The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP036168	Salmonella enterica subsp. enterica serovar Typhimurium strain sg_wt7 chromosome, complete genome	4930312	1161486	1181285	4930312	transposase	Escherichia_phage(50.0%)	23	NA	NA
QBG30653.1|1161486_1162191_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
QBG30654.1|1162167_1162365_+	hypothetical protein	NA	NA	NA	NA	NA
QBG30655.1|1162510_1163374_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
QBG30656.1|1163411_1163657_+	hypothetical protein	NA	NA	NA	NA	NA
QBG30657.1|1164125_1164917_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	NA	NA	NA	NA
QBG30658.1|1165054_1165759_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
QBG34067.1|1165704_1165896_-	hypothetical protein	NA	NA	NA	NA	NA
QBG30659.1|1166083_1166275_+	Rop family plasmid primer RNA-binding protein	NA	NA	NA	NA	NA
QBG30660.1|1166874_1169760_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.9	8.4e-191
QBG30661.1|1169885_1170509_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
QBG30662.1|1170802_1171726_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
QBG30663.1|1172841_1173645_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
QBG30664.1|1173644_1174481_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
QBG30665.1|1174522_1174813_-	hypothetical protein	NA	NA	NA	NA	NA
QBG30666.1|1174914_1175121_-	hypothetical protein	NA	NA	NA	NA	NA
QBG30667.1|1175181_1176507_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
QBG34068.1|1176511_1176805_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QBG30668.1|1177118_1177430_-	hypothetical protein	NA	NA	NA	NA	NA
QBG30669.1|1177408_1177801_-	hypothetical protein	NA	NA	NA	NA	NA
QBG30670.1|1178143_1178515_+	hypothetical protein	NA	NA	NA	NA	NA
QBG30671.1|1178606_1178798_+	hypothetical protein	NA	E5FFJ6	Burkholderia_phage	58.5	1.4e-09
QBG30672.1|1179097_1179802_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
QBG30673.1|1180292_1181285_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
CP036168	Salmonella enterica subsp. enterica serovar Typhimurium strain sg_wt7 chromosome, complete genome	4930312	1185066	1211063	4930312	transposase,integrase	Escherichia_phage(33.33%)	26	1179035:1179094	1204973:1205792
1179035:1179094	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
QBG30681.1|1185066_1186080_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
QBG34069.1|1186282_1186633_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
QBG30682.1|1186758_1187319_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
QBG30683.1|1187321_1190288_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
QBG34070.1|1190296_1190698_+	hypothetical protein	NA	NA	NA	NA	NA
QBG30684.1|1190782_1191487_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
QBG30685.1|1192411_1193296_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
QBG30686.1|1193512_1194727_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
QBG30687.1|1194754_1195060_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
QBG30688.1|1195171_1196665_+|transposase	IS91-like element ISVsa3 family transposase	transposase	NA	NA	NA	NA
QBG30689.1|1196695_1196947_+	hypothetical protein	NA	NA	NA	NA	NA
QBG30690.1|1196840_1197143_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
QBG30691.1|1197229_1198045_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
QBG30692.1|1198134_1199224_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
QBG30693.1|1199421_1199907_-	phenol hydroxylase	NA	NA	NA	NA	NA
QBG30694.1|1201717_1202470_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
QBG30695.1|1202891_1203917_-	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
QBG30696.1|1203903_1204125_-	hypothetical protein	NA	NA	NA	NA	NA
QBG34071.1|1204145_1204922_-	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
QBG30697.1|1205035_1205740_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
QBG30698.1|1205929_1206745_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
1204973:1205792	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
QBG30699.1|1206895_1207600_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
QBG30700.1|1207734_1208085_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	61.4	8.1e-16
QBG30701.1|1208232_1208664_-	silver-binding protein SilE	NA	NA	NA	NA	NA
QBG30702.1|1208908_1210390_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.8e-27
QBG30703.1|1210382_1211063_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
>prophage 3
CP036168	Salmonella enterica subsp. enterica serovar Typhimurium strain sg_wt7 chromosome, complete genome	4930312	1238360	1294237	4930312	transposase,integrase	Escherichia_phage(38.46%)	40	1232847:1232861	1295423:1295437
1232847:1232861	attL	GAATTTGCGACTGAG	NA	NA	NA	NA
QBG30727.1|1238360_1239581_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
QBG30728.1|1239827_1240289_+	hypothetical protein	NA	A0A2H4IBJ0	Erwinia_phage	37.9	7.7e-14
QBG30729.1|1240318_1240726_+	hypothetical protein	NA	NA	NA	NA	NA
QBG34076.1|1240776_1241094_-	hypothetical protein	NA	NA	NA	NA	NA
QBG34077.1|1241470_1241821_-	hypothetical protein	NA	NA	NA	NA	NA
QBG30730.1|1243685_1244078_+	cysteine hydrolase	NA	NA	NA	NA	NA
QBG30731.1|1244215_1245100_+	EamA family transporter	NA	NA	NA	NA	NA
QBG30732.1|1245131_1246331_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
QBG30733.1|1246409_1247087_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
QBG30734.1|1247118_1247361_-	relaxase	NA	NA	NA	NA	NA
QBG30735.1|1248998_1249703_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.4e-138
QBG34078.1|1253519_1253606_+	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
QBG30736.1|1253621_1255541_+	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	100.0	0.0e+00
QBG30737.1|1257636_1258497_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
QBG30738.1|1258671_1259376_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
QBG30739.1|1259533_1261360_-	OLD family endonuclease	NA	NA	NA	NA	NA
QBG30740.1|1261923_1262223_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QBG30741.1|1262575_1263502_-	hypothetical protein	NA	NA	NA	NA	NA
QBG30742.1|1263513_1265070_-|transposase	transposase	transposase	NA	NA	NA	NA
QBG30743.1|1266558_1268682_-|transposase	transposase	transposase	NA	NA	NA	NA
QBG30744.1|1268668_1269511_-|transposase	transposase	transposase	NA	NA	NA	NA
QBG30745.1|1270641_1271346_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.4e-138
QBG30746.1|1272186_1272372_-	hypothetical protein	NA	NA	NA	NA	NA
QBG30747.1|1272511_1272844_-	quaternary ammonium compound efflux SMR transporter QacL	NA	E5E3Y9	Acinetobacter_phage	35.3	2.0e-08
QBG30748.1|1273013_1273805_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
QBG30749.1|1273897_1275157_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
QBG30750.1|1275418_1276210_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
QBG30751.1|1276267_1276876_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
QBG30752.1|1276971_1277814_-	alpha/beta fold putative hydrolase EstX	NA	W8EKH7	Mycobacterium_phage	26.1	3.0e-08
QBG30753.1|1277980_1278847_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	39.4	1.3e-38
QBG30754.1|1278737_1279442_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
QBG30755.1|1279925_1281446_+	FliC/FljB family flagellin	NA	NA	NA	NA	NA
QBG30756.1|1281513_1282053_+	phase 1 flagellin gene repressor FljA	NA	NA	NA	NA	NA
QBG30757.1|1282832_1283995_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.9	5.2e-51
QBG30758.1|1284273_1286256_+	DNA helicase	NA	NA	NA	NA	NA
QBG30759.1|1286252_1286891_+	hypothetical protein	NA	NA	NA	NA	NA
QBG30760.1|1288604_1289201_-	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	91.3	2.6e-99
QBG34079.1|1289778_1291062_+	hypothetical protein	NA	NA	NA	NA	NA
QBG30761.1|1291321_1293196_-	hypothetical protein	NA	NA	NA	NA	NA
QBG30762.1|1293361_1294237_-|integrase	integrase	integrase	NA	NA	NA	NA
1295423:1295437	attR	CTCAGTCGCAAATTC	NA	NA	NA	NA
>prophage 4
CP036168	Salmonella enterica subsp. enterica serovar Typhimurium strain sg_wt7 chromosome, complete genome	4930312	1769662	1781953	4930312	holin,tail	Salmonella_phage(45.45%)	11	NA	NA
QBG31162.1|1769662_1772029_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
QBG31163.1|1772357_1773347_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	2.3e-188
QBG31164.1|1773361_1773730_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
QBG31165.1|1773758_1775090_-	NTPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
QBG31166.1|1775386_1775716_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
QBG31167.1|1776308_1777550_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
QBG31168.1|1777552_1778080_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
QBG31169.1|1778457_1778901_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
QBG31170.1|1778954_1780784_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
QBG31171.1|1781131_1781422_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
QBG31172.1|1781449_1781953_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 5
CP036168	Salmonella enterica subsp. enterica serovar Typhimurium strain sg_wt7 chromosome, complete genome	4930312	1854030	1863201	4930312	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
QBG31237.1|1854030_1854978_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
QBG31238.1|1854961_1855693_+	ABC transporter permease	NA	NA	NA	NA	NA
QBG31239.1|1855673_1855781_-	protein YohO	NA	NA	NA	NA	NA
QBG31240.1|1855840_1856572_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
QBG31241.1|1856794_1858480_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
QBG31242.1|1858476_1859196_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
QBG31243.1|1859242_1859710_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
QBG31244.1|1859766_1860297_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
QBG31245.1|1860468_1860927_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
QBG31246.1|1861167_1863201_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 6
CP036168	Salmonella enterica subsp. enterica serovar Typhimurium strain sg_wt7 chromosome, complete genome	4930312	1931508	1942014	4930312		Enterobacteria_phage(37.5%)	10	NA	NA
QBG31299.1|1931508_1932912_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	2.3e-21
QBG31300.1|1933089_1933983_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
QBG31301.1|1934359_1935445_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
QBG31302.1|1935444_1936344_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
QBG31303.1|1936391_1937270_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
QBG31304.1|1937270_1937822_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
QBG31305.1|1937827_1938820_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
QBG31306.1|1938816_1939590_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
QBG31307.1|1939594_1940674_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
QBG31308.1|1940700_1942014_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 7
CP036168	Salmonella enterica subsp. enterica serovar Typhimurium strain sg_wt7 chromosome, complete genome	4930312	2028014	2038617	4930312		Morganella_phage(25.0%)	13	NA	NA
QBG31388.1|2028014_2028488_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
QBG31389.1|2029135_2029426_-	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
QBG31390.1|2029797_2030595_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
QBG31391.1|2030855_2031098_+	hypothetical protein	NA	NA	NA	NA	NA
QBG31392.1|2031075_2031237_+	hypothetical protein	NA	NA	NA	NA	NA
QBG31393.1|2031363_2031783_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
QBG31394.1|2031785_2033054_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
QBG31395.1|2033508_2033721_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
QBG34113.1|2033731_2033920_+	cold-shock protein	NA	NA	NA	NA	NA
QBG31396.1|2034180_2035377_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
QBG31397.1|2036026_2036326_+	hypothetical protein	NA	NA	NA	NA	NA
QBG31398.1|2036417_2037113_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
QBG31399.1|2037186_2038617_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 8
CP036168	Salmonella enterica subsp. enterica serovar Typhimurium strain sg_wt7 chromosome, complete genome	4930312	2141938	2191255	4930312	portal,holin,tail,protease,integrase,lysis	Enterobacteria_phage(23.91%)	60	2134700:2134715	2191540:2191555
2134700:2134715	attL	ATTGTAGTCAATAAAC	NA	NA	NA	NA
QBG31503.1|2141938_2142169_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
QBG31504.1|2142306_2142681_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
QBG31505.1|2142681_2143557_+	copper resistance D family protein	NA	NA	NA	NA	NA
QBG31506.1|2143573_2143927_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
QBG31507.1|2144300_2145380_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.8	9.7e-100
QBG31508.1|2145360_2145633_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	39.7	1.8e-10
QBG34119.1|2145693_2145930_-	hypothetical protein	NA	NA	NA	NA	NA
QBG31509.1|2146220_2146400_-	DUF1187 family protein	NA	NA	NA	NA	NA
QBG31510.1|2146387_2147557_-	DUF550 domain-containing protein	NA	A0A1R3Y5Q8	Salmonella_virus	77.0	3.3e-85
QBG31511.1|2147553_2147886_-	hypothetical protein	NA	S4TNP2	Salmonella_phage	81.8	8.8e-20
QBG31512.1|2147878_2148199_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	60.6	3.6e-34
QBG31513.1|2148234_2149065_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.6	1.7e-104
QBG31514.1|2149057_2151748_-	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	75.3	1.8e-115
QBG31515.1|2151888_2152224_-	hypothetical protein	NA	NA	NA	NA	NA
QBG31516.1|2152298_2152583_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	53.2	1.7e-08
QBG31517.1|2153101_2153368_-	hypothetical protein	NA	NA	NA	NA	NA
QBG31518.1|2153783_2154209_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	56.3	1.2e-13
QBG31519.1|2154305_2154560_+	XRE family transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	59.4	1.2e-16
QBG31520.1|2154546_2155041_+	hypothetical protein	NA	NA	NA	NA	NA
QBG31521.1|2155087_2156095_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.0	1.7e-122
QBG31522.1|2156087_2156549_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.2	3.0e-66
QBG31523.1|2156561_2156957_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	37.0	2.9e-17
QBG31524.1|2157279_2157483_+	hypothetical protein	NA	NA	NA	NA	NA
QBG31525.1|2157386_2157878_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	51.5	9.7e-23
QBG31526.1|2158097_2158403_+	hypothetical protein	NA	NA	NA	NA	NA
QBG31527.1|2158466_2159066_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	83.4	1.9e-97
QBG31528.1|2159062_2159290_+	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	72.5	3.6e-17
QBG31529.1|2159286_2159433_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
QBG31530.1|2159422_2160220_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	6.8e-151
QBG31531.1|2160618_2160744_+	hypothetical protein	NA	NA	NA	NA	NA
QBG31532.1|2160879_2161329_-	lipoprotein	NA	NA	NA	NA	NA
QBG31533.1|2161689_2162376_-	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.1	1.5e-130
QBG34120.1|2162651_2162981_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
QBG31534.1|2162964_2163417_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.7	2.7e-80
QBG31535.1|2163434_2163914_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
QBG31536.1|2164121_2164655_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	47.5	2.3e-33
QBG31537.1|2166745_2166952_+	primosomal replication protein PriB/PriC domain protein	NA	NA	NA	NA	NA
QBG34121.1|2166978_2168496_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.9	4.4e-175
QBG34122.1|2168419_2170501_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
QBG31538.1|2170591_2170915_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
QBG31539.1|2170907_2171207_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
QBG31540.1|2171187_2171754_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
QBG31541.1|2171750_2172152_+|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	60.2	1.3e-41
QBG31542.1|2172163_2172913_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.2	5.3e-89
QBG31543.1|2172958_2173357_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
QBG31544.1|2173353_2173683_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
QBG34123.1|2173762_2176750_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.8	1.4e-260
QBG31545.1|2176746_2177079_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
QBG31546.1|2177177_2177702_+	Ail/OmpX	NA	A0A1B0VBR9	Salmonella_phage	35.3	1.8e-19
QBG31547.1|2177791_2178325_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
QBG31548.1|2178414_2179110_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
QBG31549.1|2179119_2179857_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.2e-114
QBG31550.1|2179754_2180459_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
QBG31551.1|2183919_2184162_+	hypothetical protein	NA	NA	NA	NA	NA
QBG31552.1|2184215_2186894_+	shikimate transporter	NA	A0A1B0VFW4	Salmonella_phage	63.0	1.5e-146
QBG31553.1|2186908_2187427_+|tail	phage tail protein	tail	A0A0U2QV64	Escherichia_phage	51.4	2.5e-45
QBG34124.1|2188070_2188322_-|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	62.0	1.6e-18
QBG31554.1|2188636_2189515_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	97.3	9.4e-170
QBG31555.1|2190162_2190789_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	62.6	1.4e-66
QBG31556.1|2191042_2191255_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.5e-20
2191540:2191555	attR	GTTTATTGACTACAAT	NA	NA	NA	NA
>prophage 9
CP036168	Salmonella enterica subsp. enterica serovar Typhimurium strain sg_wt7 chromosome, complete genome	4930312	2806407	2860341	4930312	head,tail,protease,integrase,lysis	Salmonella_phage(22.86%)	65	2818273:2818287	2850016:2850030
QBG32152.1|2806407_2807289_-|protease	protease HtpX	protease	NA	NA	NA	NA
QBG32153.1|2807482_2809531_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
QBG32154.1|2809550_2810237_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
QBG32155.1|2810334_2810919_-	GAF domain-containing protein	NA	NA	NA	NA	NA
QBG32156.1|2810960_2812244_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
QBG32157.1|2812206_2814846_+	PqiB family protein	NA	NA	NA	NA	NA
QBG32158.1|2814923_2816363_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
QBG32159.1|2816477_2816717_+	DUF1480 family protein	NA	NA	NA	NA	NA
QBG32160.1|2816827_2817019_+	DUF1482 family protein	NA	NA	NA	NA	NA
QBG32161.1|2817037_2817688_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	51.4	1.1e-58
QBG32162.1|2817911_2818076_-	hypothetical protein	NA	NA	NA	NA	NA
2818273:2818287	attL	TAAAAGCGTCGCCAT	NA	NA	NA	NA
QBG32163.1|2818360_2819083_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
QBG32164.1|2819766_2820162_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	9.2e-16
QBG32165.1|2820491_2820968_+	hypothetical protein	NA	NA	NA	NA	NA
QBG32166.1|2821355_2821775_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
QBG32167.1|2821903_2822098_-	hypothetical protein	NA	NA	NA	NA	NA
QBG32168.1|2822144_2822414_+	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	39.0	1.5e-06
QBG32169.1|2822579_2822720_+	hypothetical protein	NA	NA	NA	NA	NA
QBG32170.1|2824183_2824552_+|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	39.8	5.4e-18
QBG32171.1|2824489_2824747_-	hypothetical protein	NA	NA	NA	NA	NA
QBG34145.1|2825037_2825238_-	hypothetical protein	NA	NA	NA	NA	NA
QBG32172.1|2825855_2826770_+	EamA family transporter	NA	NA	NA	NA	NA
QBG32173.1|2826902_2827061_+	hypothetical protein	NA	NA	NA	NA	NA
QBG32174.1|2827070_2827685_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
QBG32175.1|2828437_2828704_-	hypothetical protein	NA	NA	NA	NA	NA
QBG32176.1|2828832_2828958_-	arsenic transporter	NA	NA	NA	NA	NA
QBG32177.1|2829220_2829337_+|tail	phage tail protein	tail	NA	NA	NA	NA
QBG32178.1|2829527_2829728_+	phage virulence factor	NA	NA	NA	NA	NA
QBG34146.1|2829824_2830706_-|tail	phage tail protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
QBG32179.1|2831178_2831367_+	hypothetical protein	NA	NA	NA	NA	NA
QBG32180.1|2831431_2831599_+	lytic enzyme	NA	NA	NA	NA	NA
QBG32181.1|2831855_2832389_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
QBG32182.1|2832442_2832673_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
QBG34148.1|2832862_2833357_+	RecE	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
QBG34147.1|2833416_2834271_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
QBG32183.1|2835215_2836016_+	hypothetical protein	NA	NA	NA	NA	NA
QBG32184.1|2836495_2837218_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
QBG32185.1|2837418_2837994_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	1.9e-94
QBG32186.1|2837993_2839445_-|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	70.7	8.6e-43
QBG32187.1|2839434_2840037_-	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	38.9	4.3e-33
QBG32188.1|2840038_2841280_-	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.6	3.5e-101
QBG32189.1|2841276_2841633_-	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	9.5e-20
QBG32190.1|2841645_2842323_-	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	36.0	1.2e-31
QBG32191.1|2842303_2843173_-	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	1.2e-31
QBG32192.1|2843216_2843519_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
QBG32193.1|2844224_2846396_-	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
QBG32194.1|2846379_2846562_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
QBG32195.1|2846603_2847008_-	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
QBG32196.1|2847007_2847454_-	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
QBG32197.1|2847454_2848939_-	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	41.0	3.1e-96
QBG32198.1|2848919_2849465_-	hypothetical protein	NA	NA	NA	NA	NA
QBG32199.1|2849449_2849815_-	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	40.5	3.9e-21
QBG32200.1|2849811_2850396_-	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.3	2.1e-16
2850016:2850030	attR	TAAAAGCGTCGCCAT	NA	NA	NA	NA
QBG32201.1|2850389_2850836_-	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	40.6	1.8e-15
QBG32202.1|2850842_2851190_-	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	3.9e-10
QBG34149.1|2851193_2852222_-	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	48.7	2.3e-82
QBG32203.1|2852221_2852704_-	hypothetical protein	NA	A0A1X9SFC3	Acinetobacter_phage	48.8	1.1e-26
QBG32204.1|2852705_2854052_-	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	36.5	5.5e-68
QBG34150.1|2854048_2854738_-|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	48.7	2.9e-57
QBG32205.1|2854778_2856299_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	43.9	1.5e-106
QBG32206.1|2856298_2857918_-	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	81.2	7.3e-261
QBG32207.1|2857920_2858550_-	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	98.1	5.6e-108
QBG34151.1|2858620_2858803_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
QBG34152.1|2859028_2859484_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	80.5	4.3e-57
QBG32208.1|2859801_2860341_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	70.6	2.2e-76
>prophage 10
CP036168	Salmonella enterica subsp. enterica serovar Typhimurium strain sg_wt7 chromosome, complete genome	4930312	2863807	2880799	4930312	integrase	Salmonella_phage(21.05%)	26	2870229:2870242	2881408:2881421
QBG32212.1|2863807_2864848_+	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	39.5	3.7e-64
QBG34154.1|2864856_2865210_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	82.3	8.4e-53
QBG34155.1|2865559_2865841_-	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	84.8	1.2e-38
QBG32213.1|2865837_2866032_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	59.6	1.0e-12
QBG32214.1|2866028_2866466_-	recombination protein NinB	NA	G8C7V3	Escherichia_phage	68.8	5.2e-52
QBG32215.1|2867042_2867198_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	84.3	1.2e-14
QBG32216.1|2867401_2867674_-	hypothetical protein	NA	NA	NA	NA	NA
QBG32217.1|2867670_2868066_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	38.8	4.4e-18
QBG32218.1|2868083_2868836_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	76.5	2.9e-103
QBG32219.1|2869096_2869339_+	hypothetical protein	NA	NA	NA	NA	NA
QBG32220.1|2869762_2870257_-	hypothetical protein	NA	NA	NA	NA	NA
2870229:2870242	attL	GCCTGACTGGCTGT	NA	NA	NA	NA
QBG32221.1|2870253_2870511_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	48.1	3.2e-17
QBG34156.1|2870616_2871006_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	47.9	1.0e-19
QBG32222.1|2871173_2871329_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	8.0e-08
QBG32223.1|2871764_2872007_-	hypothetical protein	NA	NA	NA	NA	NA
QBG32224.1|2872285_2872561_+	hypothetical protein	NA	NA	NA	NA	NA
QBG32225.1|2872564_2872771_+	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
QBG32226.1|2872846_2873182_+	hypothetical protein	NA	NA	NA	NA	NA
QBG32227.1|2873322_2876013_+	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	75.3	1.8e-115
QBG32228.1|2876005_2876836_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.0e-104
QBG32229.1|2876871_2877192_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	60.2	2.1e-34
QBG32230.1|2877184_2877517_+	hypothetical protein	NA	S4TNP2	Salmonella_phage	74.2	3.8e-15
QBG32231.1|2877513_2878017_+	Eaa protein	NA	A0A075B8H2	Enterobacteria_phage	92.3	6.0e-36
QBG32232.1|2878066_2878303_+	excisionase	NA	NA	NA	NA	NA
QBG32233.1|2878292_2879435_+|integrase	integrase	integrase	O21929	Phage_21	80.0	1.8e-173
QBG32234.1|2879548_2880799_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
2881408:2881421	attR	GCCTGACTGGCTGT	NA	NA	NA	NA
>prophage 11
CP036168	Salmonella enterica subsp. enterica serovar Typhimurium strain sg_wt7 chromosome, complete genome	4930312	3131822	3139842	4930312	protease,transposase	Enterobacteria_phage(16.67%)	7	NA	NA
QBG32472.1|3131822_3133077_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
QBG34161.1|3133092_3133368_-	hypothetical protein	NA	NA	NA	NA	NA
QBG32473.1|3133478_3135755_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
QBG32474.1|3135785_3136106_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
QBG32475.1|3136429_3136651_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
QBG32476.1|3136780_3138727_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
QBG32477.1|3138723_3139842_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 12
CP036168	Salmonella enterica subsp. enterica serovar Typhimurium strain sg_wt7 chromosome, complete genome	4930312	3497877	3562822	4930312	terminase,holin,tail,protease,tRNA,integrase	Enterobacteria_phage(31.11%)	73	3495830:3495847	3553710:3553727
3495830:3495847	attL	CCGCATAGCCCCGCCAGT	NA	NA	NA	NA
QBG32788.1|3497877_3498240_+	GtrA family protein	NA	I1TED9	Salmonella_phage	100.0	3.9e-61
QBG32789.1|3498236_3499163_+	glycosyltransferase	NA	I1TED8	Salmonella_phage	97.7	3.8e-169
QBG32790.1|3499143_3500796_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	37.9	6.7e-84
QBG34181.1|3501818_3501983_+|integrase	integrase	integrase	B9UDL9	Salmonella_phage	78.6	2.5e-12
QBG32791.1|3502524_3502758_+	DinI family protein	NA	K7P797	Enterobacteria_phage	63.0	4.9e-17
QBG32792.1|3503111_3503537_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.1	5.0e-52
QBG32793.1|3503549_3504839_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.2	3.5e-165
QBG32794.1|3504883_3505204_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	45.7	3.2e-19
QBG32795.1|3505289_3505988_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	67.7	1.4e-88
QBG34182.1|3506287_3506959_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	9.6e-82
QBG32796.1|3507677_3508448_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
QBG32797.1|3508545_3508701_+|tail	phage tail protein	tail	E5G6P4	Salmonella_phage	75.0	2.2e-05
QBG32798.1|3509272_3509791_-|tail	phage tail protein	tail	A0A0U2QV64	Escherichia_phage	51.4	2.5e-45
QBG32799.1|3509805_3512484_-	shikimate transporter	NA	A0A1B0VFW4	Salmonella_phage	68.3	1.5e-157
QBG32800.1|3512537_3512780_-	hypothetical protein	NA	NA	NA	NA	NA
QBG32801.1|3512818_3516181_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	80.1	0.0e+00
QBG32802.1|3516242_3516890_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.1	9.3e-90
QBG32803.1|3516787_3517525_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	6.8e-129
QBG32804.1|3517531_3518230_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	75.9	2.7e-103
QBG32805.1|3518239_3518569_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
QBG32806.1|3518571_3521667_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.4	1.7e-277
QBG32807.1|3521638_3521977_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
QBG32808.1|3521973_3522369_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
QBG32809.1|3522419_3523166_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
QBG32810.1|3523173_3523575_-|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	69.2	1.1e-51
QBG32811.1|3523571_3524156_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	78.6	1.1e-76
QBG32812.1|3524159_3524435_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	42.9	1.3e-13
QBG32813.1|3524427_3524751_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	64.2	2.7e-29
QBG32814.1|3524839_3527020_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	71.9	8.3e-276
QBG32815.1|3528403_3528610_-	primosomal replication protein PriB/PriC domain protein	NA	A5LH28	Enterobacteria_phage	48.6	1.1e-07
QBG32816.1|3528606_3530721_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	70.3	1.2e-295
QBG32817.1|3530707_3531205_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	55.1	2.8e-38
QBG34183.1|3531862_3532396_-	hypothetical protein	NA	NA	NA	NA	NA
QBG32818.1|3532471_3532723_-	hypothetical protein	NA	NA	NA	NA	NA
QBG32819.1|3532719_3533256_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	47.9	3.6e-07
QBG32820.1|3533252_3533867_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	94.1	1.1e-108
QBG32821.1|3533869_3534214_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
QBG32822.1|3535517_3535922_+	hypothetical protein	NA	NA	NA	NA	NA
QBG32823.1|3536037_3536841_-	antitermination protein	NA	F1C595	Cronobacter_phage	72.2	6.7e-106
QBG32824.1|3536934_3537849_-	hypothetical protein	NA	F1C596	Cronobacter_phage	47.9	1.8e-59
QBG32825.1|3537892_3538288_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
QBG32826.1|3538284_3540426_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	55.7	1.3e-193
QBG32827.1|3540435_3541083_-	hypothetical protein	NA	A0A1B5FPB4	Escherichia_phage	42.1	9.1e-29
QBG34184.1|3541075_3541459_-	hypothetical protein	NA	NA	NA	NA	NA
QBG32828.1|3541548_3541854_-	hypothetical protein	NA	NA	NA	NA	NA
QBG32829.1|3541850_3542645_-	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	66.0	1.2e-46
QBG32830.1|3542655_3542976_-	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	73.1	3.5e-21
QBG32831.1|3542956_3543184_-	hypothetical protein	NA	NA	NA	NA	NA
QBG32832.1|3543339_3543738_-	DNA primase	NA	A0A286SGR4	Klebsiella_phage	54.2	2.0e-10
QBG32833.1|3543884_3544439_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
QBG32834.1|3544365_3544698_+	hypothetical protein	NA	NA	NA	NA	NA
QBG32835.1|3544777_3545374_-	Rha family transcriptional regulator	NA	A0A1X9SFL9	Acinetobacter_phage	47.7	4.6e-19
QBG32836.1|3545475_3545673_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	46.3	5.1e-07
QBG32837.1|3545892_3546327_-	hypothetical protein	NA	NA	NA	NA	NA
QBG32838.1|3546323_3546629_-	hypothetical protein	NA	NA	NA	NA	NA
QBG32839.1|3546969_3548157_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	53.4	1.3e-121
QBG32840.1|3548462_3548699_-	hypothetical protein	NA	NA	NA	NA	NA
QBG32841.1|3548654_3549251_+	fimbriae biosynthesis transcriptional regulator FimW	NA	NA	NA	NA	NA
QBG32842.1|3549412_3549724_+	diguanylate cyclase	NA	NA	NA	NA	NA
QBG32843.1|3549742_3550465_+	fimbriae biosynthesis regulator FimY	NA	NA	NA	NA	NA
QBG32844.1|3551068_3551701_+	fimbriae biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
QBG32845.1|3551746_3552265_-	fimbriae assembly protein	NA	NA	NA	NA	NA
QBG32846.1|3552274_3553282_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
QBG32847.1|3553296_3555909_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
3553710:3553727	attR	CCGCATAGCCCCGCCAGT	NA	NA	NA	NA
QBG32848.1|3555939_3556632_-	molecular chaperone FimC	NA	NA	NA	NA	NA
QBG32849.1|3556675_3557209_-	type 1 fimbrial protein subunit FimI	NA	NA	NA	NA	NA
QBG32850.1|3557284_3557842_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
QBG32851.1|3557831_3558026_-	hypothetical protein	NA	NA	NA	NA	NA
QBG32852.1|3558388_3559255_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.5	4.2e-29
QBG32853.1|3559256_3559469_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
QBG32854.1|3559596_3560142_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
QBG32855.1|3560134_3560572_+	hypothetical protein	NA	NA	NA	NA	NA
QBG32856.1|3561436_3562822_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.5	1.1e-44
>prophage 13
CP036168	Salmonella enterica subsp. enterica serovar Typhimurium strain sg_wt7 chromosome, complete genome	4930312	4549586	4596547	4930312	plate,tail,tRNA	Burkholderia_phage(40.91%)	51	NA	NA
QBG33709.1|4549586_4550585_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
QBG33710.1|4550672_4551983_-	conjugal transfer protein	NA	NA	NA	NA	NA
QBG33711.1|4552229_4552745_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
QBG34225.1|4552844_4553054_-	CsbD family protein	NA	NA	NA	NA	NA
QBG33712.1|4553075_4553189_-	hypothetical protein	NA	NA	NA	NA	NA
QBG33713.1|4553185_4554511_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
QBG33714.1|4554689_4555298_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
QBG33715.1|4555406_4555775_-	diacylglycerol kinase	NA	NA	NA	NA	NA
QBG33716.1|4555945_4558366_+	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
QBG33717.1|4558464_4559337_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
QBG33718.1|4559350_4559848_-	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
QBG33719.1|4560028_4560946_-	maltose operon protein MalM	NA	NA	NA	NA	NA
QBG33720.1|4561109_4562468_-	maltoporin	NA	NA	NA	NA	NA
QBG33721.1|4562556_4563666_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	46.6	3.1e-16
QBG33722.1|4564026_4565217_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
QBG33723.1|4565348_4566893_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
QBG33724.1|4566907_4567798_+	maltose ABC transporter permease	NA	NA	NA	NA	NA
QBG33725.1|4567963_4568374_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
QBG33726.1|4568516_4570613_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
QBG33727.1|4570612_4571347_-	hypothetical protein	NA	NA	NA	NA	NA
QBG33728.1|4571343_4571982_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
QBG34226.1|4572045_4572288_-	hypothetical protein	NA	NA	NA	NA	NA
QBG33729.1|4572731_4574381_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
QBG33730.1|4574725_4576075_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
QBG33731.1|4576205_4576553_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
QBG33732.1|4577131_4577419_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
QBG33733.1|4577421_4578027_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.4	6.5e-61
QBG33734.1|4578039_4578354_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
QBG33735.1|4578513_4578939_+	hypothetical protein	NA	NA	NA	NA	NA
QBG33736.1|4578964_4579162_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
QBG33737.1|4579151_4580579_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	2.3e-194
QBG33738.1|4580578_4581103_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
QBG33739.1|4581154_4581472_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
QBG33740.1|4581431_4581560_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
QBG33741.1|4581656_4584008_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.8	8.1e-67
QBG33742.1|4584007_4584961_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
QBG33743.1|4584960_4585170_+	hypothetical protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
QBG33744.1|4585157_4586201_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	3.2e-76
QBG33745.1|4586210_4586933_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	5.1e-12
QBG33746.1|4586941_4587181_+	hypothetical protein	NA	NA	NA	NA	NA
QBG33747.1|4587256_4587619_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
QBG33748.1|4587615_4588545_+	glycosyltransferase	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
QBG33749.1|4588544_4590092_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	1.5e-48
QBG33750.1|4590255_4590615_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
QBG33751.1|4590605_4591721_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	51.2	6.5e-99
QBG33752.1|4591713_4592346_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
QBG33753.1|4592348_4594007_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	5.2e-52
QBG33754.1|4594013_4594628_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
QBG33755.1|4594624_4595080_+	hypothetical protein	NA	NA	NA	NA	NA
QBG33756.1|4595331_4595622_+	hypothetical protein	NA	NA	NA	NA	NA
QBG33757.1|4595818_4596547_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	1.9e-35
