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
>prophage 2
CP022442	Klebsiella sp. LY plasmid unnamed1, complete sequence	95324	76928	83971	95324	integrase	Escherichia_phage(50.0%)	7	78812:78824	85564:85576
AZZ16772.1|76928_77900_-	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
AZZ16773.1|78133_78565_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
AZZ16774.1|78564_79836_+	DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.0	5.2e-153
78812:78824	attL	TGATGAACTGCCT	NA	NA	NA	NA
AZZ16775.1|80247_81123_+	replication initiation protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
AZZ16811.1|81787_82414_+	cobyrinic acid ac-diamide synthase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
AZZ16776.1|82533_82713_+	Par-like protein	NA	NA	NA	NA	NA
AZZ16777.1|83176_83971_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
85564:85576	attR	AGGCAGTTCATCA	NA	NA	NA	NA
>prophage 1
CP022441	Klebsiella sp. LY plasmid unnamed3, complete sequence	316557	2847	35338	316557	transposase,coat	Enterobacteria_phage(62.5%)	38	NA	NA
AZZ16348.1|2847_3054_+	hypothetical protein	NA	A0A0N9HH59	Vibrio_phage	43.6	1.0e-05
AZZ16349.1|3221_3563_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16350.1|4046_5333_-	general secretion pathway protein GspD	NA	J7HXF0	Enterobacteria_phage	53.8	1.5e-120
AZZ16351.1|5313_6378_-	assembly protein	NA	A7BJY0	Enterobacteria_phage	65.8	3.6e-131
AZZ16352.1|6377_6719_-|coat	phage coat protein	coat	A7BJW9	Enterobacteria_phage	59.8	1.1e-28
AZZ16353.1|6721_8002_-	attachment protein	NA	A7BJW8	Enterobacteria_phage	62.5	5.9e-112
AZZ16354.1|8075_8303_-|coat	phage coat protein	coat	D0U160	Enterobacteria_phage	58.7	3.2e-13
AZZ16355.1|8495_8789_-	DNA-binding protein G5P	NA	NA	NA	NA	NA
AZZ16677.1|8805_9921_-	Replication-associated protein G2P	NA	NA	NA	NA	NA
AZZ16356.1|10050_10257_+	hypothetical protein	NA	A0A0N9HH59	Vibrio_phage	43.6	1.0e-05
AZZ16357.1|10424_10766_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16358.1|11249_12536_-	general secretion pathway protein GspD	NA	J7HXF0	Enterobacteria_phage	53.8	1.5e-120
AZZ16359.1|12516_13581_-	assembly protein	NA	A7BJY0	Enterobacteria_phage	65.8	3.6e-131
AZZ16360.1|13580_13922_-|coat	phage coat protein	coat	A7BJW9	Enterobacteria_phage	59.8	1.1e-28
AZZ16361.1|13924_15205_-	attachment protein	NA	A7BJW8	Enterobacteria_phage	62.5	5.9e-112
AZZ16362.1|15278_15506_-|coat	phage coat protein	coat	D0U160	Enterobacteria_phage	58.7	3.2e-13
AZZ16363.1|15698_15992_-	DNA-binding protein G5P	NA	NA	NA	NA	NA
AZZ16678.1|16008_17124_-	Replication-associated protein G2P	NA	NA	NA	NA	NA
AZZ16364.1|17253_17460_+	hypothetical protein	NA	A0A0N9HH59	Vibrio_phage	43.6	1.0e-05
AZZ16365.1|17627_17969_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16366.1|18161_19565_+|transposase	ISNCY family transposase ISKpn21	transposase	NA	NA	NA	NA
AZZ16367.1|19593_20226_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ16368.1|20422_20716_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ16369.1|20769_21378_-	DUF2913 domain-containing protein	NA	NA	NA	NA	NA
AZZ16370.1|21514_21913_-	DNA-binding protein H-NS-like protein	NA	NA	NA	NA	NA
AZZ16371.1|22286_22643_-	hypothetical protein	NA	A0A141HRY5	Bacillus_phage	40.8	2.1e-11
AZZ16372.1|23023_23818_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AZZ16373.1|24062_24884_-	DNA repair protein	NA	NA	NA	NA	NA
AZZ16374.1|24992_25487_-	nuclease	NA	A0A0R6PHV6	Moraxella_phage	35.1	5.5e-18
AZZ16375.1|25666_26938_+	DUF1173 domain-containing protein	NA	NA	NA	NA	NA
AZZ16376.1|27333_27819_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16377.1|27829_28162_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ16378.1|29764_30115_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16379.1|30745_31480_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AZZ16380.1|31731_32490_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16381.1|32556_33303_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16382.1|33493_34063_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ16383.1|34321_35338_+|transposase	IS5/IS1182 family transposase	transposase	Q38213	Escherichia_phage	99.4	3.7e-186
>prophage 2
CP022441	Klebsiella sp. LY plasmid unnamed3, complete sequence	316557	54959	97308	316557	transposase,integrase	Escherichia_phage(26.32%)	42	68181:68195	104110:104124
AZZ16408.1|54959_55517_+|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	81.3	3.4e-48
AZZ16409.1|56818_57823_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZZ16410.1|58282_58603_+	DUF134 domain-containing protein	NA	NA	NA	NA	NA
AZZ16411.1|58577_59039_+	dinitrogenase iron-molybdenum cofactor	NA	NA	NA	NA	NA
AZZ16412.1|59199_59637_+	thioesterase	NA	NA	NA	NA	NA
AZZ16413.1|59751_60228_+	DNA starvation/stationary phase protection protein	NA	G0X506	Salmonella_phage	28.7	6.7e-05
AZZ16414.1|60532_60883_-	transcriptional regulator	NA	NA	NA	NA	NA
AZZ16415.1|61044_62703_+	CoA-disulfide reductase	NA	NA	NA	NA	NA
AZZ16416.1|63284_64512_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	80.1	2.3e-142
AZZ16417.1|64487_64748_+	isoprenylcysteine carboxyl methyltransferase	NA	NA	NA	NA	NA
AZZ16418.1|66758_68150_-|transposase	ISKra4 family transposase	transposase	NA	NA	NA	NA
68181:68195	attL	TCCCGGCTACTGGTT	NA	NA	NA	NA
AZZ16419.1|68186_68759_-	resolvase	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
AZZ16420.1|68895_69486_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
AZZ16421.1|69920_70535_+	resolvase	NA	A0A0A7NPV4	Enterobacteria_phage	47.4	8.1e-35
AZZ16422.1|70853_71510_-	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
AZZ16423.1|72589_73294_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZZ16424.1|73406_74222_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
AZZ16425.1|74475_75180_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AZZ16426.1|75347_76037_-	thymidylate synthase	NA	A0A219YAW0	Aeromonas_phage	56.9	1.6e-71
AZZ16427.1|76029_76512_-	dihydrofolate reductase	NA	A0A1B1PE20	Salmonella_phage	32.6	4.1e-10
AZZ16428.1|76889_78431_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AZZ16429.1|78835_79675_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AZZ16430.1|79668_80016_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AZZ16431.1|80179_80971_-	ANT(3'') family aminoglycoside nucleotidyltransferase	NA	NA	NA	NA	NA
AZZ16432.1|81028_81661_-	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
AZZ16433.1|81809_82262_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
AZZ16434.1|82413_83154_-	subclass B1 metallo-beta-lactamase SIM-1	NA	NA	NA	NA	NA
AZZ16435.1|83306_84266_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
AZZ16436.1|84156_84861_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZZ16437.1|84851_85145_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16438.1|85317_85851_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
AZZ16439.1|85943_86648_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZZ16440.1|86684_87137_-	dinitrogenase iron-molybdenum cofactor	NA	NA	NA	NA	NA
AZZ16441.1|87111_87432_-	DUF134 domain-containing protein	NA	NA	NA	NA	NA
AZZ16442.1|87891_88896_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZZ16443.1|88974_89532_-	DNA invertase	NA	A0A0C4UR34	Shigella_phage	63.8	1.9e-59
AZZ16444.1|89554_89914_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AZZ16445.1|90064_90454_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
AZZ16446.1|90450_90741_-	nucleotidyltransferase	NA	NA	NA	NA	NA
AZZ16447.1|90877_91582_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZZ16448.1|91621_94531_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	62.5	0.0e+00
AZZ16449.1|95097_97308_+|integrase	integrase	integrase	NA	NA	NA	NA
104110:104124	attR	AACCAGTAGCCGGGA	NA	NA	NA	NA
>prophage 3
CP022441	Klebsiella sp. LY plasmid unnamed3, complete sequence	316557	107320	121043	316557	tail	Salmonella_phage(50.0%)	23	NA	NA
AZZ16463.1|107320_108562_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	29.4	8.7e-12
AZZ16464.1|109461_109890_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ16465.1|109924_110170_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ16681.1|110166_110511_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ16466.1|110792_111425_-	hypothetical protein	NA	K4JV11	Caulobacter_phage	41.2	8.3e-27
AZZ16467.1|111510_111945_-|tail	phage tail protein	tail	A0A1I9KFG8	Aeromonas_phage	28.3	4.3e-06
AZZ16682.1|112034_112355_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ16468.1|112607_112895_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ16469.1|112987_113509_-	DUF262 domain-containing protein	NA	A0A2H4FWH2	Salmonella_phage	68.5	5.4e-64
AZZ16470.1|113548_114181_-	hypothetical protein	NA	A0A1V0E5L6	Salmonella_phage	55.9	1.5e-28
AZZ16471.1|114437_114650_-	hypothetical protein	NA	J9Q804	Salmonella_phage	50.0	3.0e-13
AZZ16472.1|115139_115424_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ16473.1|115420_115828_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	56.1	3.5e-18
AZZ16474.1|115920_116244_-	hypothetical protein	NA	E5AGF3	Erwinia_phage	46.9	1.6e-13
AZZ16475.1|116244_117318_-	hypothetical protein	NA	A6N3G8	Burkholderia_virus	56.8	1.1e-18
AZZ16476.1|117321_117546_-	hypothetical protein	NA	B1GS76	Salmonella_phage	51.2	2.3e-08
AZZ16477.1|117811_118546_-	hypothetical protein	NA	A0A1V0E5L5	Salmonella_phage	36.3	9.4e-14
AZZ16478.1|118538_118727_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ16479.1|118873_119119_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	65.8	6.1e-18
AZZ16480.1|119183_119795_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ16481.1|119837_120041_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	64.2	2.8e-16
AZZ16482.1|120327_120642_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ16483.1|120722_121043_-	hypothetical protein	NA	J9Q750	Salmonella_phage	53.8	8.2e-31
>prophage 4
CP022441	Klebsiella sp. LY plasmid unnamed3, complete sequence	316557	196418	239573	316557	transposase,integrase	Salmonella_phage(44.44%)	41	228178:228191	245874:245887
AZZ16558.1|196418_197387_-|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	5.9e-181
AZZ16559.1|197466_201432_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16560.1|201570_202095_+	signal peptidase I	NA	NA	NA	NA	NA
AZZ16561.1|202081_203443_+	conjugal transfer protein	NA	NA	NA	NA	NA
AZZ16562.1|203439_204477_+	plasmid transfer protein	NA	NA	NA	NA	NA
AZZ16563.1|204491_207668_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
AZZ16564.1|207707_208478_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ16565.1|208830_210630_+	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	23.7	8.2e-27
AZZ16566.1|211092_211983_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16567.1|212112_212466_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16568.1|212527_213349_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16569.1|213376_214429_+	ATP-binding protein	NA	NA	NA	NA	NA
AZZ16570.1|214525_215602_+	DUF3150 domain-containing protein	NA	NA	NA	NA	NA
AZZ16571.1|216440_216701_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16572.1|216799_217576_+	VWA domain-containing protein	NA	NA	NA	NA	NA
AZZ16573.1|217648_217879_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16574.1|217988_219233_+	topoisomerase	NA	A0A0H5AWB1	Pseudomonas_phage	25.5	1.5e-08
AZZ16575.1|219303_219843_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16576.1|219985_220204_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16577.1|220196_220805_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16578.1|220791_221034_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16579.1|221102_221546_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16580.1|221555_221963_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16581.1|222004_222718_+	hypothetical protein	NA	Q6QLL3	Human_immunodeficiency_virus	97.2	1.7e-12
AZZ16582.1|222755_223772_-|transposase	IS5/IS1182 family transposase	transposase	Q38213	Escherichia_phage	99.4	3.7e-186
AZZ16583.1|223737_224163_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16584.1|224159_224915_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16585.1|224914_225238_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16586.1|225376_226300_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16587.1|226335_226653_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16588.1|226713_227847_-	recombinase	NA	NA	NA	NA	NA
AZZ16589.1|228020_228275_+	hypothetical protein	NA	NA	NA	NA	NA
228178:228191	attL	ATGGTGCGTATGAC	NA	NA	NA	NA
AZZ16590.1|228361_229423_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16591.1|230319_231204_-	replication initiation protein	NA	A0A1B0VDL5	Salmonella_phage	41.1	9.8e-50
AZZ16592.1|231775_232381_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ16593.1|232968_233310_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16594.1|233638_234643_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZZ16595.1|234721_237694_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
AZZ16596.1|237696_238254_-	resolvase	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
AZZ16597.1|238291_238621_-|transposase	transposase	transposase	NA	NA	NA	NA
AZZ16598.1|238559_239573_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
245874:245887	attR	ATGGTGCGTATGAC	NA	NA	NA	NA
>prophage 5
CP022441	Klebsiella sp. LY plasmid unnamed3, complete sequence	316557	243599	294740	316557	transposase	Escherichia_phage(46.67%)	49	NA	NA
AZZ16604.1|243599_245141_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AZZ16685.1|246539_247313_+	ArmA family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
AZZ16605.1|247293_247575_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ16606.1|247794_247980_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ16607.1|248028_249213_+|transposase	IS4 family transposase ISEc29	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
AZZ16608.1|249611_251087_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
AZZ16609.1|251142_252027_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AZZ16610.1|252385_252928_-	DNA-binding protein	NA	NA	NA	NA	NA
AZZ16611.1|252994_253822_-	RepB family plasmid replication initiator protein	NA	A0A218MNI2	uncultured_virus	42.5	3.9e-48
AZZ16612.1|253812_254517_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AZZ16613.1|255559_255889_+	toxin-antitoxin system, toxin component	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
AZZ16614.1|255869_256151_+	XRE family transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
AZZ16615.1|256428_257409_+|transposase	IS5/IS1182 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
AZZ16616.1|257447_257573_-	ABC transporter	NA	NA	NA	NA	NA
AZZ16617.1|257725_258226_-	ferritin	NA	NA	NA	NA	NA
AZZ16618.1|258552_259257_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZZ16619.1|259336_259837_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16620.1|259986_260628_+	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
AZZ16621.1|260771_261476_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZZ16622.1|261487_262144_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ16623.1|262239_263424_+	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
AZZ16624.1|263518_264628_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	2.8e-33
AZZ16625.1|264649_265084_+	esterase	NA	NA	NA	NA	NA
AZZ16626.1|265117_265822_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZZ16627.1|265911_266145_+	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	52.7	1.7e-17
AZZ16628.1|266808_266970_+	type I toxin-antitoxin system hok family toxin	NA	NA	NA	NA	NA
AZZ16629.1|267177_267438_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ16630.1|267978_268950_+	Hok/Gef family protein	NA	NA	NA	NA	NA
AZZ16631.1|269310_269688_-	phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZZ16632.1|271222_271438_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16633.1|271527_271815_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16634.1|271982_272387_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16635.1|272548_272896_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16636.1|273523_273880_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16637.1|273931_274705_-	nuclease-related domain protein	NA	A0A2R2ZH57	Clostridioides_phage	32.1	6.0e-11
AZZ16638.1|274711_275848_-	S49 family peptidase	NA	A0A0K2FHL6	Achromobacter_phage	30.2	2.0e-10
AZZ16639.1|275856_276531_-	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
AZZ16640.1|276543_277641_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ16641.1|277643_279770_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
AZZ16642.1|279759_282696_-	conjugal transfer protein TraI	NA	NA	NA	NA	NA
AZZ16643.1|282710_283520_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ16644.1|283519_283984_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ16645.1|284860_285349_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16646.1|285542_286067_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16647.1|286083_286626_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16648.1|286998_288036_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
AZZ16649.1|288025_289435_+	conjugal transfer protein	NA	NA	NA	NA	NA
AZZ16650.1|289436_293375_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AZZ16651.1|293411_294740_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 6
CP022441	Klebsiella sp. LY plasmid unnamed3, complete sequence	316557	306200	314690	316557	coat	Enterobacteria_phage(85.71%)	10	NA	NA
AZZ16664.1|306200_307487_-	general secretion pathway protein GspD	NA	J7HXF0	Enterobacteria_phage	53.8	1.5e-120
AZZ16665.1|307467_308532_-	assembly protein	NA	A7BJY0	Enterobacteria_phage	65.8	3.6e-131
AZZ16666.1|308531_308873_-|coat	phage coat protein	coat	A7BJW9	Enterobacteria_phage	59.8	1.1e-28
AZZ16667.1|308875_310156_-	attachment protein	NA	A7BJW8	Enterobacteria_phage	62.5	5.9e-112
AZZ16668.1|310229_310457_-|coat	phage coat protein	coat	D0U160	Enterobacteria_phage	58.7	3.2e-13
AZZ16669.1|310649_310943_-	DNA-binding protein G5P	NA	NA	NA	NA	NA
AZZ16688.1|310959_312075_-	Replication-associated protein G2P	NA	NA	NA	NA	NA
AZZ16670.1|312204_312411_+	hypothetical protein	NA	A0A0N9HH59	Vibrio_phage	43.6	1.0e-05
AZZ16671.1|312578_312920_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ16672.1|313403_314690_-	general secretion pathway protein GspD	NA	J7HXF0	Enterobacteria_phage	53.8	1.5e-120
