The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP035385	Enterobacter hormaechei strain S11_16 chromosome, complete genome	4850296	890276	932518	4850296	holin,transposase,tail	uncultured_Caudovirales_phage(31.03%)	40	NA	NA
QAV60083.1|890276_891380_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.9	1.0e-59
QAV60084.1|891391_892645_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.6	5.2e-97
QAV60085.1|892985_894158_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	49.7	4.5e-111
QAV60086.1|894154_894343_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
QAV60087.1|894339_895749_-	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	74.5	6.9e-215
QAV63724.1|895875_896178_-	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	65.9	1.5e-26
QAV60088.1|896167_896389_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
QAV63725.1|896454_897213_-	DNA-binding protein	NA	NA	NA	NA	NA
QAV60089.1|897269_899333_-	DNA polymerase	NA	Q775A3	Bordetella_phage	68.3	1.0e-275
QAV60090.1|899355_899886_+	hypothetical protein	NA	NA	NA	NA	NA
QAV60091.1|899937_900486_-	DUF2815 family protein	NA	Q775A5	Bordetella_phage	66.5	8.4e-68
QAV60092.1|900500_901805_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	59.6	1.4e-145
QAV60093.1|901807_902728_-	hypothetical protein	NA	NA	NA	NA	NA
QAV60094.1|903324_903948_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	44.8	8.8e-37
QAV60095.1|904068_904281_+	XRE family transcriptional regulator	NA	A0A0R6PHL1	Moraxella_phage	44.4	2.1e-06
QAV60096.1|904284_906453_+	replication protein	NA	B6SD37	Bacteriophage	72.6	1.2e-173
QAV60097.1|906761_907037_+	hypothetical protein	NA	NA	NA	NA	NA
QAV60098.1|907314_907752_+	hypothetical protein	NA	NA	NA	NA	NA
QAV60099.1|907764_907995_+	hypothetical protein	NA	NA	NA	NA	NA
QAV60100.1|907998_909624_+|tail	phage tail protein	tail	A0A2H4J3N6	uncultured_Caudovirales_phage	58.7	3.9e-169
QAV60101.1|909620_909854_+	hypothetical protein	NA	NA	NA	NA	NA
QAV60102.1|909840_910677_+	hypothetical protein	NA	A0A2H4JEQ5	uncultured_Caudovirales_phage	44.6	3.0e-48
QAV60103.1|910895_911807_+	hypothetical protein	NA	A0A2H4JC66	uncultured_Caudovirales_phage	37.6	9.2e-43
QAV60104.1|911864_912428_+	hypothetical protein	NA	A0A2H4JID6	uncultured_Caudovirales_phage	52.9	1.1e-51
QAV60105.1|912429_914418_+	hypothetical protein	NA	A0A2H4J6H2	uncultured_Caudovirales_phage	48.8	1.3e-187
QAV60106.1|914419_914869_+	GNAT family N-acetyltransferase	NA	A0A2H4J9Z5	uncultured_Caudovirales_phage	42.3	2.0e-22
QAV60107.1|914871_915339_+	hypothetical protein	NA	A0A2H4J679	uncultured_Caudovirales_phage	46.9	8.4e-08
QAV60108.1|915341_918050_+	lytic transglycosylase	NA	G9L6D3	Escherichia_phage	65.0	0.0e+00
QAV60109.1|918049_920941_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	75.6	0.0e+00
QAV60110.1|921005_921347_+	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	51.8	3.7e-21
QAV60111.1|921343_922954_+	transcriptional regulator	NA	A0A2H4JCA3	uncultured_Caudovirales_phage	69.9	7.1e-224
QAV60112.1|925296_926808_-	hypothetical protein	NA	Q8LTG0	Salmonella_phage	29.4	9.9e-42
QAV60113.1|926835_927747_-	glycosyltransferase	NA	S5FKN0	Shigella_phage	91.7	2.4e-160
QAV60114.1|927743_928106_-	GtrA family protein	NA	B9UDL8	Salmonella_phage	75.0	3.5e-46
QAV60115.1|928255_928480_+|holin	holin	holin	A5LH82	Enterobacteria_phage	71.0	2.8e-22
QAV60116.1|928466_929006_+	lysozyme	NA	K7PM52	Enterobacteria_phage	89.1	5.3e-91
QAV60117.1|929002_929365_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	47.9	2.9e-16
QAV60118.1|929929_930505_-	hypothetical protein	NA	NA	NA	NA	NA
QAV60119.1|930410_931268_-	hypothetical protein	NA	NA	NA	NA	NA
QAV60120.1|931397_932518_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
>prophage 2
CP035385	Enterobacter hormaechei strain S11_16 chromosome, complete genome	4850296	1746628	1829513	4850296	head,portal,protease,capsid,plate,tail,tRNA,holin,transposase,terminase	Enterobacteria_phage(34.85%)	92	NA	NA
QAV60852.1|1746628_1747120_+|transposase	transposase	transposase	NA	NA	NA	NA
QAV60853.1|1747212_1748334_-	cupin domain-containing protein	NA	NA	NA	NA	NA
QAV60854.1|1748425_1749889_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
QAV63753.1|1749889_1750564_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
QAV63754.1|1750634_1751921_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	49.1	1.6e-109
QAV60855.1|1751920_1752136_-	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	56.3	4.8e-19
QAV60856.1|1752197_1752437_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	56.6	8.0e-15
QAV60857.1|1752423_1754310_-	exodeoxyribonuclease VIII	NA	H6WRX1	Salmonella_phage	31.5	1.5e-26
QAV60858.1|1754533_1754806_-	hypothetical protein	NA	K7P7B3	Enterobacteria_phage	46.6	1.7e-16
QAV60859.1|1755661_1756081_-	helix-turn-helix domain-containing protein	NA	K7PM82	Enterobacteria_phage	53.1	2.9e-12
QAV60860.1|1756158_1756371_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	43.4	4.6e-06
QAV60861.1|1756370_1756823_+	hypothetical protein	NA	NA	NA	NA	NA
QAV60862.1|1756845_1757763_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	40.3	7.1e-51
QAV60863.1|1757765_1758506_+	DNA replication protein DnaC	NA	H6WRX8	Salmonella_phage	72.7	1.9e-99
QAV60864.1|1758523_1759183_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	29.1	7.1e-13
QAV60865.1|1759454_1761176_-	hypothetical protein	NA	D0UIM0	Aggregatibacter_phage	28.8	1.8e-55
QAV60866.1|1761363_1762032_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
QAV60867.1|1762396_1762720_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.3	5.2e-25
QAV60868.1|1762892_1763111_+	hypothetical protein	NA	NA	NA	NA	NA
QAV60869.1|1763256_1763550_+	hypothetical protein	NA	Q6V7S4	Burkholderia_virus	57.0	1.4e-21
QAV60870.1|1763542_1763911_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	61.7	3.2e-39
QAV60871.1|1763903_1764254_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	86.6	8.9e-55
QAV60872.1|1764263_1764923_-	hypothetical protein	NA	NA	NA	NA	NA
QAV60873.1|1764922_1765315_-	hypothetical protein	NA	NA	NA	NA	NA
QAV60874.1|1765315_1766368_-	hypothetical protein	NA	NA	NA	NA	NA
QAV60875.1|1766571_1766874_+	hypothetical protein	NA	O64361	Escherichia_phage	67.3	4.1e-32
QAV60876.1|1766873_1767410_+	lysozyme	NA	K7PM52	Enterobacteria_phage	89.6	5.9e-90
QAV60877.1|1767406_1767796_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	50.9	5.9e-23
QAV60878.1|1767689_1767938_+	hypothetical protein	NA	S5FXQ4	Shigella_phage	68.5	3.5e-21
QAV60879.1|1767977_1768256_-	hypothetical protein	NA	NA	NA	NA	NA
QAV60880.1|1768806_1769151_+	hypothetical protein	NA	NA	NA	NA	NA
QAV60881.1|1769698_1770244_+|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	93.4	4.6e-90
QAV60882.1|1770218_1772141_+|terminase	phage terminase large subunit family protein	terminase	K7PGW7	Enterobacteria_phage	93.8	0.0e+00
QAV60883.1|1772140_1772347_+|tail	phage tail protein	tail	E4WL20	Enterobacteria_phage	95.5	9.3e-28
QAV60884.1|1772343_1773933_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	91.1	8.5e-286
QAV60885.1|1773913_1775257_+	S49 family peptidase	NA	O64320	Escherichia_phage	92.6	4.2e-201
QAV60886.1|1775266_1775599_+|head	head decoration protein	head	E4WL24	Enterobacteria_phage	93.6	1.8e-52
QAV60887.1|1775654_1776680_+|capsid	major capsid protein	capsid	K7PGW9	Enterobacteria_phage	95.3	4.9e-186
QAV60888.1|1776725_1777139_+	DNA-packaging protein	NA	E4WL26	Enterobacteria_phage	54.3	4.6e-26
QAV60889.1|1777150_1777504_+|tail	phage tail protein	tail	E4WL27	Enterobacteria_phage	94.0	5.4e-60
QAV60890.1|1777513_1778098_+|tail	phage tail protein	tail	M9NZH5	Enterobacteria_phage	100.0	1.2e-99
QAV60891.1|1778094_1778493_+|tail	phage tail protein	tail	E4WL29	Enterobacteria_phage	99.2	6.5e-70
QAV60892.1|1778500_1779244_+|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	98.8	3.3e-131
QAV60893.1|1779254_1779698_+|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	91.6	2.0e-67
QAV60894.1|1779694_1780009_+|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	96.2	1.5e-53
QAV60895.1|1779992_1783130_+|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	96.5	0.0e+00
QAV60896.1|1783126_1783465_+|tail	phage tail protein	tail	E4WL34	Enterobacteria_phage	100.0	2.3e-60
QAV60897.1|1783520_1784258_+|tail	phage minor tail protein L	tail	M9NYX1	Enterobacteria_phage	100.0	5.5e-147
QAV60898.1|1784260_1784980_+	peptidase P60	NA	K7PJY5	Enterobacterial_phage	97.1	2.2e-140
QAV60899.1|1784972_1785590_+|tail	tail assembly protein	tail	K7PH59	Enterobacterial_phage	99.5	3.9e-106
QAV60900.1|1785632_1789256_+	DUF1983 domain-containing protein	NA	K7PMC2	Enterobacterial_phage	92.6	0.0e+00
QAV60901.1|1789257_1790223_+	hypothetical protein	NA	G1CSU0	Cronobacter_virus	39.7	3.9e-60
QAV60902.1|1790283_1791597_+|tail	tail fiber domain-containing protein	tail	K7PGY2	Enterobacteria_phage	50.2	1.2e-83
QAV63755.1|1791593_1792343_-|tail	phage tail protein	tail	G8C7K5	Escherichia_phage	68.0	8.2e-90
QAV63756.1|1792473_1793031_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	79.3	7.0e-78
QAV60903.1|1793203_1793623_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.7	9.4e-35
QAV60904.1|1793625_1794894_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.9	9.0e-230
QAV60905.1|1794939_1796685_-	hypothetical protein	NA	NA	NA	NA	NA
QAV60906.1|1798126_1798582_+	anti-adapter protein IraM	NA	NA	NA	NA	NA
QAV60907.1|1798666_1800037_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.8	1.1e-108
QAV60908.1|1800056_1800686_-	lysogenization regulator HflD	NA	NA	NA	NA	NA
QAV60909.1|1800713_1801826_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
QAV60910.1|1801866_1802340_-	NUDIX hydrolase	NA	NA	NA	NA	NA
QAV60911.1|1802339_1803002_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
QAV60912.1|1803119_1804370_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	7.9e-21
QAV60913.1|1804534_1805281_+	hypothetical protein	NA	NA	NA	NA	NA
QAV60914.1|1806297_1806579_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	46.2	1.3e-19
QAV60915.1|1806578_1807208_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	86.5	5.1e-101
QAV60916.1|1807215_1807485_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	77.5	4.2e-28
QAV60917.1|1807441_1807627_+	hypothetical protein	NA	K7PM01	Enterobacterial_phage	76.7	5.2e-14
QAV60918.1|1807699_1807930_+	hypothetical protein	NA	NA	NA	NA	NA
QAV60919.1|1808475_1808736_-	hypothetical protein	NA	NA	NA	NA	NA
QAV63757.1|1809320_1809824_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	62.3	3.1e-48
QAV60920.1|1809827_1811948_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	74.8	6.4e-305
QAV60921.1|1811944_1812160_+	hypothetical protein	NA	NA	NA	NA	NA
QAV60922.1|1812168_1813689_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	55.4	2.1e-153
QAV63758.1|1813678_1815757_+|protease	Clp protease ClpP	protease	A0A1B0YZU0	Pseudomonas_phage	58.2	6.7e-198
QAV60923.1|1815823_1816159_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	42.7	9.9e-11
QAV60924.1|1816158_1816515_+	hypothetical protein	NA	NA	NA	NA	NA
QAV60925.1|1816516_1817179_+	hypothetical protein	NA	R9TR34	Vibrio_phage	36.7	1.1e-21
QAV60926.1|1817187_1817742_+	hypothetical protein	NA	NA	NA	NA	NA
QAV60927.1|1817734_1818358_+|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	30.8	7.2e-07
QAV60928.1|1818396_1819866_+|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	47.1	8.3e-78
QAV60929.1|1819862_1820369_+|tail	phage tail protein	tail	NA	NA	NA	NA
QAV60930.1|1820420_1820708_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
QAV60931.1|1822909_1823380_+|tail	phage tail protein	tail	D4HTW5	Vibrio_phage	34.1	2.4e-15
QAV60932.1|1823354_1823570_+|tail	phage tail protein	tail	R9TR63	Vibrio_phage	52.9	6.7e-13
QAV60933.1|1823572_1824691_+	late control protein D	NA	R9TNM7	Vibrio_phage	33.4	7.1e-37
QAV60934.1|1824729_1825083_+|plate	baseplate assembly protein	plate	E5FFH4	Burkholderia_phage	50.9	3.8e-21
QAV60935.1|1825066_1825981_+|plate	baseplate assembly protein	plate	A0A088FQL4	Escherichia_phage	49.3	3.8e-65
QAV60936.1|1825973_1826525_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	41.0	3.3e-27
QAV60937.1|1829090_1829513_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	48.2	1.9e-27
>prophage 3
CP035385	Enterobacter hormaechei strain S11_16 chromosome, complete genome	4850296	1844353	1889734	4850296	head,portal,protease,capsid,tail,tRNA,integrase,holin,terminase	Enterobacterial_phage(25.93%)	63	1841578:1841592	1862826:1862840
1841578:1841592	attL	CTGACCAGCCAGCCT	NA	NA	NA	NA
QAV60955.1|1844353_1844854_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
QAV60956.1|1845073_1846216_-|integrase	integrase	integrase	O21929	Phage_21	48.7	2.7e-92
QAV60957.1|1846190_1846454_-	hypothetical protein	NA	NA	NA	NA	NA
QAV60958.1|1846489_1846759_-	hypothetical protein	NA	M9NZE4	Enterobacteria_phage	91.1	1.3e-13
QAV60959.1|1846762_1847224_-	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	38.9	4.5e-14
QAV60960.1|1847220_1847424_-	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
QAV60961.1|1847420_1847897_-	hypothetical protein	NA	K7PHA5	Enterobacterial_phage	51.4	5.3e-26
QAV60962.1|1847883_1848909_-	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	89.2	2.5e-166
QAV63760.1|1848905_1849319_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	84.7	1.2e-53
QAV60963.1|1849367_1849688_-	hypothetical protein	NA	K7P7N6	Enterobacteria_phage	55.7	4.7e-26
QAV60964.1|1850122_1850623_+	hypothetical protein	NA	I6R9C3	Salmonella_phage	28.7	7.8e-12
QAV60965.1|1850896_1851097_+	hypothetical protein	NA	NA	NA	NA	NA
QAV60966.1|1851419_1852052_-	helix-turn-helix domain-containing protein	NA	A0A1W6JP50	Morganella_phage	56.7	1.1e-50
QAV60967.1|1852152_1852356_+	hypothetical protein	NA	A0A1W6JP24	Morganella_phage	60.0	7.3e-17
QAV60968.1|1852372_1852933_+	hypothetical protein	NA	A5LH68	Enterobacteria_phage	52.2	1.9e-46
QAV60969.1|1853096_1853303_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.3	8.4e-13
QAV60970.1|1853265_1854192_+	transcriptional regulator	NA	K7PLZ7	Enterobacterial_phage	55.2	9.9e-69
QAV60971.1|1854188_1854683_+	hypothetical protein	NA	NA	NA	NA	NA
QAV60972.1|1854682_1855342_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	79.3	1.5e-98
QAV60973.1|1855338_1855566_+	hypothetical protein	NA	NA	NA	NA	NA
QAV60974.1|1855562_1855952_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	95.3	1.2e-68
QAV60975.1|1855948_1856938_+	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	89.4	5.6e-179
QAV60976.1|1856950_1857529_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	53.3	1.6e-45
QAV60977.1|1857972_1858362_+	hypothetical protein	NA	G8C7V8	Escherichia_phage	94.5	2.3e-59
QAV60978.1|1858351_1858630_+|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	87.4	9.6e-36
QAV60979.1|1858629_1859259_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	95.7	2.9e-112
QAV60980.1|1859266_1859542_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	61.5	3.6e-19
QAV63761.1|1859492_1859672_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	80.0	4.0e-19
QAV63762.1|1859738_1859996_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	52.7	5.1e-15
QAV60981.1|1860234_1860699_-|protease	retroviral-like aspartic protease	protease	NA	NA	NA	NA
QAV60982.1|1860959_1861757_+	DUF1983 domain-containing protein	NA	S4TNN5	Salmonella_phage	52.8	3.5e-54
QAV60983.1|1861759_1861993_+	hypothetical protein	NA	NA	NA	NA	NA
QAV60984.1|1862033_1863491_+	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	93.4	3.9e-277
1862826:1862840	attR	CTGACCAGCCAGCCT	NA	NA	NA	NA
QAV60985.1|1863450_1864128_+	HNH endonuclease	NA	A0A1W6DXY0	Salmonella_phage	37.0	1.7e-14
QAV60986.1|1864121_1864703_+	hypothetical protein	NA	S4TR53	Salmonella_phage	70.4	5.2e-76
QAV60987.1|1864695_1865064_+	HNH endonuclease	NA	S4TTG9	Salmonella_phage	86.9	1.9e-55
QAV60988.1|1865170_1865665_+|terminase	terminase small subunit	terminase	S4TNN3	Salmonella_phage	100.0	1.7e-83
QAV60989.1|1865661_1867323_+|terminase	terminase large subunit	terminase	S4TSQ6	Salmonella_phage	98.7	0.0e+00
QAV60990.1|1867381_1869316_+|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	98.3	0.0e+00
QAV60991.1|1869519_1870878_+|portal	phage portal protein	portal	S4TTG7	Salmonella_phage	93.1	8.6e-247
QAV60992.1|1870874_1871918_+|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TNN1	Salmonella_phage	83.9	1.2e-102
QAV60993.1|1871914_1872241_+|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TSQ3	Salmonella_phage	89.8	5.8e-48
QAV60994.1|1872249_1872600_+|head,tail	head-tail adaptor protein	head,tail	S4TND9	Salmonella_phage	90.5	1.7e-53
QAV60995.1|1872596_1873046_+	HK97 gp10 family phage protein	NA	K7PH34	Enterobacterial_phage	98.7	5.8e-75
QAV60996.1|1873042_1873390_+	DUF3168 domain-containing protein	NA	K7PM93	Enterobacterial_phage	100.0	2.0e-59
QAV60997.1|1873449_1873893_+	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	94.5	1.6e-72
QAV60998.1|1873901_1874285_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	93.7	4.4e-63
QAV60999.1|1874293_1874572_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	97.8	1.2e-43
QAV61000.1|1874627_1874969_+	hypothetical protein	NA	NA	NA	NA	NA
QAV63763.1|1875026_1878329_+|tail	phage tail tape measure protein	tail	K7P7L6	Enterobacteria_phage	86.4	0.0e+00
QAV61001.1|1878331_1878670_+|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	59.8	4.3e-38
QAV61002.1|1878666_1879425_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	63.6	3.9e-95
QAV61003.1|1879427_1880138_+	peptidase P60	NA	F1C573	Cronobacter_phage	70.2	1.3e-97
QAV61004.1|1880137_1880722_+|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	53.1	1.1e-54
QAV61005.1|1880775_1884579_+	DUF1983 domain-containing protein	NA	Q9MCU0	Escherichia_phage	63.3	0.0e+00
QAV61006.1|1884622_1884937_+	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	63.7	7.3e-32
QAV61007.1|1884937_1885609_+	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	72.2	9.9e-87
QAV61008.1|1885716_1885950_+	cor protein	NA	E4WL42	Enterobacteria_phage	77.6	3.9e-30
QAV61009.1|1886008_1887136_+|tail	tail fiber domain-containing protein	tail	A0A2I6PID3	Escherichia_phage	36.8	1.3e-51
QAV61010.1|1887267_1887534_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	92.0	2.0e-38
QAV61011.1|1887630_1887870_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	77.2	1.5e-29
QAV61012.1|1887869_1888190_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.8	2.3e-25
QAV61013.1|1888450_1889734_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	28.3	1.1e-09
>prophage 4
CP035385	Enterobacter hormaechei strain S11_16 chromosome, complete genome	4850296	2054703	2102398	4850296	head,lysis,tail,holin,terminase	Salmonella_phage(40.62%)	74	NA	NA
QAV61172.1|2054703_2055984_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	50.9	1.1e-123
QAV61173.1|2056016_2056265_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	8.3e-15
QAV61174.1|2056383_2056632_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	61.1	2.4e-06
QAV61175.1|2056641_2056881_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	47.4	7.0e-11
QAV61176.1|2056843_2057356_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.4	1.4e-69
QAV61177.1|2057355_2057574_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	62.5	1.7e-16
QAV61178.1|2057665_2058052_-	DUF2591 domain-containing protein	NA	A0A1J0GUX1	Halomonas_phage	34.2	6.5e-06
QAV61179.1|2058048_2058240_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	66.1	3.2e-14
QAV61180.1|2058236_2058533_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	62.4	9.3e-29
QAV61181.1|2058532_2058748_-	hypothetical protein	NA	NA	NA	NA	NA
QAV61182.1|2058744_2059239_-	HNH endonuclease	NA	A0A0H5ARI7	Pseudomonas_phage	45.8	4.5e-28
QAV61183.1|2059235_2059787_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	57.1	1.6e-53
QAV61184.1|2059947_2060376_-	regulator	NA	M9NYX4	Enterobacteria_phage	93.7	1.7e-71
QAV61185.1|2060372_2061053_-	exonuclease	NA	M9NZE1	Enterobacteria_phage	95.1	9.0e-128
QAV61186.1|2061338_2062184_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.7	9.6e-71
QAV61187.1|2062202_2062487_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	93.6	8.5e-48
QAV61188.1|2062559_2062793_-	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	95.5	5.4e-32
QAV61189.1|2062770_2063277_-	HNH endonuclease	NA	Q5DMP6	Escherichia_phage	41.1	1.9e-26
QAV61190.1|2063428_2063731_-	superinfection exclusion protein	NA	Q76H37	Enterobacteria_phage	82.0	5.2e-43
QAV61191.1|2063892_2064138_-	hypothetical protein	NA	NA	NA	NA	NA
QAV61192.1|2064860_2065613_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	64.0	9.2e-73
QAV61193.1|2065654_2065888_+	transcriptional regulator	NA	A0A0P0ZDD7	Stx2-converting_phage	62.3	2.6e-18
QAV61194.1|2065905_2066451_+	hypothetical protein	NA	K7P7P2	Enterobacteria_phage	97.2	2.8e-95
QAV61195.1|2066690_2067776_+	DNA replication protein	NA	E5AGE9	Erwinia_phage	45.4	3.0e-85
QAV61196.1|2067772_2069146_+	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	63.5	9.9e-166
QAV61197.1|2069135_2069450_+	protein ren	NA	M1FPD5	Enterobacteria_phage	52.6	5.1e-17
QAV61198.1|2069446_2069695_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QAV61199.1|2070032_2070245_+	hypothetical protein	NA	NA	NA	NA	NA
QAV61200.1|2070241_2070850_+	DUF551 domain-containing protein	NA	G8C7V0	Escherichia_phage	69.3	3.1e-47
QAV61201.1|2070846_2071089_+	hypothetical protein	NA	NA	NA	NA	NA
QAV61202.1|2071337_2071793_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	72.2	5.4e-60
QAV61203.1|2071792_2071963_+	NinE family protein	NA	K7P7K0	Enterobacteria_phage	91.1	1.5e-20
QAV61204.1|2071955_2072588_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	52.8	4.7e-54
QAV61205.1|2072584_2072701_+	hypothetical protein	NA	NA	NA	NA	NA
QAV61206.1|2072697_2073384_+	antiterminator	NA	I6PDF8	Cronobacter_phage	55.3	6.6e-62
QAV63771.1|2073875_2074181_+|holin	holin	holin	E7C9S8	Salmonella_phage	86.1	1.1e-43
QAV61207.1|2074167_2074608_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	76.5	7.0e-57
QAV61208.1|2074604_2075078_+|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	59.7	7.1e-39
QAV61209.1|2075282_2075969_+	hypothetical protein	NA	A0A192Y918	Salmonella_phage	99.1	1.8e-123
QAV61210.1|2076629_2077268_+	hypothetical protein	NA	I6S676	Salmonella_phage	92.5	2.8e-115
QAV61211.1|2077299_2077755_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	81.3	1.8e-63
QAV61212.1|2077751_2078999_+|terminase	PBSX family phage terminase large subunit	terminase	I6RSK1	Salmonella_phage	98.6	4.5e-218
QAV61213.1|2079013_2080363_+	DUF1073 domain-containing protein	NA	I6R9A1	Salmonella_phage	86.4	5.2e-228
QAV61214.1|2080322_2081249_+|head	phage head morphogenesis protein	head	Q5G8Y3	Enterobacteria_phage	93.5	1.8e-163
QAV61215.1|2081251_2082517_+	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	91.0	9.3e-219
QAV61216.1|2082529_2082979_+	hypothetical protein	NA	A0A1V0E5Q8	Salmonella_phage	86.6	7.1e-65
QAV61217.1|2082996_2084073_+	hypothetical protein	NA	Q5G8Y0	Enterobacteria_phage	88.5	5.0e-181
QAV61218.1|2084082_2084376_+	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	90.7	2.9e-43
QAV61219.1|2084438_2084840_+	hypothetical protein	NA	A0A1V0E5R0	Salmonella_phage	85.0	3.0e-62
QAV63773.1|2084839_2085028_+	hypothetical protein	NA	I6R0P9	Salmonella_phage	93.5	2.0e-29
QAV63772.1|2085011_2085374_+	hypothetical protein	NA	I6S1Q5	Salmonella_phage	93.3	4.9e-64
QAV61220.1|2085381_2085777_+	hypothetical protein	NA	I6RSK8	Salmonella_phage	96.2	1.5e-66
QAV61221.1|2085773_2086160_+	hypothetical protein	NA	Q5G8X4	Enterobacteria_phage	96.9	6.6e-67
QAV61222.1|2086177_2086912_+	hypothetical protein	NA	H6WRU1	Salmonella_phage	85.6	2.1e-114
QAV61223.1|2086951_2087605_+	hypothetical protein	NA	I6R0Q2	Salmonella_phage	92.6	3.5e-113
QAV61224.1|2088166_2088526_+	hypothetical protein	NA	A0A1V0E5N7	Salmonella_phage	60.8	2.7e-38
QAV61225.1|2088551_2088833_+	hypothetical protein	NA	H6WRV2	Salmonella_phage	91.4	2.5e-31
QAV61226.1|2088925_2089255_+	hypothetical protein	NA	NA	NA	NA	NA
QAV61227.1|2089251_2089722_+	hypothetical protein	NA	NA	NA	NA	NA
QAV61228.1|2089779_2092089_+	hypothetical protein	NA	H6WRV7	Salmonella_phage	41.3	3.0e-114
QAV61229.1|2092091_2092439_+|tail	phage tail protein	tail	A0A1V0E5N3	Salmonella_phage	90.4	1.1e-57
QAV61230.1|2092450_2092699_+	hypothetical protein	NA	NA	NA	NA	NA
QAV61231.1|2092682_2092922_-	hypothetical protein	NA	NA	NA	NA	NA
QAV61232.1|2093088_2093793_+|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	98.7	9.3e-136
QAV63774.1|2093792_2094512_+|tail	phage tail protein	tail	A0A1V0E5M9	Salmonella_phage	82.3	3.3e-120
QAV61233.1|2094454_2094988_+|tail	tail assembly protein	tail	H6WRW3	Salmonella_phage	67.0	4.0e-54
QAV61234.1|2094997_2098789_+	DUF1983 domain-containing protein	NA	I6R9B3	Salmonella_phage	61.2	0.0e+00
QAV61235.1|2098831_2099146_+	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	65.7	3.0e-33
QAV61236.1|2099146_2099818_+	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	71.7	8.4e-86
QAV61237.1|2099925_2100159_+	cor protein	NA	E4WL42	Enterobacteria_phage	74.0	4.3e-29
QAV61238.1|2100216_2101344_+|tail	tail fiber domain-containing protein	tail	A0A2I6PID3	Escherichia_phage	36.5	3.9e-51
QAV61239.1|2101475_2101742_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	93.2	2.0e-38
QAV61240.1|2101841_2102081_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	87.2	2.8e-36
QAV61241.1|2102080_2102398_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	48.0	1.1e-19
>prophage 5
CP035385	Enterobacter hormaechei strain S11_16 chromosome, complete genome	4850296	2165741	2172853	4850296		Escherichia_phage(83.33%)	8	NA	NA
QAV61297.1|2165741_2166401_+	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	62.1	4.1e-77
QAV61298.1|2166457_2166769_-	DNA damage-inducible SOS regulon protein	NA	NA	NA	NA	NA
QAV61299.1|2166877_2167492_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	33.7	2.8e-27
QAV61300.1|2167537_2168392_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	34.9	2.0e-23
QAV61301.1|2168393_2169011_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	8.9e-74
QAV61302.1|2169021_2171460_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.0	1.2e-217
QAV61303.1|2171590_2171896_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
QAV61304.1|2171998_2172853_-	benzoate transporter	NA	M1I711	Paramecium_bursaria_Chlorella_virus	32.5	2.4e-24
>prophage 6
CP035385	Enterobacter hormaechei strain S11_16 chromosome, complete genome	4850296	2180693	2190552	4850296		Morganella_phage(37.5%)	11	NA	NA
QAV61312.1|2180693_2180897_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	56.7	4.4e-14
QAV61313.1|2181184_2181616_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	35.2	1.5e-16
QAV61314.1|2181651_2182338_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
QAV61315.1|2182428_2183175_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
QAV61316.1|2183318_2185352_+	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	22.4	1.7e-20
QAV61317.1|2185967_2186195_-	hypothetical protein	NA	NA	NA	NA	NA
QAV61318.1|2186757_2186976_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	62.7	8.3e-19
QAV61319.1|2187343_2188033_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.5	1.7e-81
QAV61320.1|2188296_2188536_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	91.1	1.5e-32
QAV61321.1|2188862_2189282_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.7	7.2e-35
QAV61322.1|2189283_2190552_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	90.8	2.1e-226
>prophage 7
CP035385	Enterobacter hormaechei strain S11_16 chromosome, complete genome	4850296	2498472	2536421	4850296	transposase,plate,tail,tRNA	Enterobacteria_phage(40.0%)	42	NA	NA
QAV61583.1|2498472_2499600_+	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	60.3	5.2e-120
QAV61584.1|2499633_2500056_-	GFA family protein	NA	NA	NA	NA	NA
QAV61585.1|2500059_2500257_-	hypothetical protein	NA	NA	NA	NA	NA
QAV61586.1|2500563_2500860_+	hypothetical protein	NA	A0A0U2JGI6	Escherichia_phage	56.5	3.0e-19
QAV61587.1|2501186_2501861_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.2	3.1e-80
QAV61588.1|2501912_2502125_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
QAV61589.1|2502412_2502631_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	62.7	2.1e-17
QAV61590.1|2503186_2503414_+	hypothetical protein	NA	NA	NA	NA	NA
QAV61591.1|2503587_2503926_+	hypothetical protein	NA	NA	NA	NA	NA
QAV61592.1|2504299_2505568_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.9	9.0e-230
QAV61593.1|2505570_2505990_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
QAV61594.1|2506186_2507452_-|tail	phage tail protein	tail	K7P6T0	Enterobacteria_phage	64.3	2.1e-146
QAV61595.1|2507511_2507745_-	cor protein	NA	E4WL42	Enterobacteria_phage	77.9	1.7e-30
QAV61596.1|2507852_2508524_-	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	70.4	1.0e-83
QAV61597.1|2508524_2508839_-	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	70.6	1.1e-35
QAV61598.1|2508881_2512436_-	DUF1983 domain-containing protein	NA	K7P868	Enterobacteria_phage	88.6	0.0e+00
QAV61599.1|2512494_2513424_-	hypothetical protein	NA	NA	NA	NA	NA
QAV61600.1|2513467_2514097_-|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	61.8	3.1e-58
QAV61601.1|2514129_2514840_-	peptidase P60	NA	K7PGV2	Enterobacterial_phage	94.8	1.3e-140
QAV61602.1|2514841_2515597_-|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	79.2	1.2e-117
QAV61603.1|2515593_2515941_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	64.3	2.0e-38
QAV61604.1|2516015_2516675_-	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	42.5	7.1e-37
QAV61605.1|2516671_2517792_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
QAV61606.1|2517702_2517882_+	hypothetical protein	NA	NA	NA	NA	NA
QAV61607.1|2518462_2519161_-	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	72.6	1.3e-94
QAV63785.1|2519157_2520015_-	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	70.4	3.4e-100
QAV61608.1|2520159_2520711_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	45.9	5.7e-32
QAV61609.1|2520713_2520932_-	Rha family transcriptional regulator	NA	K7PKS2	Enterobacteria_phage	59.2	4.1e-18
QAV61610.1|2521029_2521413_+	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	77.2	7.5e-47
QAV61611.1|2521476_2521884_+	hypothetical protein	NA	NA	NA	NA	NA
QAV61612.1|2522658_2525796_+	exodeoxyribonuclease	NA	K7P6V4	Enterobacteria_phage	61.9	0.0e+00
QAV61613.1|2525805_2526891_+	enterohemolysin	NA	K7PKR8	Enterobacteria_phage	64.4	1.8e-125
QAV61614.1|2526929_2527172_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	89.7	7.3e-32
QAV61615.1|2527236_2527449_+	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	63.4	4.3e-20
QAV61616.1|2527450_2528689_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	70.7	2.0e-170
QAV61617.1|2528738_2529674_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	95.7	5.2e-142
QAV61618.1|2529716_2531090_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.7	3.3e-52
QAV61619.1|2531575_2532559_-	zinc transporter ZntB	NA	NA	NA	NA	NA
QAV61620.1|2532649_2533780_-	chemoreceptor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.6	5.7e-10
QAV61621.1|2534096_2534585_-	hypothetical protein	NA	NA	NA	NA	NA
QAV61622.1|2534613_2535942_-	hypothetical protein	NA	NA	NA	NA	NA
QAV61623.1|2535965_2536421_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 8
CP035385	Enterobacter hormaechei strain S11_16 chromosome, complete genome	4850296	2929570	2975228	4850296	head,coat,lysis,tail	Enterobacteria_phage(26.23%)	70	NA	NA
QAV61962.1|2929570_2929810_-	hypothetical protein	NA	K7P7E2	Enterobacteria_phage	71.8	4.1e-27
QAV61963.1|2929922_2930285_+	GtrA family protein	NA	U5P0S6	Shigella_phage	84.2	1.2e-49
QAV61964.1|2930281_2931223_+	glycosyltransferase	NA	U5P087	Shigella_phage	91.1	6.1e-159
QAV61965.1|2931219_2932701_+	hypothetical protein	NA	NA	NA	NA	NA
QAV61966.1|2932730_2934755_-	hypothetical protein	NA	F1C5A8	Cronobacter_phage	62.9	1.5e-40
QAV61967.1|2934812_2937290_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	92.5	0.0e+00
QAV61968.1|2937276_2937669_-	peptidoglycan endopeptidase	NA	F1C5F2	Cronobacter_phage	88.7	1.4e-64
QAV61969.1|2937678_2938149_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	92.9	1.8e-79
QAV61970.1|2938148_2938652_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	87.4	4.8e-86
QAV61971.1|2938651_2940976_-|tail	phage tail tape measure protein	tail	A0A1B1W284	Salmonella_phage	51.2	7.8e-147
QAV61972.1|2941033_2941408_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	52.4	1.8e-24
QAV61973.1|2941480_2942224_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	52.2	5.0e-63
QAV61974.1|2942274_2943030_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	52.6	3.8e-58
QAV61975.1|2943088_2943472_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	59.1	1.5e-39
QAV61976.1|2943468_2943837_-	HK97 gp10 family phage protein	NA	F1C5E3	Cronobacter_phage	73.8	8.8e-45
QAV61977.1|2943839_2944190_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	67.0	3.1e-39
QAV61978.1|2944189_2944363_-	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	48.1	1.6e-09
QAV61979.1|2944362_2944743_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	53.7	9.1e-29
QAV61980.1|2944745_2945069_-	hypothetical protein	NA	NA	NA	NA	NA
QAV61981.1|2945101_2946157_-|coat	phage coat protein	coat	R9TMI8	Aeromonas_phage	52.9	2.4e-103
QAV61982.1|2946153_2946615_-	hypothetical protein	NA	B1GS72	Salmonella_phage	51.7	3.4e-30
QAV61983.1|2946614_2947985_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	52.5	9.3e-124
QAV61984.1|2948060_2948546_-	hypothetical protein	NA	NA	NA	NA	NA
QAV63803.1|2948596_2949607_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.0	1.3e-114
QAV61985.1|2949524_2950976_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	50.6	1.1e-117
QAV61986.1|2950987_2952460_-	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	85.7	3.0e-253
QAV61987.1|2952446_2952926_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	87.2	3.3e-60
QAV61988.1|2952958_2953597_-	hypothetical protein	NA	I6S676	Salmonella_phage	91.5	6.9e-114
QAV61989.1|2953600_2953819_-	hypothetical protein	NA	NA	NA	NA	NA
QAV61990.1|2953914_2954115_-	hypothetical protein	NA	NA	NA	NA	NA
QAV61991.1|2954153_2954615_-|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	67.3	2.9e-45
QAV61992.1|2954910_2955405_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	97.0	2.7e-89
QAV61993.1|2955382_2955607_-|lysis	lysis protein	lysis	M9NZI9	Enterobacteria_phage	94.6	2.7e-33
QAV61994.1|2956182_2956806_-	hypothetical protein	NA	A0A2H4FND2	Salmonella_phage	71.1	1.2e-83
QAV61995.1|2956805_2956922_-	hypothetical protein	NA	NA	NA	NA	NA
QAV61996.1|2956918_2957563_-	hypothetical protein	NA	S4TSR3	Salmonella_phage	69.2	2.7e-73
QAV61997.1|2957556_2958057_-	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	52.0	2.0e-36
QAV61998.1|2958020_2958191_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	90.6	8.5e-19
QAV61999.1|2958190_2958772_-	HNH endonuclease	NA	A0A2H4PQR4	Staphylococcus_phage	43.4	4.8e-21
QAV62000.1|2958764_2959196_-	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	42.9	1.3e-26
QAV62001.1|2959699_2960302_-	hypothetical protein	NA	G8C7V0	Escherichia_phage	55.4	3.7e-32
QAV62002.1|2960298_2960688_-	ead/Ea22-like family protein	NA	K7P6V8	Enterobacteria_phage	52.7	1.0e-11
QAV62003.1|2960684_2960885_-	hypothetical protein	NA	NA	NA	NA	NA
QAV62004.1|2960881_2961226_-	ArsR family transcriptional regulator	NA	G8C7U7	Escherichia_phage	87.6	8.5e-50
QAV62005.1|2961222_2962095_-	AAA family ATPase	NA	K7PLU3	Enterobacteria_phage	66.5	1.2e-103
QAV62006.1|2962079_2962949_-	replication protein	NA	K7PGT1	Enterobacteria_phage	51.2	7.9e-68
QAV62007.1|2963295_2963841_-	hypothetical protein	NA	G8C7U3	Escherichia_phage	97.8	8.1e-95
QAV62008.1|2963871_2964090_-	XRE family transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	47.0	1.9e-10
QAV62009.1|2964198_2964858_+	helix-turn-helix domain-containing protein	NA	F1C599	Cronobacter_phage	65.1	7.5e-71
QAV62010.1|2964951_2965713_+	KilA-N domain-containing protein	NA	A0A1L2BWW1	Bacteriophage	46.3	1.1e-09
QAV62011.1|2965851_2966049_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	96.9	1.8e-25
QAV62012.1|2966413_2966839_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	76.6	3.5e-53
QAV62013.1|2966838_2966991_+	DUF3927 domain-containing protein	NA	A0A0A0YRI9	Escherichia_phage	67.4	2.7e-08
QAV62014.1|2967045_2967303_+	hypothetical protein	NA	NA	NA	NA	NA
QAV62015.1|2967454_2967664_+	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	94.2	2.0e-33
QAV62016.1|2967674_2968109_+	hypothetical protein	NA	G0YQE7	Erwinia_phage	61.1	9.4e-46
QAV62017.1|2968181_2968463_+	host nuclease inhibitor GamL	NA	M9NZI3	Enterobacteria_phage	96.8	3.2e-47
QAV62018.1|2968472_2969390_+	recombinase RecT	NA	M9NZA6	Enterobacteria_phage	90.2	5.1e-158
QAV62019.1|2969386_2970067_+	exonuclease	NA	M9NZE1	Enterobacteria_phage	94.7	2.9e-126
QAV62020.1|2970063_2970492_+	regulator	NA	M9NYX4	Enterobacteria_phage	95.1	4.4e-72
QAV62021.1|2970652_2971204_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	58.3	1.1e-54
QAV62022.1|2971200_2971419_+	hypothetical protein	NA	NA	NA	NA	NA
QAV62023.1|2971415_2971952_+	hypothetical protein	NA	J9Q748	Salmonella_phage	74.3	7.2e-72
QAV62024.1|2971948_2972140_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	62.7	1.6e-13
QAV62025.1|2972231_2972450_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	63.9	5.4e-18
QAV62026.1|2972449_2973001_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A218M393	Acidovorax_phage	44.1	6.6e-20
QAV62027.1|2972963_2973203_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	50.0	6.3e-12
QAV62028.1|2973212_2973539_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	81.0	3.3e-43
QAV62029.1|2973641_2973887_+	excisionase	NA	Q8W657	Enterobacteria_phage	67.9	9.4e-27
QAV62030.1|2973932_2975228_+	DUF3596 domain-containing protein	NA	Q20GI2	Phage_258-320	68.9	3.0e-180
>prophage 9
CP035385	Enterobacter hormaechei strain S11_16 chromosome, complete genome	4850296	3062215	3072414	4850296	transposase	Escherichia_phage(37.5%)	9	NA	NA
QAV62105.1|3062215_3063220_+	NAD-dependent epimerase	NA	A0A2K9L4U8	Tupanvirus	29.0	2.5e-33
QAV62106.1|3064695_3065862_-	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	53.5	1.2e-111
QAV62107.1|3066115_3067522_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	5.2e-37
QAV62108.1|3067657_3068209_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	9.1e-54
QAV62109.1|3068216_3069107_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	31.0	5.3e-27
QAV62110.1|3069119_3069986_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.3	2.8e-110
QAV62111.1|3070001_3071066_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	4.9e-104
QAV62112.1|3071145_3071376_-	hypothetical protein	NA	NA	NA	NA	NA
QAV62113.1|3071433_3072414_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
>prophage 10
CP035385	Enterobacter hormaechei strain S11_16 chromosome, complete genome	4850296	4093357	4130844	4850296	head,portal,capsid,plate,lysis,tail,tRNA,integrase,holin,terminase	Erwinia_phage(33.33%)	47	4093326:4093354	4142629:4142657
4093326:4093354	attL	CCCGGTAAGCGCAGCGCCACCGGGCAAAA	NA	NA	NA	NA
QAV63004.1|4093357_4094371_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	5.3e-108
QAV63005.1|4094607_4094823_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
QAV63006.1|4094938_4096684_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	1.4e-76
QAV63007.1|4096837_4098682_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
QAV63008.1|4098784_4099291_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
QAV63841.1|4099647_4099866_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	88.9	2.4e-34
QAV63009.1|4099931_4101101_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	77.7	5.1e-171
QAV63010.1|4101097_4101562_-|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	70.8	1.0e-58
QAV63011.1|4101572_4104023_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	73.7	1.2e-307
QAV63012.1|4104012_4104135_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	89.7	5.9e-14
QAV63013.1|4104167_4104491_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	64.0	2.0e-24
QAV63014.1|4104548_4105067_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	81.4	2.9e-78
QAV63015.1|4105079_4106273_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	81.1	2.8e-185
QAV63016.1|4106663_4107236_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	55.7	2.5e-54
QAV63842.1|4109410_4109941_-|tail	phage tail protein I	tail	Q37841	Escherichia_phage	87.5	4.8e-92
QAV63017.1|4109933_4110842_-|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	83.1	1.6e-135
QAV63018.1|4110847_4111198_-|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	71.6	1.8e-39
QAV63019.1|4111194_4111836_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	82.6	1.0e-96
QAV63020.1|4112009_4113191_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
QAV63021.1|4113241_4113694_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	68.0	3.6e-48
QAV63022.1|4113686_4114154_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	69.0	8.0e-59
QAV63023.1|4114116_4114362_-|holin	holin	holin	S4TNY4	Salmonella_phage	75.3	1.1e-27
QAV63843.1|4114249_4114666_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	68.0	9.3e-43
QAV63024.1|4114665_4115097_-	lysA protein	NA	A0A218M4L6	Erwinia_phage	77.6	6.2e-58
QAV63025.1|4115093_4115606_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	89.4	1.0e-83
QAV63026.1|4115589_4115811_-	primosomal protein	NA	A0A218M4L5	Erwinia_phage	72.6	2.1e-25
QAV63027.1|4115801_4116005_-|tail	phage tail protein	tail	Q858W3	Yersinia_virus	77.6	2.1e-24
QAV63028.1|4116004_4116511_-|head	head completion/stabilization protein	head	O80306	Escherichia_phage	72.0	3.4e-63
QAV63029.1|4116610_4117366_-|terminase	terminase	terminase	Q6K1I5	Salmonella_virus	64.1	1.4e-73
QAV63030.1|4117369_4118437_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	83.6	9.7e-169
QAV63031.1|4118497_4119352_-|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	73.6	8.4e-115
QAV63032.1|4119517_4121287_+|terminase	terminase ATPase subunit family protein	terminase	A0A0M4RE51	Salmonella_phage	84.9	2.1e-301
QAV63033.1|4121288_4122314_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	82.4	1.5e-166
QAV63034.1|4122523_4122679_+	acetyl xylan esterase	NA	NA	NA	NA	NA
QAV63035.1|4122626_4123277_-	hypothetical protein	NA	NA	NA	NA	NA
QAV63036.1|4123300_4123558_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	55.0	8.9e-20
QAV63037.1|4123703_4124435_-	hypothetical protein	NA	Q37850	Escherichia_phage	95.5	7.2e-131
QAV63038.1|4124517_4124958_-	DinI family protein	NA	A0A218M4I0	Erwinia_phage	95.6	4.0e-68
QAV63039.1|4125075_4127292_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	94.0	0.0e+00
QAV63040.1|4127293_4127515_-	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	87.5	1.1e-29
QAV63041.1|4127514_4127742_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	92.0	1.1e-26
QAV63042.1|4127809_4128148_-	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	92.9	8.0e-53
QAV63043.1|4128111_4128312_-	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	93.9	1.1e-30
QAV63044.1|4128319_4128829_-	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	94.7	6.4e-86
QAV63045.1|4128859_4129123_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	93.1	2.1e-40
QAV63046.1|4129258_4129846_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	64.9	1.3e-66
QAV63047.1|4129845_4130844_+|integrase	site-specific integrase	integrase	A0A218M4I3	Erwinia_phage	92.4	2.7e-181
4142629:4142657	attR	CCCGGTAAGCGCAGCGCCACCGGGCAAAA	NA	NA	NA	NA
>prophage 1
CP035386	Enterobacter hormaechei strain S11_16 plasmid unnamed1, complete sequence	119994	1708	61164	119994	transposase,integrase	Escherichia_phage(16.67%)	45	NA	NA
QAV63870.1|1708_2449_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
QAV63871.1|2812_3736_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	1.1e-176
QAV63872.1|4025_4229_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
QAV63975.1|5049_5250_+	hypothetical protein	NA	NA	NA	NA	NA
QAV63873.1|5694_5961_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
QAV63874.1|5948_6431_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
QAV63875.1|6642_7986_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
QAV63876.1|8056_8875_-	hypothetical protein	NA	NA	NA	NA	NA
QAV63877.1|8883_9456_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	47.2	7.8e-40
QAV63878.1|9846_10967_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
QAV63879.1|10877_11066_+	hypothetical protein	NA	NA	NA	NA	NA
QAV63880.1|11080_13078_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	2.0e-21
QAV63881.1|13141_14434_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
QAV63882.1|14474_15455_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
QAV63883.1|22941_23421_-	EAL domain-containing protein	NA	NA	NA	NA	NA
QAV63884.1|23465_24446_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	3.0e-185
QAV63885.1|24768_25773_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
QAV63886.1|26212_26965_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
QAV63887.1|27568_28342_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
QAV63888.1|28407_29109_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
QAV63889.1|29174_30281_-	alkene reductase	NA	NA	NA	NA	NA
QAV63890.1|30493_30823_+	thioredoxin	NA	V9SJ74	Achromobacter_phage	33.7	7.4e-11
QAV63891.1|30852_31191_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
QAV63892.1|31195_31777_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
QAV63893.1|31918_32476_-	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
QAV63894.1|32719_34747_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
QAV63895.1|34743_36078_+	restriction endonuclease subunit S	NA	A0A1V0SLK8	Klosneuvirus	40.9	3.5e-06
QAV63896.1|36078_39336_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
QAV63897.1|39340_40609_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
QAV63898.1|40840_41425_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	36.1	2.6e-22
QAV63899.1|43125_46023_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	9.3e-182
QAV63900.1|46117_46723_+	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
QAV63901.1|47382_48564_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	64.2	1.9e-120
QAV63902.1|48990_49305_-	hypothetical protein	NA	NA	NA	NA	NA
QAV63976.1|49559_49916_-	cupin domain-containing protein	NA	NA	NA	NA	NA
QAV63903.1|49905_50307_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
QAV63904.1|50303_50594_-	nucleotidyltransferase	NA	NA	NA	NA	NA
QAV63905.1|50668_53635_+|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
QAV63906.1|53713_54718_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
QAV63907.1|56519_56861_-	hypothetical protein	NA	NA	NA	NA	NA
QAV63908.1|57858_58734_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
QAV63977.1|58714_58792_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
QAV63909.1|59010_59289_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
QAV63910.1|59440_59986_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.1	1.0e-20
QAV63911.1|60043_61164_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
>prophage 2
CP035386	Enterobacter hormaechei strain S11_16 plasmid unnamed1, complete sequence	119994	103418	108954	119994		Pectobacterium_phage(16.67%)	10	NA	NA
QAV63958.1|103418_103673_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.0	2.1e-13
QAV63959.1|103865_104057_-	hypothetical protein	NA	NA	NA	NA	NA
QAV63960.1|104099_104606_-	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	31.8	3.7e-09
QAV63961.1|105004_105784_-	hypothetical protein	NA	NA	NA	NA	NA
QAV63962.1|105837_106257_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
QAV63963.1|106240_106489_-	hypothetical protein	NA	NA	NA	NA	NA
QAV63964.1|106488_107166_-	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	37.5	1.6e-28
QAV63965.1|107525_108197_+	DNA breaking-rejoining protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	3.3e-82
QAV63966.1|108376_108799_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.5	2.4e-30
QAV63967.1|108798_108954_+	DNA repair protein	NA	I6RSM4	Salmonella_phage	74.5	3.0e-15
>prophage 1
CP035387	Enterobacter hormaechei strain S11_16 plasmid unnamed2, complete sequence	63369	4060	43930	63369	integrase,transposase	Escherichia_phage(20.0%)	43	NA	NA
QAV63982.1|4060_4765_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
QAV63983.1|5265_6126_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
QAV63984.1|6384_7266_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
QAV63985.1|8225_8831_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
QAV63986.1|8925_11823_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.9	1.1e-182
QAV63987.1|12780_12960_-	hypothetical protein	NA	NA	NA	NA	NA
QAV63988.1|12959_13955_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
QAV63989.1|13996_15157_-	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
QAV64042.1|15156_15978_-	conjugal transfer protein TraO	NA	NA	NA	NA	NA
QAV63990.1|16051_16750_-	type IV secretion system protein	NA	NA	NA	NA	NA
QAV63991.1|16739_16886_-	conjugal transfer protein TraN	NA	NA	NA	NA	NA
QAV63992.1|16968_18009_-	type IV secretion system protein	NA	NA	NA	NA	NA
QAV63993.1|18024_18252_-	entry exclusion protein	NA	NA	NA	NA	NA
QAV63994.1|18259_18973_-	type IV secretion system protein	NA	NA	NA	NA	NA
QAV63995.1|18990_21591_-	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
QAV63996.1|21590_21908_-	type IV secretion system protein VirB3	NA	NA	NA	NA	NA
QAV63997.1|21958_22252_-	conjugal transfer protein TraM	NA	NA	NA	NA	NA
QAV63998.1|22261_22543_-	transcriptional regulator	NA	NA	NA	NA	NA
QAV63999.1|22551_23289_-	traL protein	NA	NA	NA	NA	NA
QAV64000.1|23352_23703_+	KorB	NA	NA	NA	NA	NA
QAV64001.1|23718_24063_+	hypothetical protein	NA	NA	NA	NA	NA
QAV64002.1|24059_24374_+	IncN plasmid KikA protein	NA	NA	NA	NA	NA
QAV64003.1|24409_24721_+	hypothetical protein	NA	NA	NA	NA	NA
QAV64004.1|25078_26002_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.7	6.2e-172
QAV64005.1|26097_26484_+	restriction endonuclease	NA	NA	NA	NA	NA
QAV64006.1|26488_26695_+	hypothetical protein	NA	NA	NA	NA	NA
QAV64007.1|27076_28510_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	51.2	7.0e-106
QAV64008.1|28543_29752_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
QAV64009.1|29997_30567_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	42.6	9.8e-35
QAV64043.1|30712_31024_-	hypothetical protein	NA	NA	NA	NA	NA
QAV64010.1|31878_32583_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
QAV64044.1|32891_33536_-	quinolone resistance pentapeptide repeat protein QnrB5	NA	NA	NA	NA	NA
QAV64045.1|34024_34864_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
QAV64011.1|35268_36810_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
QAV64012.1|37075_37576_+	hypothetical protein	NA	A0A1V0SB21	Catovirus	31.7	3.3e-10
QAV64013.1|37575_38145_+	trimethoprim-resistant dihydrofolate reductase DfrA19	NA	A0A1V0SD48	Indivirus	27.2	3.5e-08
QAV64046.1|38527_38779_-|transposase	transposase	transposase	NA	NA	NA	NA
QAV64014.1|38747_39761_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
QAV64015.1|39918_40722_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
QAV64016.1|40721_41558_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
QAV64017.1|41738_42530_+	sprT domain-containing protein	NA	NA	NA	NA	NA
QAV64018.1|42544_42886_-	ArdK family transcriptional regulator	NA	NA	NA	NA	NA
QAV64019.1|43225_43930_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
