The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP035110	Lactobacillus curvatus strain SRCM103465 chromosome, complete genome	2042320	761663	803585	2042320	integrase,tail,portal,protease,capsid,terminase	Lactobacillus_phage(23.68%)	54	763448:763502	804017:804071
QAR35229.1|761663_763502_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.8	1.2e-20
763448:763502	attL	AGAAGCCTTCATGTCCATTTTGAAGATGAATGATGAAGATACCAAAGGTAAATAA	NA	NA	NA	NA
QAR35230.1|763632_764796_-|integrase	site-specific integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	47.8	2.2e-97
QAR35231.1|764882_765173_-	hypothetical protein	NA	NA	NA	NA	NA
QAR35232.1|765245_766067_-	hypothetical protein	NA	NA	NA	NA	NA
QAR35233.1|766128_766590_-	toxin	NA	A0A0A7RTX7	Clostridium_phage	46.2	1.2e-19
QAR35234.1|766601_766937_-	XRE family transcriptional regulator	NA	A8ATX5	Listeria_phage	44.4	4.6e-16
QAR35235.1|767094_767313_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QAR35236.1|767566_768124_+	XRE family transcriptional regulator	NA	O03909	Lactobacillus_phage	54.5	8.1e-42
QAR35237.1|768124_768382_+	hypothetical protein	NA	NA	NA	NA	NA
QAR35238.1|768720_768993_+	hypothetical protein	NA	NA	NA	NA	NA
QAR35239.1|768982_769954_+	DUF1351 domain-containing protein	NA	U5U3Y3	Lactobacillus_phage	27.2	3.3e-22
QAR35240.1|769953_770946_+	hypothetical protein	NA	A0A0S2SY47	Bacillus_phage	40.1	4.0e-60
QAR35241.1|770945_771635_+	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	49.3	1.4e-56
QAR35242.1|771624_772098_+	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	61.8	6.0e-46
QAR35243.1|772129_772855_+	DnaD domain protein	NA	A0A1L2JY26	Aeribacillus_phage	37.5	3.2e-14
QAR35244.1|773066_773597_+	response regulator transcription factor	NA	NA	NA	NA	NA
QAR35245.1|773565_773775_+	hypothetical protein	NA	NA	NA	NA	NA
QAR35246.1|773932_774244_+	hypothetical protein	NA	NA	NA	NA	NA
QAR35247.1|774440_774638_+	hypothetical protein	NA	NA	NA	NA	NA
QAR35248.1|774868_775108_+	hypothetical protein	NA	NA	NA	NA	NA
QAR35249.1|775605_775872_+	hypothetical protein	NA	NA	NA	NA	NA
QAR35250.1|776056_776305_+	hypothetical protein	NA	NA	NA	NA	NA
QAR35251.1|776301_776502_+	hypothetical protein	NA	NA	NA	NA	NA
QAR36383.1|776507_776816_+	hypothetical protein	NA	A0A2K9VCF6	Lactobacillus_phage	56.0	3.0e-22
QAR35252.1|777165_777627_+	autolysin	NA	D2IZZ3	Enterococcus_phage	39.1	8.8e-18
QAR36384.1|778648_778924_+	DUF2829 domain-containing protein	NA	I6X2Q9	Vibriophage	67.4	2.4e-31
QAR35253.1|779062_779293_+	hypothetical protein	NA	NA	NA	NA	NA
QAR35254.1|779330_780215_+|terminase	terminase	terminase	V9QKX0	Oenococcus_phage	46.2	6.1e-60
QAR35255.1|780198_781482_+|terminase	PBSX family phage terminase large subunit	terminase	V5UQR5	Oenococcus_phage	71.6	7.8e-189
QAR35256.1|781492_782941_+|portal	phage portal protein	portal	V9QKI8	Oenococcus_phage	55.4	2.3e-149
QAR35257.1|782882_783197_+|protease	ribosomal-processing cysteine protease Prp	protease	D2J003	Enterococcus_phage	39.0	5.6e-08
QAR35258.1|783199_784375_+	hypothetical protein	NA	V5UTD3	Oenococcus_phage	47.2	6.8e-91
QAR35259.1|784543_785191_+	DUF4355 domain-containing protein	NA	V5URU4	Oenococcus_phage	45.4	2.9e-19
QAR35260.1|785203_785566_+	hypothetical protein	NA	V5UTH9	Oenococcus_phage	57.0	2.1e-30
QAR35261.1|785589_786651_+|capsid	major capsid protein	capsid	V9QKJ3	Oenococcus_phage	63.3	3.0e-122
QAR36385.1|786698_786986_+	hypothetical protein	NA	A0A059NT99	Lactococcus_phage	48.4	2.7e-17
QAR35262.1|786982_787369_+	hypothetical protein	NA	D7RWJ2	Brochothrix_phage	55.9	3.3e-26
QAR35263.1|787319_787865_+	HK97 gp10 family phage protein	NA	V5URV0	Oenococcus_phage	61.0	5.3e-54
QAR35264.1|787866_788232_+	hypothetical protein	NA	Q6SE74	Lactobacillus_prophage	42.5	5.5e-23
QAR35265.1|788244_788718_+|tail	phage tail protein	tail	V9QKJ6	Oenococcus_phage	59.9	4.4e-41
QAR35266.1|788987_789392_+	hypothetical protein	NA	A0A182BQ86	Lactococcus_phage	59.3	5.3e-35
QAR35267.1|789484_789790_+	hypothetical protein	NA	D7RWJ9	Brochothrix_phage	42.4	7.3e-13
QAR35268.1|789972_790347_-	DUF2513 domain-containing protein	NA	A0A2I7SCV0	Paenibacillus_phage	39.4	4.3e-15
QAR35269.1|790404_795222_+|tail	phage tail protein	tail	D2J014	Enterococcus_phage	44.9	6.3e-175
QAR35270.1|795237_795597_+	hypothetical protein	NA	A0A1S5SCJ5	Streptococcus_phage	55.5	3.0e-29
QAR35271.1|795609_797592_+	hypothetical protein	NA	D7RWK2	Brochothrix_phage	52.2	3.6e-116
QAR36386.1|797618_799616_+	hypothetical protein	NA	A0A1B0Y2S0	Lactobacillus_phage	39.5	2.4e-80
QAR35272.1|799612_800062_+	DUF1617 family protein	NA	A0A2P0ZLE0	Lactobacillus_phage	37.4	6.6e-18
QAR35273.1|800061_800298_+	hypothetical protein	NA	NA	NA	NA	NA
QAR35274.1|800318_801797_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9MCC8	Lactobacillus_phage	56.0	5.6e-50
QAR35275.1|801836_802340_-	hypothetical protein	NA	NA	NA	NA	NA
QAR35276.1|802326_802557_-	hypothetical protein	NA	B8R666	Lactobacillus_phage	45.8	2.6e-10
QAR35277.1|802965_803214_+	hypothetical protein	NA	A0A0S2MYI8	Enterococcus_phage	34.3	3.2e-06
QAR35278.1|803210_803585_+	hypothetical protein	NA	E3W8I0	Leuconostoc_phage	31.1	1.4e-05
804017:804071	attR	AGAAGCCTTCATGTCCATTTTGAAGATGAATGATGAAGATACCAAAGGTAAATAA	NA	NA	NA	NA
>prophage 2
CP035110	Lactobacillus curvatus strain SRCM103465 chromosome, complete genome	2042320	810711	818944	2042320		Bacillus_phage(50.0%)	9	NA	NA
QAR35287.1|810711_811038_-	heavy metal-binding domain-containing protein	NA	M4STD1	Rhodobacter_phage	35.6	2.4e-06
QAR35288.1|811053_811419_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
QAR35289.1|811528_812524_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	37.4	1.4e-49
QAR35290.1|812676_814971_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.4	3.9e-74
QAR35291.1|815005_815524_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	42.0	8.9e-27
QAR35292.1|815741_816356_-	transcriptional repressor LexA	NA	A0A1B1P7Q3	Bacillus_phage	57.4	1.3e-16
QAR35293.1|816491_816734_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
QAR35294.1|816814_817042_+	YneF family protein	NA	NA	NA	NA	NA
QAR35295.1|817198_818944_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.9	1.5e-46
>prophage 3
CP035110	Lactobacillus curvatus strain SRCM103465 chromosome, complete genome	2042320	916152	924556	2042320		Paramecium_bursaria_Chlorella_virus(14.29%)	8	NA	NA
QAR35381.1|916152_916872_+	aquaporin family protein	NA	M1HQB9	Paramecium_bursaria_Chlorella_virus	30.5	8.3e-23
QAR35382.1|917259_918633_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	29.3	3.3e-44
QAR35383.1|918676_919156_-	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	37.5	6.5e-16
QAR35384.1|919607_921641_+	potassium transporter Kup	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	35.6	1.7e-68
QAR35385.1|921866_922475_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A249XZV3	Enterococcus_phage	48.2	5.6e-20
QAR35386.1|922616_922886_+	hypothetical protein	NA	NA	NA	NA	NA
QAR36393.1|922917_924183_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	38.8	6.9e-81
QAR35387.1|924175_924556_+	hypothetical protein	NA	E3W8I0	Leuconostoc_phage	29.5	8.3e-06
>prophage 4
CP035110	Lactobacillus curvatus strain SRCM103465 chromosome, complete genome	2042320	1174441	1182323	2042320	tRNA	Staphylococcus_phage(33.33%)	7	NA	NA
QAR35630.1|1174441_1175299_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	41.9	3.9e-19
QAR35631.1|1175481_1175976_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	38.6	2.5e-26
QAR35632.1|1175991_1176942_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	66.6	2.8e-127
QAR35633.1|1177567_1179451_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.6	8.5e-51
QAR35634.1|1179593_1180055_-	hypothetical protein	NA	NA	NA	NA	NA
QAR35635.1|1180118_1181318_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	50.0	5.4e-43
QAR35636.1|1181465_1182323_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	41.5	3.9e-59
