The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033621	Streptococcus pyogenes strain M75 chromosome, complete genome	1852894	36640	49027	1852894		Synechococcus_phage(28.57%)	8	NA	NA
QAZ36195.1|36640_40366_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	27.4	9.2e-41
QAZ36196.1|40599_42054_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.5	8.3e-54
QAZ36197.1|42081_43104_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	41.4	4.0e-63
QAZ36198.1|43271_43826_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.1	2.4e-25
QAZ36199.1|44009_45557_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase PurH	NA	E3SNU8	Prochlorococcus_phage	52.4	4.4e-45
QAZ36200.1|45614_46739_-	CHAP domain-containing protein	NA	F8HGP2	Streptococcus_phage	28.6	7.7e-07
QAZ36201.1|46991_48257_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
QAZ36202.1|48535_49027_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.3	1.9e-18
>prophage 2
CP033621	Streptococcus pyogenes strain M75 chromosome, complete genome	1852894	612732	623335	1852894		Streptococcus_phage(57.14%)	9	NA	NA
QAZ36716.1|612732_614943_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	68.9	6.5e-268
QAZ36717.1|615050_616214_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	65.1	3.4e-143
QAZ36718.1|616210_616897_+	3-dehydroquinase	NA	W6LP76	Streptococcus_phage	68.9	7.0e-88
QAZ36719.1|616990_618157_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.2	1.9e-32
QAZ36720.1|618217_618559_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	41.1	2.6e-19
QAZ36721.1|618779_620132_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	23.8	4.5e-30
QAZ36722.1|620219_621488_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
QAZ36723.1|621517_621958_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ36724.1|622192_623335_+	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	27.3	1.4e-24
>prophage 3
CP033621	Streptococcus pyogenes strain M75 chromosome, complete genome	1852894	715157	766650	1852894	holin,capsid,head,integrase,terminase,tail,tRNA,portal	Streptococcus_pyogenes_phage(47.27%)	66	715737:715752	770902:770917
QAZ36811.1|715157_716057_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
715737:715752	attL	GACCGTATCAATCAGC	NA	NA	NA	NA
QAZ36812.1|716129_717368_+	GTPase HflX	NA	NA	NA	NA	NA
QAZ36813.1|717360_717996_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
QAZ36814.1|718010_718940_+	ribonuclease Z	NA	NA	NA	NA	NA
QAZ36815.1|718939_719704_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
QAZ36816.1|719700_721911_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.2	5.1e-71
QAZ36817.1|722060_722579_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	42.4	3.9e-30
QAZ36818.1|722659_723343_+	DnaD domain protein	NA	Q938N2	Temperate_phage	36.8	2.9e-09
QAZ36819.1|723339_723996_+	endonuclease III	NA	NA	NA	NA	NA
QAZ36820.1|724067_724754_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
QAZ36821.1|724743_725532_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
QAZ36822.1|725571_726678_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
QAZ36823.1|726735_727605_+	glucose-1-phosphate thymidylyltransferase	NA	K7QKA7	Escherichia_phage	64.6	2.4e-101
QAZ36824.1|727604_728198_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	H9NC63	Sphingomonas_phage	28.2	3.7e-08
QAZ36825.1|728441_729482_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	43.9	8.5e-69
QAZ36826.1|729564_730704_-|integrase	site-specific integrase	integrase	A1EAB7	Streptococcus_phage	55.8	4.4e-119
QAZ36827.1|730825_731512_-	hypothetical protein	NA	A0A1P8VVT3	Streptococcus_phage	100.0	5.7e-122
QAZ36828.1|731845_732223_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1P8VVK5	Streptococcus_phage	100.0	4.0e-69
QAZ36829.1|732206_732566_-	XRE family transcriptional regulator	NA	A0A1P8VVN3	Streptococcus_phage	98.3	1.8e-58
QAZ36830.1|732754_732973_+	XRE family transcriptional regulator	NA	A0A1P8VVR5	Streptococcus_phage	100.0	4.1e-34
QAZ36831.1|733067_733319_+	hypothetical protein	NA	A0A1P8VVV6	Streptococcus_phage	100.0	2.8e-42
QAZ36832.1|733499_733814_+	XRE family transcriptional regulator	NA	A0A1P8VVN6	Streptococcus_phage	100.0	1.7e-52
QAZ36833.1|734040_734523_+	siphovirus Gp157 family protein	NA	A0A1P8VVS5	Streptococcus_phage	100.0	1.2e-78
QAZ36834.1|734523_735204_+	AAA family ATPase	NA	A0A1P8VVS4	Streptococcus_phage	100.0	1.6e-129
QAZ36835.1|735305_736535_+	DEAD/DEAH box helicase	NA	A0A1P8VVM2	Streptococcus_phage	100.0	3.3e-237
QAZ36836.1|736550_737009_+	DUF669 domain-containing protein	NA	A0A1P8VVN0	Streptococcus_phage	100.0	3.8e-82
QAZ36837.1|737011_737824_+	hypothetical protein	NA	A0A1P8VVM6	Streptococcus_phage	99.6	5.5e-156
QAZ36838.1|737813_739295_+	DNA primase	NA	A0A1P8VVM0	Streptococcus_phage	100.0	1.3e-296
QAZ36839.1|739539_739860_+	VRR-NUC domain-containing protein	NA	A0A1P8VVL5	Streptococcus_phage	100.0	2.0e-53
QAZ36840.1|739843_740200_+	hypothetical protein	NA	A0A1P8VVP9	Streptococcus_phage	100.0	5.0e-61
QAZ36841.1|740196_740448_+	hypothetical protein	NA	A0A1P8VVV4	Streptococcus_phage	100.0	4.3e-43
QAZ36842.1|740441_740726_+	DUF3310 domain-containing protein	NA	A0A1P8VVP5	Streptococcus_phage	100.0	7.0e-50
QAZ36843.1|740722_740992_+	hypothetical protein	NA	A0A1P8VVR6	Streptococcus_phage	100.0	3.1e-47
QAZ36844.1|741001_741406_+	hypothetical protein	NA	Q938M1	Temperate_phage	100.0	6.0e-71
QAZ36845.1|741569_742076_+	DUF1642 domain-containing protein	NA	Q938L9	Temperate_phage	100.0	9.8e-95
QAZ36846.1|742516_742957_+	ArpU family transcriptional regulator	NA	Q938L8	Temperate_phage	100.0	5.0e-79
QAZ36847.1|743104_743485_+	hypothetical protein	NA	A0A097PAR5	Streptococcus_pyogenes_phage	100.0	1.0e-64
QAZ36848.1|743474_744749_+|terminase	PBSX family phage terminase large subunit	terminase	A0A097PAV9	Streptococcus_pyogenes_phage	99.8	1.9e-251
QAZ36849.1|744748_746074_+|portal	phage portal protein	portal	A0A097PAT2	Streptococcus_pyogenes_phage	95.6	6.3e-234
QAZ36850.1|746042_746951_+|head	phage head morphogenesis protein	head	A0A097PBF2	Streptococcus_pyogenes_phage	94.5	2.4e-83
QAZ36851.1|746957_747188_+	hypothetical protein	NA	Q938K9	Temperate_phage	62.5	4.0e-19
QAZ36852.1|747299_747869_+	DUF4355 domain-containing protein	NA	A0A097PAW3	Streptococcus_pyogenes_phage	90.5	1.4e-60
QAZ36853.1|747887_748778_+|capsid	phage capsid protein	capsid	A0A097PAW2	Streptococcus_pyogenes_phage	99.4	8.6e-86
QAZ36854.1|748789_749083_+	hypothetical protein	NA	A0A097PBF3	Streptococcus_pyogenes_phage	99.0	1.3e-46
QAZ36855.1|749096_749441_+	hypothetical protein	NA	A0A097PAS2	Streptococcus_pyogenes_phage	99.1	1.5e-54
QAZ36856.1|749437_749749_+	hypothetical protein	NA	A0A097PAW7	Streptococcus_pyogenes_phage	94.2	4.6e-47
QAZ36857.1|749745_750141_+	hypothetical protein	NA	A0A097PAT9	Streptococcus_pyogenes_phage	93.0	1.8e-56
QAZ36858.1|750142_750553_+	DUF5072 domain-containing protein	NA	A0A097PAW5	Streptococcus_pyogenes_phage	99.3	1.8e-70
QAZ36859.1|750564_751071_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	98.7	8.3e-78
QAZ36860.1|751083_751401_+	hypothetical protein	NA	A0A097PAS6	Streptococcus_pyogenes_phage	98.1	1.9e-51
QAZ36861.1|751373_751832_+	hypothetical protein	NA	A0A097PAX1	Streptococcus_pyogenes_phage	93.4	7.0e-76
QAZ36862.1|751824_753630_+|tail	phage tail protein	tail	A0A097PAU2	Streptococcus_pyogenes_phage	95.5	9.1e-252
QAZ36863.1|753630_755115_+|tail	phage tail protein	tail	A0A097PAW9	Streptococcus_pyogenes_phage	98.8	1.8e-290
QAZ36864.1|755115_758565_+	CHAP domain-containing protein	NA	A0A097PBF5	Streptococcus_pyogenes_phage	99.0	0.0e+00
QAZ36865.1|758569_760432_+	hypothetical protein	NA	A0A097PAT0	Streptococcus_pyogenes_phage	99.8	0.0e+00
QAZ36866.1|760442_760790_+	DUF1366 domain-containing protein	NA	A0A097PAX5	Streptococcus_pyogenes_phage	100.0	3.5e-59
QAZ36867.1|760939_761263_+	hypothetical protein	NA	A0A097PAX2	Streptococcus_pyogenes_phage	100.0	7.7e-53
QAZ36868.1|761262_761595_+|holin	phage holin	holin	A0A097PBF6	Streptococcus_pyogenes_phage	100.0	5.7e-51
QAZ36869.1|761596_762361_+	CHAP domain-containing protein	NA	A0A097PAT3	Streptococcus_pyogenes_phage	100.0	1.5e-150
QAZ36870.1|762372_762975_+	hypothetical protein	NA	A0A097PAX9	Streptococcus_pyogenes_phage	98.8	7.8e-91
QAZ36871.1|762985_763759_+	hypothetical protein	NA	A0A097PAV0	Streptococcus_pyogenes_phage	94.6	4.6e-128
QAZ36872.1|763768_763990_+	hypothetical protein	NA	A0A097PAX7	Streptococcus_pyogenes_phage	84.5	2.5e-18
QAZ36873.1|763989_764649_+	hypothetical protein	NA	A0A097PBF7	Streptococcus_pyogenes_phage	96.3	6.3e-118
QAZ36874.1|764717_765152_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ36875.1|765423_766230_-	deoxyribonuclease	NA	NA	NA	NA	NA
QAZ36876.1|766461_766650_+	Paratox	NA	A3F673	Streptococcus_phage	73.3	6.1e-18
770902:770917	attR	GCTGATTGATACGGTC	NA	NA	NA	NA
>prophage 4
CP033621	Streptococcus pyogenes strain M75 chromosome, complete genome	1852894	1116621	1189665	1852894	capsid,head,integrase,tail,terminase,tRNA,portal	Streptococcus_phage(49.18%)	87	1144370:1144389	1187050:1187069
QAZ37186.1|1116621_1117650_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
QAZ37187.1|1117656_1118877_+	DUF3114 domain-containing protein	NA	NA	NA	NA	NA
QAZ37188.1|1119564_1119813_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ37189.1|1120184_1120790_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	52.7	3.9e-58
QAZ37190.1|1120886_1121927_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
QAZ37191.1|1121997_1124241_-	DNA internalization-related competence protein ComEC/Rec2	NA	M1PSD2	Streptococcus_phage	58.2	7.5e-54
QAZ37192.1|1124221_1124884_-	ComEA family DNA-binding protein	NA	NA	NA	NA	NA
QAZ37193.1|1125083_1125902_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
QAZ37905.1|1125941_1126718_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
QAZ37194.1|1126707_1126986_+	GIY-YIG nuclease family protein	NA	W8W2G4	Invertebrate_iridovirus	36.0	7.9e-06
QAZ37195.1|1127009_1129010_-	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	34.0	3.4e-66
QAZ37196.1|1129137_1130757_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.5	1.5e-59
QAZ37197.1|1131063_1132608_-	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	28.8	1.1e-35
QAZ37906.1|1132561_1132786_+	hypothetical protein	NA	NA	NA	NA	NA
QAZ37198.1|1132855_1133551_-	TIGR02206 family membrane protein	NA	NA	NA	NA	NA
QAZ37199.1|1133630_1135022_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
QAZ37200.1|1135220_1136267_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
QAZ37201.1|1136367_1136964_-	recombination protein RecR	NA	NA	NA	NA	NA
QAZ37202.1|1137010_1137202_-	penicillin-binding protein	NA	NA	NA	NA	NA
QAZ37203.1|1137762_1138542_-	formate-nitrite transporter	NA	NA	NA	NA	NA
QAZ37204.1|1138665_1139208_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ37205.1|1139368_1139890_-	transcription repressor NadR	NA	NA	NA	NA	NA
QAZ37206.1|1139996_1140692_-	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
QAZ37207.1|1140930_1141866_+	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	44.8	3.0e-65
QAZ37208.1|1142165_1144028_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.0	1.9e-90
1144370:1144389	attL	AATTATTTAACAGCGTCTTT	NA	NA	NA	NA
QAZ37209.1|1144558_1144741_-	Paratox	NA	A3F673	Streptococcus_phage	81.7	4.4e-21
QAZ37210.1|1144855_1145644_-	exotoxin M precursor	NA	Q938J1	Temperate_phage	41.4	9.1e-47
QAZ37211.1|1145925_1146639_-	pyrogenic exotoxin SpeK	NA	Q938J1	Temperate_phage	59.1	9.0e-78
QAZ37212.1|1147022_1147616_-	N-acetyltransferase	NA	A0A0A8WFI2	Clostridium_phage	38.2	2.4e-23
QAZ37213.1|1147615_1147819_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ37214.1|1147928_1148573_-	CHAP domain-containing protein	NA	Q938J4	Temperate_phage	78.6	3.6e-94
QAZ37215.1|1148682_1149375_-	AP2 domain-containing protein	NA	A0A2H4J2S8	uncultured_Caudovirales_phage	34.2	1.5e-32
QAZ37216.1|1149607_1150165_-	cell wall hydrolase	NA	Q938J4	Temperate_phage	89.2	2.8e-95
QAZ37217.1|1150275_1150461_-	hypothetical protein	NA	Q938J5	Temperate_phage	100.0	1.7e-25
QAZ37218.1|1150457_1150754_-	hypothetical protein	NA	Q938J6	Temperate_phage	99.0	2.9e-46
QAZ37219.1|1150764_1151397_-	hypothetical protein	NA	Q938J7	Temperate_phage	50.0	2.6e-44
QAZ37220.1|1151399_1151828_-	DUF1617 family protein	NA	Q938J8	Temperate_phage	89.3	9.8e-64
QAZ37221.1|1151839_1153726_-	hyaluronidase	NA	Q938J9	Temperate_phage	84.9	8.1e-219
QAZ37222.1|1153740_1154754_-	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	98.2	1.6e-181
QAZ37223.1|1154753_1156859_-	hypothetical protein	NA	A3F656	Streptococcus_phage	43.1	2.3e-129
QAZ37224.1|1156855_1157626_-|tail	phage tail protein	tail	A1EAB1	Streptococcus_phage	45.0	1.2e-56
QAZ37225.1|1157625_1160376_-|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	36.4	8.3e-55
QAZ37226.1|1160372_1160690_-	hypothetical protein	NA	A1EAF6	Streptococcus_phage	44.4	6.9e-14
QAZ37227.1|1160710_1161079_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ37228.1|1161132_1161651_-|tail	phage major tail protein, TP901-1 family	tail	A1EAF4	Streptococcus_phage	51.7	2.2e-41
QAZ37229.1|1161638_1162037_-	DUF3168 domain-containing protein	NA	A1EAF3	Streptococcus_phage	44.5	3.8e-25
QAZ37230.1|1162033_1162390_-	hypothetical protein	NA	A1EAF2	Streptococcus_phage	44.0	4.7e-19
QAZ37231.1|1162389_1162686_-	hypothetical protein	NA	A0A1P8BKV3	Lactococcus_phage	35.6	9.6e-10
QAZ37232.1|1162682_1163036_-	hypothetical protein	NA	A0A2H4J002	uncultured_Caudovirales_phage	52.1	3.9e-26
QAZ37233.1|1163047_1163314_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ37234.1|1163325_1164375_-|capsid	major capsid protein E	capsid	A0A286QR01	Streptococcus_phage	57.7	1.8e-106
QAZ37235.1|1164377_1164758_-|head	head decoration protein	head	A0A0K2CNR0	Brevibacillus_phage	36.3	6.4e-06
QAZ37236.1|1164767_1165301_-	DUF4355 domain-containing protein	NA	A0A141E0S7	Streptococcus_phage	82.5	1.8e-14
QAZ37237.1|1165444_1165711_-	hypothetical protein	NA	A0A097PAR8	Streptococcus_pyogenes_phage	77.3	4.1e-28
QAZ37238.1|1165726_1166641_-|head	phage head morphogenesis protein	head	A1EAE3	Streptococcus_phage	50.0	2.2e-73
QAZ37239.1|1166621_1168112_-|portal	phage portal protein	portal	C9W9H5	Streptococcus_virus	54.0	1.3e-142
QAZ37240.1|1168123_1169431_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4IYR5	uncultured_Caudovirales_phage	75.0	2.9e-183
QAZ37907.1|1169408_1169861_-|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	95.7	1.7e-66
QAZ37241.1|1169950_1170367_-	transcriptional regulator	NA	A7J289	Streptococcus_phage	99.3	3.3e-72
QAZ37242.1|1170499_1170772_-	hypothetical protein	NA	A7J287	Streptococcus_phage	73.3	5.7e-25
QAZ37243.1|1170936_1172259_-	DEAD/DEAH box helicase	NA	A7J284	Streptococcus_phage	97.5	4.3e-251
QAZ37244.1|1172255_1172531_-	VRR-NUC domain-containing protein	NA	A7J283	Streptococcus_phage	96.7	2.9e-45
QAZ37245.1|1172916_1175301_-	DNA primase	NA	A7J282	Streptococcus_phage	94.6	6.3e-277
QAZ37246.1|1175305_1177228_-	DNA polymerase	NA	A7J280	Streptococcus_phage	99.1	0.0e+00
QAZ37247.1|1177270_1177834_-	DUF2815 family protein	NA	D2J040	Enterococcus_phage	58.5	3.3e-51
QAZ37248.1|1177842_1179000_-	DUF2800 domain-containing protein	NA	A7J278	Streptococcus_phage	98.2	1.0e-216
QAZ37249.1|1178999_1179299_-	hypothetical protein	NA	A7J277	Streptococcus_phage	96.0	3.7e-41
QAZ37250.1|1179386_1179590_-	hypothetical protein	NA	A7J276	Streptococcus_phage	89.6	3.7e-29
QAZ37251.1|1179735_1180122_-	hypothetical protein	NA	A7J274	Streptococcus_phage	87.4	6.8e-56
QAZ37252.1|1180118_1180322_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ37253.1|1180314_1180485_-	hypothetical protein	NA	A7J273	Streptococcus_phage	87.5	2.9e-19
QAZ37254.1|1180486_1180798_-	excisionase	NA	A0A1S5SA25	Streptococcus_phage	78.6	1.4e-43
QAZ37255.1|1180875_1181061_-	XRE family transcriptional regulator	NA	A0A1X9I6I3	Streptococcus_phage	72.1	3.3e-16
QAZ37256.1|1181227_1181467_+	hypothetical protein	NA	NA	NA	NA	NA
QAZ37257.1|1181616_1181826_+	hypothetical protein	NA	NA	NA	NA	NA
QAZ37258.1|1181784_1182030_-	hypothetical protein	NA	A0A097PAP6	Streptococcus_pyogenes_phage	95.1	1.2e-34
QAZ37259.1|1182071_1182278_-	XRE family transcriptional regulator	NA	A0A1X9I5S3	Streptococcus_phage	64.7	1.1e-17
QAZ37260.1|1182327_1182834_+	hypothetical protein	NA	NA	NA	NA	NA
QAZ37261.1|1183031_1183631_+	hypothetical protein	NA	A0A097PAT4	Streptococcus_pyogenes_phage	99.5	9.1e-108
QAZ37262.1|1183661_1183820_-	hypothetical protein	NA	A0A097PAP2	Streptococcus_pyogenes_phage	98.1	1.1e-23
QAZ37263.1|1184209_1184968_+	helix-turn-helix domain-containing protein	NA	A0A097PBE5	Streptococcus_pyogenes_phage	65.9	3.1e-84
QAZ37264.1|1185002_1185683_+	hypothetical protein	NA	A0A097PAS7	Streptococcus_pyogenes_phage	87.7	1.2e-74
QAZ37265.1|1185819_1186962_+|integrase	site-specific integrase	integrase	M1NRJ9	Streptococcus_phage	77.4	2.4e-173
QAZ37266.1|1187051_1187327_-	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	73.0	2.6e-25
1187050:1187069	attR	AATTATTTAACAGCGTCTTT	NA	NA	NA	NA
QAZ37267.1|1187425_1188013_-	DUF2140 family protein	NA	NA	NA	NA	NA
QAZ37268.1|1187990_1188851_-	GDSL family lipase	NA	NA	NA	NA	NA
QAZ37908.1|1188825_1189665_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.7	1.2e-12
>prophage 5
CP033621	Streptococcus pyogenes strain M75 chromosome, complete genome	1852894	1428653	1524485	1852894	holin,tRNA,capsid,integrase,tail,terminase,transposase,portal	Temperate_phage(50.0%)	108	1479751:1479768	1521561:1521578
QAZ37479.1|1428653_1430120_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
QAZ37480.1|1430119_1430422_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
QAZ37481.1|1431074_1431260_+	hypothetical protein	NA	NA	NA	NA	NA
QAZ37482.1|1431415_1431970_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	38.5	2.0e-24
QAZ37483.1|1432116_1432899_-	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
QAZ37484.1|1433116_1434331_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
QAZ37485.1|1434507_1435014_+	universal stress protein	NA	NA	NA	NA	NA
QAZ37486.1|1435136_1436525_-	Cof-type HAD-IIB family hydrolase	NA	A0A0H3UZF4	Geobacillus_virus	37.1	2.1e-22
QAZ37487.1|1436596_1437562_+	asparaginase	NA	NA	NA	NA	NA
QAZ37488.1|1437910_1438615_-	ABC transporter permease	NA	NA	NA	NA	NA
QAZ37489.1|1438627_1439530_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.2	3.9e-38
QAZ37490.1|1439821_1441837_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
QAZ37491.1|1442033_1442174_+	cytosine deaminase	NA	NA	NA	NA	NA
QAZ37492.1|1442211_1443606_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.6	3.1e-13
QAZ37493.1|1443602_1444283_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
QAZ37494.1|1444279_1444873_-	Trep_Strep domain-containing protein	NA	NA	NA	NA	NA
QAZ37495.1|1444869_1446540_-	ABC transporter ATP-binding protein	NA	F2Y165	Organic_Lake_phycodnavirus	29.1	1.3e-18
QAZ37496.1|1446532_1448296_-	ABC transporter ATP-binding protein/permease	NA	F2Y1V5	Organic_Lake_phycodnavirus	31.1	1.7e-21
QAZ37497.1|1448292_1449129_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.4	5.1e-16
QAZ37498.1|1449125_1450148_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.5	1.2e-14
QAZ37499.1|1450149_1451034_-	heme ABC transporter substrate-binding protein IsdE	NA	NA	NA	NA	NA
QAZ37500.1|1451017_1451893_-	heme-binding protein	NA	NA	NA	NA	NA
QAZ37501.1|1452089_1455917_-	DUF1533 domain-containing protein	NA	NA	NA	NA	NA
QAZ37502.1|1456406_1457918_-	CHAP domain-containing protein	NA	NA	NA	NA	NA
QAZ37503.1|1458004_1459105_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	31.0	3.3e-31
QAZ37504.1|1459101_1459458_-	holo-ACP synthase	NA	NA	NA	NA	NA
QAZ37505.1|1459573_1462093_-	protein translocase subunit SecA	NA	NA	NA	NA	NA
QAZ37506.1|1462170_1462254_-	exfoliative toxin	NA	NA	NA	NA	NA
QAZ37507.1|1462258_1463392_-|transposase	ISAs1-like element IS1548 family transposase	transposase	NA	NA	NA	NA
QAZ37508.1|1463552_1464506_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
QAZ37509.1|1464600_1465485_-	ROK family protein	NA	NA	NA	NA	NA
QAZ37510.1|1465748_1468760_-	endo-beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
QAZ37511.1|1468990_1470874_-	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
QAZ37512.1|1471115_1472555_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
QAZ37513.1|1472559_1473525_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.7	8.0e-21
QAZ37514.1|1473665_1474118_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
QAZ37515.1|1474110_1474500_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
QAZ37516.1|1474545_1475103_-	elongation factor P	NA	NA	NA	NA	NA
QAZ37517.1|1475198_1475660_-	competence protein ComE	NA	F8WPT6	Bacillus_phage	54.3	1.3e-32
QAZ37518.1|1475694_1476768_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	32.8	2.7e-17
QAZ37519.1|1476883_1479712_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.5	8.5e-305
1479751:1479768	attL	CTTATATTATAACAAAAA	NA	NA	NA	NA
QAZ37520.1|1479937_1480120_-	Paratox	NA	A3F673	Streptococcus_phage	83.3	4.4e-21
QAZ37521.1|1480351_1481341_+	deoxyribonuclease	NA	A7J2B8	Streptococcus_phage	97.7	4.9e-167
QAZ37522.1|1481403_1482240_-	hypothetical protein	NA	Q938J2	Temperate_phage	47.7	6.2e-54
QAZ37523.1|1482243_1482786_-	DUF4065 domain-containing protein	NA	Q938J3	Temperate_phage	49.4	5.4e-43
QAZ37524.1|1482922_1484119_-	CHAP domain-containing protein	NA	A7J2B5	Streptococcus_phage	81.2	4.0e-195
QAZ37525.1|1484230_1484686_-|holin	holin	holin	A0A0M4R3G6	Streptococcus_phage	81.5	5.2e-63
QAZ37526.1|1484701_1485307_-	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	93.0	4.6e-83
QAZ37527.1|1485309_1485741_-	DUF1617 family protein	NA	Q938J8	Temperate_phage	92.3	1.6e-66
QAZ37528.1|1485752_1487642_-	hyaluronidase	NA	Q938J9	Temperate_phage	77.4	6.5e-192
QAZ37529.1|1487652_1487982_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ37530.1|1487968_1489183_-	hypothetical protein	NA	A3F657	Streptococcus_phage	49.5	5.0e-44
QAZ37531.1|1489179_1491327_-	peptidase	NA	Q938K1	Temperate_phage	95.2	0.0e+00
QAZ37532.1|1491323_1492040_-|tail	phage tail protein	tail	Q938K2	Temperate_phage	99.2	7.2e-136
QAZ37533.1|1492036_1495297_-	tape measure domain-containing protein	NA	Q938K3	Temperate_phage	98.6	0.0e+00
QAZ37534.1|1495286_1495868_-	hypothetical protein	NA	Q938K4	Temperate_phage	98.4	1.6e-104
QAZ37535.1|1495871_1496306_-	hypothetical protein	NA	Q938K5	Temperate_phage	99.3	2.9e-71
QAZ37536.1|1496344_1496830_-|tail	phage tail protein	tail	Q938K6	Temperate_phage	100.0	1.6e-86
QAZ37537.1|1496829_1497228_-|capsid	capsid protein	capsid	Q79S87	Temperate_phage	100.0	3.5e-71
QAZ37538.1|1497224_1497581_-|capsid	capsid protein	capsid	Q79S88	Temperate_phage	100.0	4.5e-62
QAZ37539.1|1497580_1497913_-|capsid	minor capsid protein	capsid	Q79S86	Temperate_phage	100.0	9.6e-59
QAZ37540.1|1497902_1498319_-	hypothetical protein	NA	Q938K7	Temperate_phage	99.1	4.3e-56
QAZ37541.1|1498372_1499191_-|capsid	N4-gp56 family major capsid protein	capsid	Q79S85	Temperate_phage	100.0	4.0e-146
QAZ37542.1|1499194_1499809_-	hypothetical protein	NA	Q938K8	Temperate_phage	95.0	3.1e-95
QAZ37543.1|1499934_1500201_-	hypothetical protein	NA	Q938K9	Temperate_phage	95.5	8.3e-37
QAZ37544.1|1500287_1500515_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ37545.1|1500514_1502008_-|capsid	capsid protein	capsid	Q938L1	Temperate_phage	80.8	2.1e-214
QAZ37546.1|1502012_1503515_-|portal	phage portal protein	portal	Q938L2	Temperate_phage	99.6	5.9e-281
QAZ37547.1|1503528_1504740_-|terminase	PBSX family phage terminase large subunit	terminase	Q938L3	Temperate_phage	99.7	3.7e-225
QAZ37917.1|1504822_1505296_-	hypothetical protein	NA	Q938L4	Temperate_phage	99.4	4.3e-76
QAZ37548.1|1505346_1505724_-	ASCH domain-containing protein	NA	Q938L5	Temperate_phage	100.0	1.7e-67
QAZ37549.1|1505784_1506216_-	N-acetyltransferase	NA	B5SP24	Lactococcus_phage	56.9	3.0e-36
QAZ37550.1|1506733_1507258_-	chromosome partitioning protein ParB	NA	Q938L7	Temperate_phage	100.0	1.5e-90
QAZ37551.1|1507334_1507520_+	hypothetical protein	NA	NA	NA	NA	NA
QAZ37552.1|1507494_1507758_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ37553.1|1507832_1508051_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ37554.1|1508170_1508608_-	DUF1492 domain-containing protein	NA	A0A097PBF1	Streptococcus_pyogenes_phage	99.3	1.4e-76
QAZ37555.1|1508972_1509266_-	hypothetical protein	NA	A0A097PAR1	Streptococcus_pyogenes_phage	99.0	2.7e-49
QAZ37556.1|1509313_1510102_-	site-specific DNA-methyltransferase	NA	A0A1S5SE41	Streptococcus_phage	91.9	3.7e-133
QAZ37557.1|1510067_1510550_-	class I SAM-dependent methyltransferase	NA	A0A097PAU8	Streptococcus_pyogenes_phage	98.8	9.6e-92
QAZ37558.1|1510553_1510838_-	hypothetical protein	NA	A3F628	Streptococcus_phage	79.8	7.8e-33
QAZ37559.1|1510834_1511248_-	hypothetical protein	NA	Q938M1	Temperate_phage	65.2	4.9e-36
QAZ37560.1|1511244_1511439_-	hypothetical protein	NA	A3F626	Streptococcus_phage	91.9	2.6e-11
QAZ37561.1|1511425_1511824_-	hypothetical protein	NA	A0A286QMU6	Streptococcus_phage	48.8	6.6e-30
QAZ37562.1|1512100_1512898_-	hypothetical protein	NA	J7KGZ1	Streptococcus_phage	82.3	1.3e-125
QAZ37563.1|1512890_1513091_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ37564.1|1513087_1514014_-	recombinase RecT	NA	M1NRN6	Streptococcus_phage	71.8	1.2e-90
QAZ37565.1|1514016_1514346_-	hypothetical protein	NA	J7KGX3	Streptococcus_phage	86.2	1.1e-46
QAZ37566.1|1514401_1514608_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ37567.1|1514616_1514757_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ37568.1|1514753_1514987_-	hypothetical protein	NA	Q938N1	Temperate_phage	96.1	2.8e-36
QAZ37569.1|1514967_1515354_-	DnaD domain protein	NA	Q938N2	Temperate_phage	51.9	8.1e-25
QAZ37570.1|1515494_1515749_-	transcriptional regulator	NA	A0A1S5S9Z1	Streptococcus_phage	41.3	7.7e-08
QAZ37571.1|1515857_1516043_-	hypothetical protein	NA	Q938N3	Temperate_phage	95.1	1.2e-23
QAZ37572.1|1516071_1516329_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ37573.1|1516435_1516648_+	hypothetical protein	NA	NA	NA	NA	NA
QAZ37574.1|1516574_1516829_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ37575.1|1516817_1517018_+	KTSC domain-containing protein	NA	A0A1S5S8T9	Streptococcus_phage	70.8	3.1e-20
QAZ37576.1|1517196_1517925_-	oxidoreductase	NA	Q938N5	Temperate_phage	99.6	3.4e-133
QAZ37577.1|1517935_1518127_-	hypothetical protein	NA	A7J270	Streptococcus_phage	90.5	1.2e-24
QAZ37578.1|1518922_1519282_+	XRE family transcriptional regulator	NA	Q938N6	Temperate_phage	99.2	1.1e-60
QAZ37579.1|1519295_1519676_+	ImmA/IrrE family metallo-endopeptidase	NA	Q938N7	Temperate_phage	100.0	5.3e-69
QAZ37580.1|1519686_1520208_+	hypothetical protein	NA	Q938N8	Temperate_phage	100.0	2.3e-67
QAZ37581.1|1520326_1521481_+|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	98.1	3.8e-203
QAZ37582.1|1521724_1522669_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
1521561:1521578	attR	CTTATATTATAACAAAAA	NA	NA	NA	NA
QAZ37583.1|1522801_1523458_+	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
QAZ37584.1|1523590_1523830_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
QAZ37585.1|1523993_1524485_-	single-stranded DNA-binding protein	NA	A0A286QNX2	Streptococcus_phage	74.2	1.3e-59
