The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025576	Klebsiella pneumoniae strain 08EU827 chromosome, complete genome	5277535	1659363	1666268	5277535		Planktothrix_phage(33.33%)	6	NA	NA
AZZ34780.1|1659363_1660227_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
AZZ31499.1|1660237_1661011_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
AZZ34781.1|1661251_1662145_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AZZ31500.1|1662390_1663752_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
AZZ31501.1|1664070_1664793_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AZZ31502.1|1664789_1666268_-	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 2
CP025576	Klebsiella pneumoniae strain 08EU827 chromosome, complete genome	5277535	2701498	2712385	5277535		Escherichia_phage(87.5%)	9	NA	NA
AZZ32440.1|2701498_2704606_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AZZ32441.1|2704660_2705926_+	MFS transporter	NA	NA	NA	NA	NA
AZZ32442.1|2705956_2707045_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AZZ32443.1|2707131_2707392_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
AZZ32444.1|2707689_2708550_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
AZZ32445.1|2708570_2709332_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AZZ32446.1|2709592_2710495_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AZZ32447.1|2710506_2711772_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
AZZ32448.1|2711764_2712385_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 3
CP025576	Klebsiella pneumoniae strain 08EU827 chromosome, complete genome	5277535	3113335	3158219	5277535	transposase,plate,integrase,tRNA,terminase,tail,capsid,portal	Enterobacteria_phage(52.94%)	56	3118563:3118580	3154485:3154502
AZZ32802.1|3113335_3113836_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AZZ32803.1|3113952_3114399_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AZZ34849.1|3114382_3115174_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZZ32804.1|3115275_3116460_+	cyanate MFS transporter	NA	NA	NA	NA	NA
AZZ32805.1|3116491_3117184_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ32806.1|3117329_3117839_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AZZ32807.1|3117825_3118182_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AZZ32808.1|3118171_3118411_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
3118563:3118580	attL	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
AZZ32809.1|3118675_3118927_-	hypothetical protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
AZZ32810.1|3118970_3120110_-	hypothetical protein	NA	B9A7A9	Serratia_phage	71.0	9.4e-146
AZZ32811.1|3120264_3121437_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.7	2.9e-158
AZZ32812.1|3121436_3121952_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	3.7e-57
AZZ32813.1|3121997_3122315_+|tail	phage tail protein	tail	B9A7B2	Serratia_phage	54.8	1.0e-17
AZZ32814.1|3122314_3122473_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	65.3	2.7e-11
AZZ32815.1|3122459_3125435_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.1	1.1e-217
AZZ32816.1|3125449_3125941_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	61.5	3.6e-54
AZZ32817.1|3126231_3126612_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ32818.1|3127013_3127982_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	3.7e-183
AZZ32819.1|3127999_3128722_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ32820.1|3129514_3130612_-|tail	phage tail protein	tail	G4KKN6	Yersinia_phage	48.9	5.2e-08
AZZ32821.1|3130611_3130824_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ32822.1|3130820_3133847_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.0	4.1e-23
AZZ32823.1|3133836_3134760_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	44.6	1.2e-53
AZZ32824.1|3134761_3135112_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	54.8	1.6e-27
AZZ32825.1|3135108_3135696_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.5	6.9e-60
AZZ32826.1|3135692_3136328_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.9	4.6e-57
AZZ32827.1|3136324_3136792_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	59.5	1.6e-46
AZZ34850.1|3136973_3137303_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AZZ32828.1|3137314_3137860_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	42.5	8.2e-31
AZZ32829.1|3137856_3138141_-|tail	phage tail protein	tail	NA	NA	NA	NA
AZZ32830.1|3138131_3138332_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
AZZ32831.1|3138331_3138847_-|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	49.4	4.1e-40
AZZ32832.1|3138959_3139817_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	61.3	2.8e-70
AZZ32833.1|3139866_3140901_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	49.7	1.4e-95
AZZ32834.1|3140911_3141751_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.9	1.2e-94
AZZ32835.1|3141907_3143635_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	68.3	3.1e-233
AZZ32836.1|3143628_3144690_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.4	7.0e-143
AZZ32837.1|3145209_3145824_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ32838.1|3146979_3149589_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	50.3	2.2e-190
AZZ32839.1|3149606_3150563_-	adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	53.7	6.6e-84
AZZ34851.1|3150559_3150787_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	41.0	1.9e-05
AZZ32840.1|3150795_3151362_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	31.5	1.0e-12
AZZ32841.1|3151358_3151583_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ32842.1|3151651_3151924_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ32843.1|3151939_3152317_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ32844.1|3152332_3152551_-	DUF4761 domain-containing protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
AZZ32845.1|3152571_3152850_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
AZZ32846.1|3152970_3153270_+	XRE family transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
AZZ32847.1|3153385_3154369_+|integrase	integrase	integrase	Q83VS6	Escherichia_phage	80.1	6.4e-151
AZZ32848.1|3154633_3155647_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
3154485:3154502	attR	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
AZZ32849.1|3155704_3155806_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ34852.1|3155805_3155880_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ32850.1|3155997_3156123_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ32851.1|3156182_3156446_-	DUF2534 domain-containing protein	NA	NA	NA	NA	NA
AZZ32852.1|3156576_3157215_-	leucine efflux protein	NA	NA	NA	NA	NA
AZZ32853.1|3157304_3158219_-	lipid A biosynthesis palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
>prophage 4
CP025576	Klebsiella pneumoniae strain 08EU827 chromosome, complete genome	5277535	3177913	3228372	5277535	integrase,tRNA,holin,terminase,protease,tail,portal	Enterobacteria_phage(23.68%)	53	3176069:3176083	3226183:3226197
3176069:3176083	attL	TGGCTGGCGTTCTTT	NA	NA	NA	NA
AZZ32876.1|3177913_3178066_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
AZZ32877.1|3178220_3179717_-|tail	phage tail protein	tail	A0A0P0IDN1	Klebsiella_phage	65.1	1.4e-128
AZZ32878.1|3179778_3188595_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	43.2	0.0e+00
AZZ32879.1|3188657_3189248_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	77.0	2.5e-81
AZZ32880.1|3189279_3189990_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	90.7	1.1e-136
AZZ32881.1|3189991_3190747_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	84.1	1.3e-130
AZZ32882.1|3190743_3191091_-|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	67.8	4.7e-40
AZZ32883.1|3191095_3194239_-|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	73.1	0.0e+00
AZZ32884.1|3194222_3194537_-|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	75.0	5.0e-41
AZZ32885.1|3194557_3194986_-|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	60.0	2.7e-37
AZZ32886.1|3194996_3195740_-|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	83.0	1.7e-111
AZZ32887.1|3195748_3196150_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	75.6	2.7e-55
AZZ32888.1|3196146_3196725_-|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	81.2	1.7e-79
AZZ32889.1|3196728_3197004_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	57.1	1.1e-23
AZZ32890.1|3196996_3197323_-	DUF2190 domain-containing protein	NA	K7PJY3	Enterobacterial_phage	66.7	8.1e-34
AZZ32891.1|3197406_3199434_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	82.1	0.0e+00
AZZ32892.1|3199378_3200881_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.0	2.8e-246
AZZ32893.1|3200880_3201093_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	80.0	2.9e-24
AZZ32894.1|3201089_3203192_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	84.0	0.0e+00
AZZ32895.1|3203191_3203680_-	DUF1441 domain-containing protein	NA	K7PJY2	Enterobacterial_phage	87.7	1.3e-72
AZZ32896.1|3203911_3204334_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.3	1.2e-40
AZZ32897.1|3204330_3204648_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ32898.1|3205100_3205322_-	DNA gyrase subunit B	NA	NA	NA	NA	NA
AZZ32899.1|3205428_3205617_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ32900.1|3206696_3207047_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	39.8	1.8e-10
AZZ32901.1|3207043_3207541_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	85.8	1.9e-79
AZZ32902.1|3207540_3207756_-|holin	holin	holin	A5LH82	Enterobacteria_phage	87.3	7.9e-30
AZZ32903.1|3208973_3210005_+	nucleoid-associated protein	NA	NA	NA	NA	NA
AZZ32904.1|3209994_3211173_+	hypothetical protein	NA	A0A291AUQ1	Sinorhizobium_phage	29.9	1.5e-45
AZZ32905.1|3211196_3211544_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	89.4	5.5e-57
AZZ32906.1|3211556_3212588_-	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	49.3	2.4e-95
AZZ32907.1|3212587_3212791_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ32908.1|3212787_3213180_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	4.7e-12
AZZ32909.1|3213220_3213511_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	1.4e-16
AZZ32910.1|3213522_3213756_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	1.7e-25
AZZ32911.1|3214218_3215586_-	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	29.7	9.0e-10
AZZ32912.1|3215897_3216338_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AZZ32913.1|3216351_3216816_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	70.2	7.6e-62
AZZ34853.1|3216808_3217813_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	41.9	8.6e-34
AZZ32914.1|3217873_3218428_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ32915.1|3218430_3218655_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	62.5	1.3e-19
AZZ32916.1|3218743_3219181_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	62.2	1.3e-39
AZZ32917.1|3219502_3219817_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ32918.1|3219979_3220198_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ32919.1|3220207_3220402_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AZZ32920.1|3220444_3220789_+	transcriptional regulator	NA	NA	NA	NA	NA
AZZ32921.1|3220930_3223069_+	exonuclease	NA	S4TNL0	Salmonella_phage	43.0	5.0e-100
AZZ32922.1|3223121_3223367_+	excisionase	NA	NA	NA	NA	NA
AZZ32923.1|3223347_3224475_+|integrase	integrase	integrase	O21925	Phage_21	58.4	3.3e-119
AZZ32924.1|3224592_3225843_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
AZZ32925.1|3226083_3226734_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
3226183:3226197	attR	AAAGAACGCCAGCCA	NA	NA	NA	NA
AZZ32926.1|3226750_3227209_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AZZ34854.1|3227265_3228372_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 5
CP025576	Klebsiella pneumoniae strain 08EU827 chromosome, complete genome	5277535	3475469	3484943	5277535	tRNA,protease	Brazilian_cedratvirus(16.67%)	9	NA	NA
AZZ33143.1|3475469_3477191_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
AZZ33144.1|3477235_3477937_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AZZ33145.1|3478290_3478509_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AZZ33146.1|3478639_3480919_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AZZ33147.1|3480949_3481267_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AZZ33148.1|3481592_3481814_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AZZ33149.1|3481768_3481951_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ33150.1|3481890_3483831_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AZZ33151.1|3483827_3484943_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 6
CP025576	Klebsiella pneumoniae strain 08EU827 chromosome, complete genome	5277535	4642107	4652082	5277535		Enterobacteria_phage(83.33%)	9	NA	NA
AZZ34168.1|4642107_4644441_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	84.3	0.0e+00
AZZ34169.1|4644454_4644775_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ34170.1|4644771_4644999_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ34171.1|4644995_4645547_-	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	68.4	3.4e-32
AZZ34172.1|4646370_4647108_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	60.1	2.9e-71
AZZ34173.1|4647104_4647350_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	59.3	5.0e-20
AZZ34174.1|4647367_4647934_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.1e-59
AZZ34175.1|4648278_4650753_+	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
AZZ34176.1|4650828_4652082_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	41.0	9.6e-75
>prophage 1
CP025577	Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence	215872	8976	59298	215872	integrase,transposase	Salmonella_phage(15.38%)	46	46165:46184	59334:59353
AZZ34955.1|8976_9945_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.4	8.7e-185
AZZ34956.1|9982_10234_-	DUF1471 domain-containing protein	NA	A0A1B2IE60	Erwinia_phage	59.6	6.9e-09
AZZ34957.1|10359_11151_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AZZ34958.1|11299_12193_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ34959.1|12227_13217_-	aldo/keto reductase	NA	NA	NA	NA	NA
AZZ34960.1|13243_14095_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.6	4.4e-47
AZZ34961.1|14564_15632_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ34962.1|15862_16927_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZZ34963.1|17034_17619_-	flavodoxin	NA	NA	NA	NA	NA
AZZ34964.1|17628_18390_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AZZ34965.1|18367_18847_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AZZ34966.1|18911_20369_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	27.6	2.4e-21
AZZ34967.1|20384_21065_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.4	1.0e-30
AZZ34968.1|21079_22222_-	aldo/keto reductase	NA	NA	NA	NA	NA
AZZ34969.1|22496_23546_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZZ34970.1|23805_24486_+	nitroreductase	NA	M1I6Q5	Acanthocystis_turfacea_Chlorella_virus	34.2	1.9e-24
AZZ34971.1|24493_25696_-	MFS transporter	NA	NA	NA	NA	NA
AZZ34972.1|26278_26509_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ35140.1|26522_26696_-	transcriptional regulator	NA	NA	NA	NA	NA
AZZ34973.1|26723_27077_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ34974.1|27258_28263_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZZ34975.1|28849_29932_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
AZZ34976.1|30053_33128_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.6	0.0e+00
AZZ34977.1|33179_34433_+	MFS transporter	NA	NA	NA	NA	NA
AZZ34978.1|34489_34660_+	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
AZZ34979.1|35886_36891_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZZ35141.1|37188_37431_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ34980.1|37761_38055_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
AZZ34981.1|38153_38921_-	ferric citrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
AZZ34982.1|38921_39878_-	iron-dicitrate transporter subunit FecD	NA	NA	NA	NA	NA
AZZ34983.1|39874_40873_-	iron-dicitrate transporter permease subunit	NA	NA	NA	NA	NA
AZZ34984.1|40869_41772_-	Fe(3+)-dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
AZZ34985.1|41816_44141_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AZZ34986.1|44233_45187_-	FecR family protein	NA	NA	NA	NA	NA
AZZ34987.1|45183_45705_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
46165:46184	attL	GGCTTTGTTGAATAAATCAG	NA	NA	NA	NA
AZZ34988.1|46807_46975_+|integrase	integrase	integrase	NA	NA	NA	NA
AZZ34989.1|47259_48387_+	regulator	NA	NA	NA	NA	NA
AZZ34990.1|48383_48977_+	response regulator	NA	NA	NA	NA	NA
AZZ34991.1|48973_49822_+	ABC transporter permease	NA	NA	NA	NA	NA
AZZ34992.1|49821_50742_+	ABC transporter permease	NA	NA	NA	NA	NA
AZZ34993.1|50754_52359_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZZ34994.1|52403_53351_+	acetamidase	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
AZZ34995.1|53358_55092_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
AZZ34996.1|55943_56204_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ34997.1|57051_58056_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZZ34998.1|58329_59298_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	2.0e-173
59334:59353	attR	CTGATTTATTCAACAAAGCC	NA	NA	NA	NA
>prophage 2
CP025577	Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence	215872	96152	103992	215872	plate,tail	Escherichia_phage(71.43%)	10	NA	NA
AZZ35027.1|96152_97442_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	2.5e-171
AZZ35028.1|97490_99242_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AZZ35029.1|99259_99622_-	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AZZ35030.1|99669_100023_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	4.1e-23
AZZ35031.1|100575_100932_+	recombination enhancement function domain protein	NA	Q71TG3	Escherichia_phage	65.2	4.2e-36
AZZ35032.1|100931_101162_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ35144.1|101493_102015_+	maturation control protein	NA	A0A222YZ79	Escherichia_phage	53.8	6.4e-49
AZZ35033.1|102011_102341_+|plate	baseplate protein	plate	A0A222YYR0	Escherichia_phage	65.1	6.7e-36
AZZ35034.1|102333_103536_+|tail	phage tail protein	tail	A0A222YXT1	Escherichia_phage	63.6	3.9e-126
AZZ35035.1|103572_103992_-	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	31.4	1.8e-06
>prophage 1
CP025578	Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_2, complete sequence	80272	0	64665	80272	transposase,integrase	Salmonella_phage(24.14%)	64	1329:1343	49328:49342
AZZ35154.1|455_1292_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AZZ35155.1|1291_2095_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
1329:1343	attL	GCAAGGCGTTCGCGG	NA	NA	NA	NA
AZZ35156.1|2155_2971_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AZZ35157.1|3300_3477_+|integrase	integrase	integrase	T1S9J3	Salmonella_phage	68.6	1.0e-06
AZZ35158.1|3658_4663_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZZ35159.1|4741_7708_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
AZZ35160.1|7710_8271_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	88.6	2.1e-50
AZZ35161.1|8401_8614_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AZZ35162.1|8668_9373_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
AZZ35237.1|9397_9910_+	restriction endonuclease	NA	NA	NA	NA	NA
AZZ35163.1|9914_10121_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ35164.1|10502_11936_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
AZZ35165.1|11969_13178_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AZZ35166.1|13190_13403_-	resolvase	NA	NA	NA	NA	NA
AZZ35167.1|13444_14209_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AZZ35168.1|14351_14618_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
AZZ35169.1|14838_15321_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	6.6e-16
AZZ35170.1|15467_16481_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AZZ35171.1|16419_16734_+|transposase	transposase	transposase	NA	NA	NA	NA
AZZ35172.1|16873_17443_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
AZZ35173.1|18199_19669_+	HNH endonuclease	NA	G0X580	Salmonella_phage	51.3	5.5e-21
AZZ35174.1|20188_20926_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ35175.1|21063_21750_-	NYN domain-containing protein	NA	NA	NA	NA	NA
AZZ35176.1|22330_23272_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ35177.1|23656_24361_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
AZZ35178.1|24306_24567_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ35179.1|25112_25499_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ35180.1|25507_25699_+	plasmid stabilization protein	NA	NA	NA	NA	NA
AZZ35181.1|26710_27466_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	4.5e-136
AZZ35182.1|27466_27661_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ35183.1|28144_28333_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ35184.1|28883_29219_-	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
AZZ35185.1|29391_29673_+	cytoplasmic protein	NA	NA	NA	NA	NA
AZZ35186.1|29726_30338_+	DUF2913 domain-containing protein	NA	NA	NA	NA	NA
AZZ35187.1|30486_31191_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZZ35188.1|32288_32540_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ35189.1|32697_33129_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
AZZ35190.1|33128_34400_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
AZZ35191.1|34481_35459_-	chromosome partitioning protein ParB	NA	Q38420	Escherichia_phage	54.4	2.6e-88
AZZ35192.1|35455_36661_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
AZZ35193.1|37075_37345_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ35194.1|37377_37575_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ35195.1|37701_38568_-	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
AZZ35196.1|39335_39593_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ35197.1|39650_40427_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
AZZ35198.1|40423_41167_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ35199.1|41217_41568_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ35200.1|42192_44001_-	ATP-binding protein	NA	NA	NA	NA	NA
AZZ35201.1|43997_45044_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ35202.1|46360_47542_+	DUF4268 domain-containing protein	NA	NA	NA	NA	NA
AZZ35203.1|48089_49094_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZZ35204.1|49172_52145_-|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
49328:49342	attR	GCAAGGCGTTCGCGG	NA	NA	NA	NA
AZZ35205.1|52219_52510_+	nucleotidyltransferase	NA	NA	NA	NA	NA
AZZ35206.1|52506_52908_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
AZZ35207.1|52897_53254_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AZZ35208.1|53508_53823_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ35209.1|54249_55431_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	64.2	1.9e-120
AZZ35210.1|56090_56696_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AZZ35211.1|56919_57780_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AZZ35212.1|57962_58520_-	recombinase	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
AZZ35213.1|59083_60346_+|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AZZ35214.1|60601_61477_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
AZZ35215.1|61523_61856_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AZZ35216.1|61872_64665_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.9	0.0e+00
