The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028841	Streptococcus pyogenes strain CCUG 4207 chromosome, complete genome	1914862	36609	48922	1914862		Synechococcus_phage(28.57%)	8	NA	NA
QAB33731.1|36609_40335_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	27.3	1.5e-38
QAB33732.1|40495_41950_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	2.8e-54
QAB33733.1|41977_43000_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	R9TMC7	Synechococcus_phage	42.1	1.1e-63
QAB33734.1|43167_43722_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.1	5.2e-25
QAB33735.1|43905_45453_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase PurH	NA	E3SNU8	Prochlorococcus_phage	51.3	8.3e-44
QAB33736.1|45510_46635_-	amidase	NA	F8HGP2	Streptococcus_phage	28.6	7.7e-07
QAB33737.1|46887_48153_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
QAB33738.1|48430_48922_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.3	3.2e-18
>prophage 2
CP028841	Streptococcus pyogenes strain CCUG 4207 chromosome, complete genome	1914862	336789	342823	1914862		Streptococcus_phage(100.0%)	9	NA	NA
QAB33997.1|336789_337425_+	thymidylate kinase	NA	M1PSC7	Streptococcus_phage	63.4	1.2e-65
QAB33998.1|337442_338318_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	43.8	7.7e-63
QAB33999.1|338336_338576_+	Tpl protein	NA	NA	NA	NA	NA
QAB34000.1|338980_339304_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	59.4	1.3e-28
QAB34001.1|339308_340172_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	74.7	6.5e-115
QAB34002.1|340198_340591_+	hypothetical protein	NA	NA	NA	NA	NA
QAB34003.1|340637_341267_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
QAB34004.1|341565_341922_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	65.8	6.3e-40
QAB34005.1|341995_342823_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	79.1	1.4e-127
>prophage 3
CP028841	Streptococcus pyogenes strain CCUG 4207 chromosome, complete genome	1914862	514861	569981	1914862	tail,terminase,capsid,head,protease,portal,tRNA	Streptococcus_phage(56.9%)	72	NA	NA
QAB35532.1|514861_515986_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
QAB34169.1|516054_517152_+	peptide chain release factor 2	NA	NA	NA	NA	NA
QAB34170.1|517171_517864_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	35.6	1.0e-30
QAB34171.1|517847_518786_+	ABC transporter permease	NA	NA	NA	NA	NA
QAB34172.1|519095_519794_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	62.4	1.1e-77
QAB34173.1|519961_520576_+	KR domain-containing protein	NA	NA	NA	NA	NA
QAB34174.1|520579_520726_+	acetoin dehydrogenase	NA	NA	NA	NA	NA
QAB34175.1|520833_523335_+	bifunctional DnaQ family exonuclease/ATP-dependent helicase	NA	A0A1X9I5C8	Streptococcus_phage	48.1	1.3e-203
QAB34176.1|523669_524863_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
QAB34177.1|524883_526230_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.8	1.1e-55
QAB34178.1|526643_527534_+	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.8	8.8e-06
QAB34179.1|527530_528508_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	74.2	2.1e-138
QAB34180.1|528504_529416_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	64.7	1.3e-105
QAB34181.1|529592_531008_-	recombinase family protein	NA	A5GZ62	Lactococcus_phage	47.2	7.9e-110
QAB34182.1|531131_531437_-	hypothetical protein	NA	NA	NA	NA	NA
QAB34183.1|531446_532211_-	XRE family transcriptional regulator	NA	E8ZDN4	Streptococcus_phage	64.5	2.0e-83
QAB34184.1|532570_532729_+	hypothetical protein	NA	J7KH24	Streptococcus_phage	88.5	7.1e-20
QAB34185.1|532827_533469_-	hypothetical protein	NA	J7KJ31	Streptococcus_phage	100.0	1.5e-116
QAB34186.1|533520_533709_+	XRE family transcriptional regulator	NA	A0A0B5A7F0	Streptococcus_phage	63.3	2.6e-13
QAB34187.1|533757_534519_+	phage repressor protein/antirepressor Ant	NA	A0A0C5AEJ9	Bacteriophage	61.5	3.6e-85
QAB34188.1|534659_534842_-	hypothetical protein	NA	NA	NA	NA	NA
QAB34189.1|534928_535066_+	hypothetical protein	NA	NA	NA	NA	NA
QAB34190.1|535067_535253_+	hypothetical protein	NA	Q938N3	Temperate_phage	83.6	2.0e-21
QAB34191.1|535352_535592_+	transcriptional regulator	NA	A0A060QMU7	Streptococcus_phage	51.4	3.0e-14
QAB34192.1|535735_536122_+	DnaD domain protein	NA	Q938N2	Temperate_phage	47.3	1.1e-24
QAB34193.1|536102_536336_+	hypothetical protein	NA	Q938N1	Temperate_phage	96.1	2.8e-36
QAB34194.1|536332_536473_+	hypothetical protein	NA	A0A1X9I6Y1	Streptococcus_phage	54.5	3.4e-05
QAB34195.1|536481_536688_+	hypothetical protein	NA	NA	NA	NA	NA
QAB34196.1|536743_537076_+	hypothetical protein	NA	J7KGX3	Streptococcus_phage	78.7	2.2e-42
QAB34197.1|537075_538065_+	recombinase RecT	NA	A0A286QMX3	Streptococcus_phage	44.2	5.8e-59
QAB34198.1|538061_538262_+	hypothetical protein	NA	NA	NA	NA	NA
QAB34199.1|538254_539052_+	hypothetical protein	NA	J7KGZ1	Streptococcus_phage	82.3	3.4e-126
QAB34200.1|539156_539570_+	hypothetical protein	NA	M1NS23	Streptococcus_phage	38.7	1.3e-12
QAB34201.1|539566_540079_+	hypothetical protein	NA	Q708P9	Streptococcus_phage	74.4	3.4e-63
QAB34202.1|540065_540260_+	hypothetical protein	NA	A3F626	Streptococcus_phage	86.5	9.7e-11
QAB34203.1|540256_540670_+	hypothetical protein	NA	Q938M1	Temperate_phage	65.2	4.9e-36
QAB34204.1|540666_540951_+	hypothetical protein	NA	A3F628	Streptococcus_phage	90.4	3.6e-38
QAB34205.1|540954_541182_+	hypothetical protein	NA	A0A1S5S8R7	Streptococcus_phage	47.8	6.2e-09
QAB34206.1|541361_541565_+	hypothetical protein	NA	NA	NA	NA	NA
QAB34207.1|541962_542598_+	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	66.5	2.0e-84
QAB34208.1|542870_543311_+	ArpU family transcriptional regulator	NA	Q938L8	Temperate_phage	100.0	5.0e-79
QAB34209.1|543865_544777_+	hypothetical protein	NA	A0A126HDT5	Lactococcus_phage	64.5	4.3e-101
QAB34210.1|544902_545280_-	HicB family protein	NA	I3NLB2	Bifidobacterium_phage	44.0	3.3e-15
QAB34211.1|545331_545517_-	addiction module toxin, HicA family	NA	D6PSW1	Lactobacillus_phage	54.0	1.7e-09
QAB34212.1|545752_546094_+	HNH endonuclease	NA	J7KH36	Streptococcus_phage	89.8	9.6e-54
QAB34213.1|546261_546729_+|terminase	phage terminase small subunit P27 family	terminase	J7KC46	Streptococcus_phage	98.7	3.9e-82
QAB34214.1|546731_546962_+	hypothetical protein	NA	NA	NA	NA	NA
QAB35533.1|546965_548720_+|terminase	terminase large subunit	terminase	J7KKD1	Streptococcus_phage	96.2	0.0e+00
QAB34215.1|548879_549104_+	hypothetical protein	NA	Q938K9	Temperate_phage	61.4	3.6e-17
QAB34216.1|549137_550358_+|portal	phage portal protein	portal	J7KDU3	Streptococcus_phage	81.9	6.9e-187
QAB34217.1|550335_551001_+|protease	Clp protease ClpP	protease	M1Q115	Streptococcus_phage	77.7	6.0e-92
QAB34218.1|551024_552209_+|capsid	phage major capsid protein	capsid	J7KJ82	Streptococcus_phage	76.3	2.3e-163
QAB34219.1|552353_552656_+	DNA packaging protein, QLRG family	NA	J7KC36	Streptococcus_phage	87.8	2.6e-42
QAB34220.1|552652_553000_+|head,tail	head-tail adaptor protein	head,tail	J7KJ42	Streptococcus_phage	84.5	2.1e-48
QAB34221.1|552996_553374_+	hypothetical protein	NA	J7KDM3	Streptococcus_phage	73.6	1.8e-45
QAB34222.1|553370_553796_+	hypothetical protein	NA	J7KBZ9	Streptococcus_phage	85.1	5.0e-68
QAB35534.1|553812_554421_+|tail	phage tail protein	tail	J7KKC8	Streptococcus_phage	70.5	2.3e-74
QAB34223.1|554473_554800_+	hypothetical protein	NA	J7KK85	Streptococcus_phage	73.1	6.0e-37
QAB34224.1|555009_558933_+|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	48.8	1.0e-239
QAB34225.1|558932_559640_+|tail	phage tail protein	tail	Q938K2	Temperate_phage	71.1	1.7e-92
QAB34226.1|559636_561781_+	peptidase	NA	Q938K1	Temperate_phage	98.3	0.0e+00
QAB34227.1|561777_562797_+	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	95.8	8.3e-178
QAB34228.1|562809_564696_+	hyaluronidase	NA	Q938J9	Temperate_phage	82.6	2.6e-209
QAB34229.1|564707_565136_+	DUF1617 domain-containing protein	NA	Q938J8	Temperate_phage	78.6	1.9e-54
QAB34230.1|565138_565756_+	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	87.8	1.0e-77
QAB34231.1|565766_566066_+	hypothetical protein	NA	Q938J6	Temperate_phage	93.8	1.9e-42
QAB34232.1|566062_566248_+	hypothetical protein	NA	Q938J5	Temperate_phage	98.4	6.6e-25
QAB34233.1|566360_567563_+	CHAP domain-containing protein	NA	Q938J4	Temperate_phage	94.8	2.7e-228
QAB34234.1|567702_568227_+	DUF4065 domain-containing protein	NA	Q938J3	Temperate_phage	100.0	4.0e-99
QAB34235.1|568214_569081_+	DUF334 domain-containing protein	NA	Q938J2	Temperate_phage	100.0	3.7e-134
QAB34236.1|569149_569506_-	hypothetical protein	NA	NA	NA	NA	NA
QAB34237.1|569507_569981_-	hypothetical protein	NA	A3F671	Streptococcus_phage	92.3	1.6e-78
>prophage 4
CP028841	Streptococcus pyogenes strain CCUG 4207 chromosome, complete genome	1914862	663085	673688	1914862		Streptococcus_phage(57.14%)	9	NA	NA
QAB34310.1|663085_665296_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	68.9	6.5e-268
QAB34311.1|665403_666567_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	65.1	3.4e-143
QAB34312.1|666563_667250_+	3-dehydroquinase	NA	W6LP76	Streptococcus_phage	68.9	7.0e-88
QAB34313.1|667343_668510_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	34.4	1.8e-38
QAB34314.1|668570_668912_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	41.1	5.9e-19
QAB34315.1|669132_670485_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.0	4.5e-30
QAB34316.1|670572_671841_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
QAB34317.1|671870_672311_-	hypothetical protein	NA	NA	NA	NA	NA
QAB34318.1|672545_673688_+	cysteine desulfurase	NA	H7BUW1	unidentified_phage	31.7	7.8e-15
>prophage 5
CP028841	Streptococcus pyogenes strain CCUG 4207 chromosome, complete genome	1914862	818559	877783	1914862	integrase,tail,holin,terminase,capsid,head,protease,portal,tRNA	Streptococcus_phage(89.13%)	75	812069:812088	856833:856852
812069:812088	attL	GCTATGCTGTTTTGAATGGT	NA	NA	NA	NA
QAB34451.1|818559_819756_-|integrase	site-specific integrase	integrase	A3F610	Streptococcus_phage	96.7	1.5e-223
QAB34452.1|820151_820907_-	XRE family transcriptional regulator	NA	M1NS52	Streptococcus_phage	64.4	4.3e-78
QAB34453.1|821386_821968_+	hypothetical protein	NA	NA	NA	NA	NA
QAB35544.1|822206_822434_+	pathogenicity island protein	NA	A0A141E1R7	Streptococcus_phage	57.3	1.2e-12
QAB34454.1|822476_823196_+	hypothetical protein	NA	A3F617	Streptococcus_phage	79.5	1.6e-106
QAB34455.1|823270_823483_+	hypothetical protein	NA	NA	NA	NA	NA
QAB34456.1|823479_823686_-	hypothetical protein	NA	NA	NA	NA	NA
QAB34457.1|823942_824200_+	hypothetical protein	NA	A3F618	Streptococcus_phage	95.3	7.0e-41
QAB34458.1|824354_824543_+	hypothetical protein	NA	NA	NA	NA	NA
QAB34459.1|824529_825876_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	84.0	2.3e-207
QAB34460.1|825862_826609_+	DNA replication protein	NA	A0A1P8VVR3	Streptococcus_phage	97.2	3.7e-135
QAB34461.1|826609_827431_+	ATP-binding protein	NA	A0A1P8VVV9	Streptococcus_phage	94.9	1.2e-147
QAB34462.1|827430_827661_+	hypothetical protein	NA	C5J991	Streptococcus_phage	52.8	1.0e-14
QAB34463.1|827653_827836_+	hypothetical protein	NA	NA	NA	NA	NA
QAB34464.1|827822_828314_+	hypothetical protein	NA	A0A1P8VVP1	Streptococcus_phage	79.8	1.2e-70
QAB34465.1|828310_828616_+	DUF1372 domain-containing protein	NA	A0A1X9I624	Streptococcus_phage	51.5	6.0e-23
QAB35545.1|828738_828978_+	DUF3310 domain-containing protein	NA	A3F631	Streptococcus_phage	94.8	2.6e-37
QAB34466.1|828970_829303_+	hypothetical protein	NA	A0A1S5SCX1	Streptococcus_phage	54.6	5.9e-32
QAB34467.1|829295_829517_+	hypothetical protein	NA	NA	NA	NA	NA
QAB34468.1|829513_829906_+	single-stranded DNA-binding protein	NA	A0A1P8VVS8	Streptococcus_phage	71.7	5.3e-48
QAB34469.1|829919_830198_+	hypothetical protein	NA	A3F632	Streptococcus_phage	96.7	9.6e-44
QAB34470.1|830194_830539_+	XRE family transcriptional regulator	NA	A3F633	Streptococcus_phage	95.0	1.4e-49
QAB34471.1|830541_830943_+	transcriptional regulator	NA	A3F635	Streptococcus_phage	93.2	3.4e-66
QAB34472.1|831100_831676_+|integrase	site-specific integrase	integrase	A3F636	Streptococcus_phage	94.8	2.7e-101
QAB34473.1|831830_832127_+	hypothetical protein	NA	NA	NA	NA	NA
QAB34474.1|832150_832396_+	hypothetical protein	NA	NA	NA	NA	NA
QAB34475.1|832408_832612_+	hypothetical protein	NA	NA	NA	NA	NA
QAB35547.1|832637_833024_+	hypothetical protein	NA	A3F638	Streptococcus_phage	93.0	3.6e-65
QAB35546.1|833049_833322_+	HNH endonuclease	NA	A3F639	Streptococcus_phage	96.7	4.8e-48
QAB34476.1|833464_833782_+|terminase	terminase	terminase	A3F640	Streptococcus_phage	99.0	1.3e-49
QAB34477.1|833794_835525_+|terminase	terminase large subunit	terminase	A3F641	Streptococcus_phage	97.4	0.0e+00
QAB34478.1|835705_836893_+|portal	phage portal protein	portal	A3F643	Streptococcus_phage	97.5	2.1e-220
QAB34479.1|836873_837680_+|protease	Clp protease ClpP	protease	A3F644	Streptococcus_phage	97.8	3.9e-146
QAB34480.1|837696_838830_+|capsid	phage major capsid protein	capsid	A3F645	Streptococcus_phage	96.0	1.3e-200
QAB34481.1|839013_839322_+	hypothetical protein	NA	A3F647	Streptococcus_phage	92.2	1.4e-43
QAB34482.1|839314_839677_+|head,tail	phage head-tail adapter protein	head,tail	A3F648	Streptococcus_phage	95.8	1.6e-59
QAB34483.1|839678_840077_+	hypothetical protein	NA	A3F649	Streptococcus_phage	100.0	2.9e-70
QAB34484.1|840069_840450_+	hypothetical protein	NA	A3F650	Streptococcus_phage	97.6	8.2e-62
QAB34485.1|840461_841046_+|tail	phage tail protein	tail	A3F651	Streptococcus_phage	90.2	6.2e-93
QAB34486.1|841141_841444_+	hypothetical protein	NA	A3F652	Streptococcus_phage	96.0	2.4e-48
QAB34487.1|841668_845769_+|tail	phage tail tape measure protein	tail	A3F654	Streptococcus_phage	76.5	0.0e+00
QAB34488.1|845781_846552_+|tail	phage tail protein	tail	A3F655	Streptococcus_phage	87.9	1.4e-129
QAB34489.1|846548_848600_+	hypothetical protein	NA	A3F656	Streptococcus_phage	85.2	0.0e+00
QAB34490.1|848596_849604_+	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	64.9	9.9e-115
QAB34491.1|849613_851518_+	hyaluronidase	NA	Q938J9	Temperate_phage	83.7	1.1e-210
QAB34492.1|851529_851958_+	DUF1617 domain-containing protein	NA	Q938J8	Temperate_phage	84.3	8.1e-58
QAB34493.1|851960_852599_+	hypothetical protein	NA	A3F662	Streptococcus_phage	52.7	2.0e-44
QAB34494.1|852610_852883_+	hypothetical protein	NA	A7J2B2	Streptococcus_phage	91.0	5.5e-36
QAB34495.1|852879_853107_+|holin	phage holin	holin	A7J2B3	Streptococcus_phage	97.3	2.2e-30
QAB34496.1|853229_854435_+	CHAP domain-containing protein	NA	A7J2B5	Streptococcus_phage	82.0	5.0e-198
QAB34497.1|854550_854907_-	hypothetical protein	NA	NA	NA	NA	NA
QAB34498.1|854964_855204_-	hypothetical protein	NA	NA	NA	NA	NA
QAB34499.1|855467_855719_-	hypothetical protein	NA	A3F666	Streptococcus_phage	96.4	2.8e-42
QAB34500.1|856159_856369_+	XRE family transcriptional regulator	NA	A3F668	Streptococcus_phage	100.0	1.2e-30
QAB34501.1|856567_856750_+	Paratox	NA	A3F673	Streptococcus_phage	71.7	1.0e-17
QAB35548.1|856990_857170_+	nucleoside-diphosphate kinase	NA	NA	NA	NA	NA
856833:856852	attR	GCTATGCTGTTTTGAATGGT	NA	NA	NA	NA
QAB34502.1|857233_857380_+	nucleoside-diphosphate kinase	NA	NA	NA	NA	NA
QAB34503.1|857503_859336_+	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	41.0	2.2e-19
QAB34504.1|859593_860412_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
QAB34505.1|860597_861035_+	peptide-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
QAB34506.1|861149_862169_+	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
QAB34507.1|862375_862801_+	PTS mannose transporter subunit IIA	NA	NA	NA	NA	NA
QAB34508.1|862819_863311_+	PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB	NA	NA	NA	NA	NA
QAB34509.1|863327_864137_+	PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC	NA	NA	NA	NA	NA
QAB34510.1|864133_864961_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
QAB34511.1|865096_866746_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.3	8.0e-13
QAB34512.1|866749_867538_+	DNA-binding response regulator	NA	NA	NA	NA	NA
QAB34513.1|867531_868578_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
QAB34514.1|869356_869923_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
QAB34515.1|869926_870628_+	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
QAB34516.1|870722_872120_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
QAB34517.1|872221_874018_+	excinuclease ABC subunit C	NA	NA	NA	NA	NA
QAB34518.1|874202_874805_+	nitroreductase family protein	NA	NA	NA	NA	NA
QAB34519.1|874929_876339_+	dipeptidase PepV	NA	NA	NA	NA	NA
QAB34520.1|876406_877783_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
>prophage 6
CP028841	Streptococcus pyogenes strain CCUG 4207 chromosome, complete genome	1914862	1027428	1103152	1914862	integrase,tail,holin,terminase,capsid,head,portal,tRNA	Streptococcus_pyogenes_phage(66.15%)	92	1060780:1060839	1099691:1099786
QAB34667.1|1027428_1028313_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
QAB34668.1|1028428_1029769_-	DUF2130 domain-containing protein	NA	NA	NA	NA	NA
QAB34669.1|1029865_1030822_-	aromatic acid exporter family protein	NA	NA	NA	NA	NA
QAB34670.1|1030832_1031429_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
QAB34671.1|1031520_1034157_-	peptide ABC transporter permease	NA	NA	NA	NA	NA
QAB34672.1|1034171_1034873_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.8	8.3e-36
QAB34673.1|1034990_1035533_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
QAB34674.1|1035675_1036317_-	transcriptional regulator	NA	NA	NA	NA	NA
QAB34675.1|1036479_1036971_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
QAB34676.1|1036978_1037179_-	CsbD family protein	NA	J7KJ36	Streptococcus_phage	50.0	1.8e-07
QAB34677.1|1037219_1037759_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
QAB34678.1|1037771_1037960_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
QAB34679.1|1037970_1038582_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
QAB34680.1|1038618_1038867_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
QAB34681.1|1039230_1041549_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.2	3.5e-131
QAB34682.1|1042077_1043400_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
QAB34683.1|1043519_1044755_+	cation efflux system protein	NA	NA	NA	NA	NA
QAB34684.1|1045123_1045897_-	hypothetical protein	NA	NA	NA	NA	NA
QAB34685.1|1046266_1047103_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
QAB34686.1|1047118_1047748_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.5	1.3e-27
QAB34687.1|1047757_1048399_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
QAB34688.1|1048504_1048840_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
QAB34689.1|1049035_1050850_-	glutamine--fructose-6-phosphate aminotransferase	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	38.6	2.6e-97
QAB34690.1|1051025_1051583_-	signal peptidase I	NA	NA	NA	NA	NA
QAB34691.1|1051800_1053303_-	pyruvate kinase	NA	NA	NA	NA	NA
QAB34692.1|1053365_1054379_-	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
QAB34693.1|1054458_1057569_-	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	29.9	3.7e-120
QAB34694.1|1057753_1058125_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
QAB34695.1|1058124_1058823_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.3	6.6e-09
QAB34696.1|1058832_1059618_+	ABC transporter permease	NA	NA	NA	NA	NA
QAB34697.1|1059744_1060359_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	52.3	1.1e-50
1060780:1060839	attL	ACTCCCACCAGCTCCATCAATGCTTACCGTAAGTAATCATAACTTACTAAAACCTTGTTA	NA	NA	NA	NA
QAB34698.1|1060949_1061138_-	Paratox	NA	J7KIW4	Streptococcus_phage	82.3	3.4e-21
QAB34699.1|1061358_1062114_+	exotoxin type A	NA	A0A097PAT7	Streptococcus_pyogenes_phage	100.0	2.2e-143
QAB34700.1|1062235_1062895_-	hypothetical protein	NA	A0A097PBF7	Streptococcus_pyogenes_phage	100.0	8.5e-123
QAB34701.1|1062894_1063116_-	hypothetical protein	NA	A0A097PAX7	Streptococcus_pyogenes_phage	84.5	2.5e-18
QAB34702.1|1063125_1063899_-	hypothetical protein	NA	A0A097PAV0	Streptococcus_pyogenes_phage	100.0	3.9e-135
QAB34703.1|1063909_1064512_-	hypothetical protein	NA	A0A097PAX9	Streptococcus_pyogenes_phage	98.8	7.8e-91
QAB34704.1|1064523_1065288_-	CHAP domain-containing protein	NA	A0A097PAT3	Streptococcus_pyogenes_phage	98.4	8.0e-149
QAB34705.1|1065289_1065622_-|holin	phage holin	holin	A0A097PBF6	Streptococcus_pyogenes_phage	99.1	7.4e-51
QAB34706.1|1065621_1065945_-	hypothetical protein	NA	A0A097PAX2	Streptococcus_pyogenes_phage	100.0	7.7e-53
QAB34707.1|1066094_1066442_-	DUF1366 domain-containing protein	NA	A0A097PAX5	Streptococcus_pyogenes_phage	99.1	6.5e-58
QAB34708.1|1066452_1068315_-	hypothetical protein	NA	A0A097PAT0	Streptococcus_pyogenes_phage	99.4	0.0e+00
QAB34709.1|1068319_1071760_-	CHAP domain-containing protein	NA	A0A097PBF5	Streptococcus_pyogenes_phage	98.7	0.0e+00
QAB34710.1|1071760_1073245_-|tail	phage tail protein	tail	A0A097PAW9	Streptococcus_pyogenes_phage	99.8	4.3e-292
QAB34711.1|1073245_1075051_-|tail	phage tail protein	tail	A0A097PAU2	Streptococcus_pyogenes_phage	99.7	8.8e-263
QAB34712.1|1075043_1075502_-	hypothetical protein	NA	A0A097PAX1	Streptococcus_pyogenes_phage	100.0	2.3e-82
QAB34713.1|1075474_1075792_-	hypothetical protein	NA	A0A097PAS6	Streptococcus_pyogenes_phage	100.0	4.9e-52
QAB34714.1|1075804_1076311_-|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	100.0	2.6e-79
QAB34715.1|1076322_1076733_-	DUF5072 domain-containing protein	NA	A0A097PAW5	Streptococcus_pyogenes_phage	100.0	1.4e-70
QAB34716.1|1076734_1077130_-	hypothetical protein	NA	A0A097PAT9	Streptococcus_pyogenes_phage	100.0	1.8e-59
QAB34717.1|1077126_1077438_-	hypothetical protein	NA	A0A097PAW7	Streptococcus_pyogenes_phage	98.1	1.0e-49
QAB34718.1|1077434_1077773_-	hypothetical protein	NA	A0A097PAS2	Streptococcus_pyogenes_phage	98.2	5.2e-52
QAB34719.1|1077786_1078080_-	hypothetical protein	NA	A0A097PBF3	Streptococcus_pyogenes_phage	100.0	2.0e-47
QAB34720.1|1078092_1078983_-|capsid	phage capsid protein	capsid	A0A097PAW2	Streptococcus_pyogenes_phage	99.4	8.6e-86
QAB34721.1|1079001_1079571_-	DUF4355 domain-containing protein	NA	A0A097PAW3	Streptococcus_pyogenes_phage	98.4	8.5e-71
QAB34722.1|1079815_1080085_-	hypothetical protein	NA	Q938K9	Temperate_phage	85.2	5.6e-33
QAB34723.1|1080091_1081000_-|head	phage head morphogenesis protein	head	A0A097PBF2	Streptococcus_pyogenes_phage	98.2	6.7e-86
QAB34724.1|1080968_1082294_-|portal	phage portal protein	portal	A0A097PAT2	Streptococcus_pyogenes_phage	97.2	2.1e-237
QAB34725.1|1082293_1083568_-|terminase	PBSX family phage terminase large subunit	terminase	A0A097PAV9	Streptococcus_pyogenes_phage	100.0	1.1e-251
QAB34726.1|1083557_1083938_-	hypothetical protein	NA	A0A097PAR5	Streptococcus_pyogenes_phage	100.0	1.0e-64
QAB34727.1|1084547_1084982_-	ArpU family transcriptional regulator	NA	J7KDQ1	Streptococcus_phage	94.4	2.2e-71
QAB34728.1|1085267_1085534_-	hypothetical protein	NA	NA	NA	NA	NA
QAB34729.1|1085530_1086055_-	DUF1642 domain-containing protein	NA	J7KK91	Streptococcus_phage	51.1	2.3e-38
QAB34730.1|1086057_1086690_-	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	68.6	2.3e-85
QAB34731.1|1086691_1086976_-	hypothetical protein	NA	A0A097PAV1	Streptococcus_pyogenes_phage	87.2	8.9e-37
QAB34732.1|1087139_1087376_-	DUF3310 domain-containing protein	NA	A0A097PAQ7	Streptococcus_pyogenes_phage	100.0	2.4e-40
QAB34733.1|1087375_1087621_-	hypothetical protein	NA	A0A097PBE9	Streptococcus_pyogenes_phage	100.0	1.8e-41
QAB34734.1|1087617_1087974_-	hypothetical protein	NA	A0A097PAU4	Streptococcus_pyogenes_phage	100.0	2.9e-61
QAB34735.1|1087970_1088411_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A097PAS0	Streptococcus_pyogenes_phage	97.9	4.5e-80
QAB34736.1|1088410_1088614_-	hypothetical protein	NA	Q938M6	Temperate_phage	100.0	4.7e-32
QAB34737.1|1088619_1089045_-	single-stranded DNA-binding protein	NA	A0A097PAQ3	Streptococcus_pyogenes_phage	82.3	2.8e-55
QAB34738.1|1089037_1089712_-	single-stranded DNA-binding protein	NA	Q938M8	Temperate_phage	97.3	1.5e-103
QAB34739.1|1089712_1090195_-	hypothetical protein	NA	Q938M9	Temperate_phage	100.0	8.2e-51
QAB34740.1|1090216_1090471_-	hypothetical protein	NA	Q938N0	Temperate_phage	98.8	3.7e-42
QAB34741.1|1090451_1090805_-	hypothetical protein	NA	A0A097PAU3	Streptococcus_pyogenes_phage	54.0	2.8e-16
QAB34742.1|1090945_1091728_-	DNA replication protein	NA	A0A097PAQ0	Streptococcus_pyogenes_phage	96.9	3.9e-143
QAB34743.1|1091714_1092545_-	DnaD domain protein	NA	A0A1S5S918	Streptococcus_phage	54.7	6.4e-67
QAB34744.1|1092558_1092873_-	XRE family transcriptional regulator	NA	A0A1P8VVN6	Streptococcus_phage	95.2	2.7e-50
QAB34745.1|1093019_1093316_-	hypothetical protein	NA	A0A097PAT8	Streptococcus_pyogenes_phage	100.0	2.1e-49
QAB34746.1|1093352_1093616_-	hypothetical protein	NA	A0A097PAP6	Streptococcus_pyogenes_phage	98.9	3.6e-40
QAB34747.1|1093670_1094180_+	hypothetical protein	NA	NA	NA	NA	NA
QAB34748.1|1094310_1094520_+	hypothetical protein	NA	NA	NA	NA	NA
QAB34749.1|1094629_1094830_-	XRE family transcriptional regulator	NA	A0A141E205	Streptococcus_phage	59.6	2.7e-08
QAB34750.1|1094903_1095290_+	hypothetical protein	NA	A0A097PAT1	Streptococcus_pyogenes_phage	100.0	1.2e-65
QAB34751.1|1095278_1095488_-	hypothetical protein	NA	A0A097PAQ9	Streptococcus_pyogenes_phage	100.0	1.7e-32
QAB34752.1|1095541_1096141_+	hypothetical protein	NA	A0A097PAT4	Streptococcus_pyogenes_phage	100.0	3.1e-108
QAB34753.1|1096170_1096329_-	hypothetical protein	NA	A0A097PAP2	Streptococcus_pyogenes_phage	100.0	4.8e-24
QAB34754.1|1096685_1097510_+	XRE family transcriptional regulator	NA	A0A097PBE5	Streptococcus_pyogenes_phage	91.6	1.2e-131
QAB34755.1|1097545_1098439_+	hypothetical protein	NA	A0A1I9LJQ0	Stx_converting_phage	47.5	1.2e-68
QAB34756.1|1098559_1099648_+|integrase	site-specific integrase	integrase	A0A097PAS9	Streptococcus_pyogenes_phage	99.2	4.7e-203
QAB34757.1|1100010_1100631_+	DUF3862 domain-containing protein	NA	NA	NA	NA	NA
1099691:1099786	attR	ACTCCCACCAGCTCCATCAATGCTTACCGTAAGTAATCATAACTTACTAAAACCTTGTTACATCAAGGTTTTTTCTTTTTGTCTTGTTCATGAGTT	NA	NA	NA	NA
QAB34758.1|1100887_1103152_-	glycogen/starch/alpha-glucan family phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	43.7	1.2e-11
>prophage 7
CP028841	Streptococcus pyogenes strain CCUG 4207 chromosome, complete genome	1914862	1221252	1259402	1914862	integrase,tail,holin,terminase,capsid	Streptococcus_phage(71.74%)	55	1223457:1223476	1256787:1256806
QAB34860.1|1221252_1223115_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.7	4.6e-89
1223457:1223476	attL	AATTATTTAACAGCGTCTTT	NA	NA	NA	NA
QAB34861.1|1223645_1223828_-	Paratox	NA	A3F673	Streptococcus_phage	80.0	1.7e-20
QAB34862.1|1224050_1224857_+	deoxyribonuclease	NA	NA	NA	NA	NA
QAB34863.1|1225076_1225562_+	hypothetical protein	NA	NA	NA	NA	NA
QAB34864.1|1225631_1226837_-	CHAP domain-containing protein	NA	Q938J4	Temperate_phage	84.3	5.9e-207
QAB34865.1|1226952_1227180_-|holin	phage holin	holin	A7J2B3	Streptococcus_phage	100.0	2.0e-31
QAB34866.1|1227176_1227452_-	hypothetical protein	NA	A7J2B2	Streptococcus_phage	100.0	2.6e-41
QAB34867.1|1227461_1228079_-	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	88.8	1.0e-77
QAB34868.1|1228081_1228513_-	DUF1617 domain-containing protein	NA	Q938J8	Temperate_phage	97.9	3.8e-71
QAB34869.1|1228524_1230309_-	hypothetical protein	NA	Q938J9	Temperate_phage	47.5	6.3e-96
QAB34870.1|1230323_1231325_-	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	71.6	2.3e-127
QAB34871.1|1231324_1233283_-	peptidase	NA	M1PKG3	Streptococcus_phage	49.2	5.3e-96
QAB34872.1|1233279_1233975_-	hypothetical protein	NA	A0A1B1P761	Bacillus_phage	29.6	7.6e-05
QAB34873.1|1233971_1236329_-	hypothetical protein	NA	M1NRG5	Streptococcus_phage	50.6	6.5e-141
QAB34874.1|1236328_1236700_-	hypothetical protein	NA	M1PL84	Streptococcus_phage	62.4	2.9e-35
QAB34875.1|1236714_1236978_-	hypothetical protein	NA	A0A0B5A2F3	Streptococcus_phage	55.8	1.0e-18
QAB34876.1|1236988_1237582_-|tail	phage tail protein	tail	M1PKG8	Streptococcus_phage	62.5	3.5e-59
QAB34877.1|1237593_1237929_-	hypothetical protein	NA	A0A1P8BMR5	Lactococcus_phage	64.9	9.8e-35
QAB34878.1|1237929_1238166_-	hypothetical protein	NA	A0A0B5A7G2	Streptococcus_phage	71.4	2.5e-21
QAB34879.1|1238158_1238497_-	hypothetical protein	NA	M1PFF8	Streptococcus_phage	70.3	2.2e-42
QAB34880.1|1238456_1238879_-	hypothetical protein	NA	A0A0B5A2F6	Streptococcus_phage	70.8	3.7e-47
QAB34881.1|1238888_1239089_-	hypothetical protein	NA	NA	NA	NA	NA
QAB34882.1|1239088_1240000_-|capsid	phage major capsid protein	capsid	M1PFL0	Streptococcus_phage	67.3	9.9e-114
QAB34883.1|1240024_1240486_-	DUF4355 domain-containing protein	NA	M1Q1L0	Streptococcus_phage	53.2	4.5e-38
QAB34884.1|1240566_1241982_-|terminase	terminase	terminase	A0A0B5A091	Streptococcus_phage	74.2	2.9e-213
QAB34885.1|1242091_1242358_-	hypothetical protein	NA	A0A097PAR8	Streptococcus_pyogenes_phage	86.4	7.3e-33
QAB34886.1|1242350_1242611_-	hypothetical protein	NA	NA	NA	NA	NA
QAB34887.1|1242579_1242804_-	hypothetical protein	NA	NA	NA	NA	NA
QAB34888.1|1242809_1244303_-	hypothetical protein	NA	M1Q184	Streptococcus_phage	55.0	2.0e-87
QAB34889.1|1244295_1245564_-	hypothetical protein	NA	M1PFL4	Streptococcus_phage	75.6	2.2e-188
QAB34890.1|1245560_1245917_-	hypothetical protein	NA	M1PRL3	Streptococcus_phage	57.8	2.4e-07
QAB34891.1|1246065_1246410_-	HNH endonuclease	NA	M1Q0W7	Streptococcus_phage	68.5	5.5e-41
QAB34892.1|1246518_1246938_-	DUF1492 domain-containing protein	NA	A0A1X9I5B5	Streptococcus_phage	79.9	8.7e-57
QAB34893.1|1247205_1247841_-	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	69.4	2.0e-89
QAB34894.1|1247842_1248112_-	hypothetical protein	NA	A7J287	Streptococcus_phage	71.9	9.6e-25
QAB34895.1|1248195_1248708_-	hypothetical protein	NA	Q708P9	Streptococcus_phage	78.0	2.3e-67
QAB34896.1|1248704_1249118_-	hypothetical protein	NA	M1NS23	Streptococcus_phage	38.7	1.3e-12
QAB34897.1|1249400_1250198_-	hypothetical protein	NA	J7KGZ1	Streptococcus_phage	84.5	6.0e-131
QAB34898.1|1250194_1251124_-	recombinase RecT	NA	M1NRN6	Streptococcus_phage	72.2	1.1e-91
QAB34899.1|1251126_1251456_-	hypothetical protein	NA	J7KGX3	Streptococcus_phage	83.5	2.1e-45
QAB34900.1|1251511_1251718_-	hypothetical protein	NA	NA	NA	NA	NA
QAB34901.1|1251726_1251867_-	hypothetical protein	NA	NA	NA	NA	NA
QAB34902.1|1251863_1252097_-	hypothetical protein	NA	Q938N1	Temperate_phage	94.8	6.1e-36
QAB34903.1|1252077_1252464_-	DnaD domain protein	NA	Q938N2	Temperate_phage	51.9	8.1e-25
QAB34904.1|1252604_1252859_-	transcriptional regulator	NA	A0A1S5S9Z1	Streptococcus_phage	41.3	7.7e-08
QAB34905.1|1252967_1253153_-	hypothetical protein	NA	Q938N3	Temperate_phage	83.6	1.3e-20
QAB34906.1|1253154_1253466_-	excisionase	NA	A0A1S5SA25	Streptococcus_phage	77.7	5.3e-43
QAB34907.1|1253735_1253948_-	XRE family transcriptional regulator	NA	A0A1X9I583	Streptococcus_phage	56.7	1.1e-10
QAB34908.1|1254148_1254904_+	XRE family transcriptional regulator	NA	A0A1S5S8S8	Streptococcus_phage	60.8	2.8e-77
QAB34909.1|1254915_1255434_+	restriction endonuclease	NA	E8ZDN5	Streptococcus_phage	45.9	9.2e-32
QAB34910.1|1255557_1256700_+|integrase	site-specific integrase	integrase	M1NRJ9	Streptococcus_phage	77.4	2.4e-173
QAB34911.1|1256788_1257064_-	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	73.0	2.6e-25
1256787:1256806	attR	AATTATTTAACAGCGTCTTT	NA	NA	NA	NA
QAB34912.1|1257162_1257750_-	DUF2140 domain-containing protein	NA	NA	NA	NA	NA
QAB34913.1|1257727_1258588_-	GDSL family lipase	NA	NA	NA	NA	NA
QAB35555.1|1258562_1259402_-	EDD domain protein	NA	A0A0N9SI50	Staphylococcus_phage	35.7	7.0e-13
>prophage 8
CP028841	Streptococcus pyogenes strain CCUG 4207 chromosome, complete genome	1914862	1326258	1402151	1914862	integrase,tail,holin,terminase,capsid,tRNA	Temperate_phage(50.0%)	82	1389575:1389592	1416756:1416773
QAB34976.1|1326258_1328907_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.5	1.1e-149
QAB34977.1|1328908_1329472_-	shikimate kinase	NA	NA	NA	NA	NA
QAB34978.1|1329468_1329669_-	N-acetyltransferase	NA	NA	NA	NA	NA
QAB34979.1|1330072_1330468_-	hypothetical protein	NA	NA	NA	NA	NA
QAB34980.1|1330485_1330740_-	DUF1912 domain-containing protein	NA	NA	NA	NA	NA
QAB34981.1|1331218_1331971_+	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
QAB34982.1|1332026_1333100_+	3-dehydroquinate synthase	NA	E5ERI4	Ostreococcus_lucimarinus_virus	31.6	7.3e-31
QAB34983.1|1333534_1333840_-	cupin domain-containing protein	NA	NA	NA	NA	NA
QAB34984.1|1333841_1334180_-	cupin domain-containing protein	NA	NA	NA	NA	NA
QAB34985.1|1334232_1334988_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
QAB34986.1|1335222_1336101_-	shikimate dehydrogenase (NADP+)	NA	NA	NA	NA	NA
QAB34987.1|1336238_1339745_-	glycoside hydrolase family 2 protein	NA	NA	NA	NA	NA
QAB34988.1|1339674_1341159_-	DNA-binding response regulator	NA	NA	NA	NA	NA
QAB34989.1|1341158_1342883_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	24.9	5.8e-14
QAB34990.1|1342872_1343478_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
QAB34991.1|1343783_1345229_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
QAB34992.1|1345309_1346236_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
QAB34993.1|1346245_1347196_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
QAB34994.1|1347346_1348270_+	ROK family protein	NA	NA	NA	NA	NA
QAB34995.1|1348880_1350323_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
QAB34996.1|1350346_1352041_-	hyaluronidase	NA	NA	NA	NA	NA
QAB34997.1|1352091_1353132_-	transcriptional regulator	NA	NA	NA	NA	NA
QAB34998.1|1353237_1354551_+	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
QAB34999.1|1354565_1357271_+	alpha-mannosidase	NA	NA	NA	NA	NA
QAB35000.1|1357371_1358727_-	sensor histidine kinase	NA	NA	NA	NA	NA
QAB35001.1|1359391_1360747_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	32.7	1.7e-72
QAB35002.1|1360937_1361120_-	Paratox	NA	A3F673	Streptococcus_phage	83.3	4.4e-21
QAB35003.1|1361351_1362158_+	deoxyribonuclease	NA	NA	NA	NA	NA
QAB35004.1|1362430_1362865_+	hypothetical protein	NA	NA	NA	NA	NA
QAB35005.1|1363768_1364293_-	DUF4065 domain-containing protein	NA	Q938J3	Temperate_phage	100.0	4.0e-99
QAB35006.1|1364432_1365638_-	CHAP domain-containing protein	NA	Q938J4	Temperate_phage	83.5	1.8e-203
QAB35007.1|1365749_1366205_-|holin	holin	holin	A0A0M4R3G6	Streptococcus_phage	81.5	2.3e-63
QAB35008.1|1366214_1366847_-	hypothetical protein	NA	Q938J7	Temperate_phage	48.6	3.2e-42
QAB35009.1|1366849_1367281_-	DUF1617 domain-containing protein	NA	Q938J8	Temperate_phage	89.5	1.3e-63
QAB35010.1|1367292_1369179_-	hyaluronidase	NA	Q938J9	Temperate_phage	84.6	2.0e-217
QAB35011.1|1369191_1370202_-	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	75.8	7.8e-136
QAB35012.1|1370198_1372343_-	peptidase	NA	Q938K1	Temperate_phage	95.1	0.0e+00
QAB35013.1|1372339_1373056_-|tail	phage tail protein	tail	Q938K2	Temperate_phage	99.2	1.2e-135
QAB35014.1|1373052_1376313_-	tape measure domain-containing protein	NA	Q938K3	Temperate_phage	99.1	0.0e+00
QAB35015.1|1376302_1376884_-	hypothetical protein	NA	Q938K4	Temperate_phage	94.3	1.0e-100
QAB35016.1|1376887_1377322_-	hypothetical protein	NA	Q938K5	Temperate_phage	97.9	4.2e-70
QAB35017.1|1377365_1377827_-|tail	phage tail protein	tail	Q938K6	Temperate_phage	78.8	1.9e-60
QAB35018.1|1377826_1378225_-|capsid	capsid protein	capsid	Q79S87	Temperate_phage	98.5	6.5e-70
QAB35019.1|1378221_1378578_-|capsid	capsid protein	capsid	Q79S88	Temperate_phage	100.0	4.5e-62
QAB35020.1|1378577_1378910_-|capsid	minor capsid protein	capsid	Q79S86	Temperate_phage	99.1	6.2e-58
QAB35021.1|1378899_1379316_-	hypothetical protein	NA	Q938K7	Temperate_phage	98.2	9.6e-56
QAB35022.1|1379369_1380188_-|capsid	N4-gp56 family major capsid protein	capsid	Q79S85	Temperate_phage	100.0	4.0e-146
QAB35023.1|1380191_1380806_-	hypothetical protein	NA	Q938K8	Temperate_phage	93.1	3.8e-93
QAB35024.1|1380931_1381198_-	hypothetical protein	NA	Q938K9	Temperate_phage	95.5	6.4e-37
QAB35025.1|1381284_1381512_-	hypothetical protein	NA	NA	NA	NA	NA
QAB35026.1|1381511_1383005_-|capsid	capsid protein	capsid	Q938L1	Temperate_phage	79.6	3.4e-212
QAB35027.1|1383009_1384512_-|capsid	capsid protein	capsid	Q938L2	Temperate_phage	99.6	5.9e-281
QAB35028.1|1384525_1385737_-|terminase	PBSX family phage terminase large subunit	terminase	Q938L3	Temperate_phage	99.7	3.7e-225
QAB35029.1|1385819_1386296_-	hypothetical protein	NA	Q938L4	Temperate_phage	68.4	4.9e-48
QAB35030.1|1387880_1388099_+	hypothetical protein	NA	NA	NA	NA	NA
QAB35031.1|1388095_1388314_-	hypothetical protein	NA	NA	NA	NA	NA
QAB35032.1|1388438_1388873_-	ArpU family transcriptional regulator	NA	J7KDQ1	Streptococcus_phage	94.4	1.7e-71
QAB35556.1|1389323_1389803_-	DUF1642 domain-containing protein	NA	A0A141E0J6	Streptococcus_phage	41.9	6.5e-24
1389575:1389592	attL	CATCTTCTTCAACTTTTT	NA	NA	NA	NA
QAB35033.1|1389807_1390440_-	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	68.6	5.1e-85
QAB35034.1|1390441_1390726_-	hypothetical protein	NA	A0A097PAV1	Streptococcus_pyogenes_phage	87.2	8.9e-37
QAB35035.1|1390889_1391126_-	DUF3310 domain-containing protein	NA	A0A097PAQ7	Streptococcus_pyogenes_phage	100.0	2.4e-40
QAB35036.1|1391125_1391371_-	hypothetical protein	NA	A0A097PBE9	Streptococcus_pyogenes_phage	100.0	1.8e-41
QAB35037.1|1391367_1391724_-	hypothetical protein	NA	A0A097PAU4	Streptococcus_pyogenes_phage	100.0	2.9e-61
QAB35038.1|1391720_1392161_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A097PAS0	Streptococcus_pyogenes_phage	97.9	4.5e-80
QAB35039.1|1392160_1392364_-	hypothetical protein	NA	Q938M6	Temperate_phage	100.0	4.7e-32
QAB35040.1|1392369_1392795_-	single-stranded DNA-binding protein	NA	A0A097PAQ3	Streptococcus_pyogenes_phage	82.3	2.8e-55
QAB35041.1|1392787_1393462_-	single-stranded DNA-binding protein	NA	Q938M8	Temperate_phage	97.8	3.1e-104
QAB35042.1|1393462_1393945_-	hypothetical protein	NA	Q938M9	Temperate_phage	100.0	8.2e-51
QAB35043.1|1393966_1394221_-	hypothetical protein	NA	Q938N0	Temperate_phage	98.8	3.7e-42
QAB35044.1|1394201_1394555_-	hypothetical protein	NA	A0A097PAU3	Streptococcus_pyogenes_phage	54.0	2.8e-16
QAB35045.1|1394695_1395478_-	DNA replication protein	NA	A0A097PAQ0	Streptococcus_pyogenes_phage	97.3	1.0e-143
QAB35046.1|1395464_1396226_-	DnaD domain protein	NA	A0A097PBE7	Streptococcus_pyogenes_phage	100.0	7.5e-131
QAB35047.1|1396319_1396457_-	hypothetical protein	NA	A0A097PAR2	Streptococcus_pyogenes_phage	100.0	3.4e-18
QAB35048.1|1396487_1396739_-	hypothetical protein	NA	A0A1P8VVV6	Streptococcus_phage	97.6	2.6e-40
QAB35049.1|1396809_1396995_-	XRE family transcriptional regulator	NA	A0A1X9I6I3	Streptococcus_phage	72.1	3.3e-16
QAB35050.1|1397161_1397401_+	hypothetical protein	NA	NA	NA	NA	NA
QAB35051.1|1397498_1398218_-	oxidoreductase	NA	M1Q1T4	Streptococcus_phage	70.3	7.4e-88
QAB35052.1|1398245_1398458_-	transcriptional regulator	NA	J7KBP9	Streptococcus_phage	95.7	9.2e-31
QAB35053.1|1398655_1398997_+	XRE family transcriptional regulator	NA	J7KJZ4	Streptococcus_phage	85.8	1.2e-48
QAB35054.1|1398980_1399367_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1P8VVK5	Streptococcus_phage	77.6	1.9e-53
QAB35055.1|1399381_1400803_+	DUF4041 domain-containing protein	NA	M1PLF9	Streptococcus_phage	74.1	1.0e-136
QAB35056.1|1400984_1402151_+|integrase	integrase	integrase	C5J953	Streptococcus_phage	42.4	2.4e-80
1416756:1416773	attR	CATCTTCTTCAACTTTTT	NA	NA	NA	NA
