The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
AP019400	Cohnella sp. HS21 DNA, complete genome	7059027	1044843	1058270	7059027		Bacillus_phage(35.71%)	18	NA	NA
BBI31447.1|1044843_1045413_-	hypothetical protein	NA	A0A2H4JA43	uncultured_Caudovirales_phage	35.4	3.0e-23
BBI31448.1|1045500_1045905_-	HTH-type transcriptional regulator Xre	NA	A0A1L2JY18	Aeribacillus_phage	40.7	3.6e-15
BBI31449.1|1046169_1046739_+	hypothetical protein	NA	NA	NA	NA	NA
BBI31450.1|1046968_1047682_+	hypothetical protein	NA	A0A2H4J4Q0	uncultured_Caudovirales_phage	35.3	1.7e-28
BBI31451.1|1047696_1047888_+	hypothetical protein	NA	NA	NA	NA	NA
BBI31452.1|1047889_1049338_+	hypothetical protein	NA	A0A0N7AEC6	Bacillus_phage	38.1	8.5e-83
BBI31453.1|1049353_1049761_+	hypothetical protein	NA	A0A2H4J032	uncultured_Caudovirales_phage	57.3	6.1e-39
BBI31454.1|1049780_1050185_+	hypothetical protein	NA	A0A2H4J883	uncultured_Caudovirales_phage	45.7	1.3e-28
BBI31455.1|1050356_1051823_+	hypothetical protein	NA	NA	NA	NA	NA
BBI31456.1|1051857_1052478_+	hypothetical protein	NA	A0A0N7ACF7	Bacillus_phage	52.1	1.4e-50
BBI31457.1|1052474_1053440_+	hypothetical protein	NA	A0A0N6W8H4	Bacillus_phage	49.2	1.5e-83
BBI31458.1|1053432_1053852_+	hypothetical protein	NA	A0A0N7ACD3	Bacillus_phage	29.2	6.3e-07
BBI31459.1|1053844_1054294_+	phage-like element PBSX protein XkdS	NA	A0A0N7ACH4	Bacillus_phage	45.8	7.5e-30
BBI31460.1|1054293_1055406_+	phage-like element PBSX protein XkdT	NA	S6AVU3	Thermus_phage	34.9	3.5e-44
BBI31461.1|1055440_1055980_+	hypothetical protein	NA	S6BFJ0	Thermus_phage	41.2	3.8e-28
BBI31462.1|1055992_1057390_+	hypothetical protein	NA	NA	NA	NA	NA
BBI31463.1|1057409_1057709_+	hypothetical protein	NA	S6C455	Thermus_phage	54.1	5.0e-22
BBI31464.1|1058009_1058270_+	phage protein	NA	A0A0A7RWP8	Clostridium_phage	37.5	1.8e-07
>prophage 2
AP019400	Cohnella sp. HS21 DNA, complete genome	7059027	1499255	1506319	7059027	integrase,protease	Bacillus_phage(33.33%)	11	1503371:1503389	1505010:1505028
BBI31816.1|1499255_1500206_+	DNA ligase	NA	A0A1P8CWY5	Bacillus_phage	26.5	8.7e-20
BBI31817.1|1500255_1501143_-	non-homologous end joining protein Ku	NA	A0A218M9C0	Mycobacterium_phage	33.6	2.3e-38
BBI31818.1|1501267_1501447_+	hypothetical protein	NA	NA	NA	NA	NA
BBI31819.1|1501443_1501629_+	hypothetical protein	NA	NA	NA	NA	NA
BBI31820.1|1501918_1502479_+	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	35.4	7.2e-06
BBI31821.1|1502529_1502886_-	membrane protein	NA	S5MNN8	Brevibacillus_phage	77.2	1.5e-20
BBI31822.1|1503217_1503385_+	hypothetical protein	NA	NA	NA	NA	NA
1503371:1503389	attL	AGATGTACGAAATAATCGA	NA	NA	NA	NA
BBI31823.1|1503668_1504508_-|integrase	integrase	integrase	A0A2I6AZV9	Macacine_betaherpesvirus	25.7	2.0e-07
BBI31824.1|1504615_1504936_-	hypothetical protein	NA	NA	NA	NA	NA
BBI31825.1|1505115_1505283_+	hypothetical protein	NA	NA	NA	NA	NA
1505010:1505028	attR	AGATGTACGAAATAATCGA	NA	NA	NA	NA
BBI31826.1|1505560_1506319_-|protease	serine protease	protease	U5Q0C0	Bacillus_phage	62.2	2.0e-35
>prophage 3
AP019400	Cohnella sp. HS21 DNA, complete genome	7059027	1740227	1778528	7059027	integrase,portal,terminase,tail	Brevibacillus_phage(47.06%)	58	1737309:1737322	1757800:1757813
1737309:1737322	attL	TACACCGCTTGTTA	NA	NA	NA	NA
BBI32006.1|1740227_1741703_-|integrase	integrase	integrase	A0A2P1JU08	Anoxybacillus_phage	32.6	1.4e-56
BBI32007.1|1741715_1742234_-	hypothetical protein	NA	NA	NA	NA	NA
BBI32008.1|1742330_1742687_-	hypothetical protein	NA	A8ATJ9	Listeria_phage	48.5	2.8e-11
BBI32009.1|1742837_1743056_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32010.1|1743325_1743577_+	hypothetical protein	NA	S5MNZ7	Brevibacillus_phage	47.4	4.8e-10
BBI32011.1|1743579_1743906_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32012.1|1743902_1744178_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32013.1|1744191_1744617_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32014.1|1744631_1744811_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32015.1|1744934_1745798_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32016.1|1745778_1746087_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32017.1|1746083_1746341_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32018.1|1746315_1746621_+	hypothetical protein	NA	A0A2H4J073	uncultured_Caudovirales_phage	59.5	2.8e-20
BBI32019.1|1746860_1748186_+	hypothetical protein	NA	J9PLX4	Bacillus_phage	32.9	1.4e-15
BBI32020.1|1748182_1749151_+	membrane protein	NA	A0A2H4J025	uncultured_Caudovirales_phage	43.2	4.3e-14
BBI32021.1|1749221_1749509_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32022.1|1749501_1750203_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32023.1|1750205_1750628_+	phage protein	NA	S5MUL4	Brevibacillus_phage	40.0	1.2e-18
BBI32024.1|1750620_1751001_+	hypothetical protein	NA	A8ASN9	Listeria_phage	36.7	1.5e-15
BBI32025.1|1751058_1751274_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32026.1|1751302_1751734_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32027.1|1751783_1752452_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32028.1|1752711_1753302_+|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	51.1	1.3e-45
BBI32029.1|1753556_1754279_+	hypothetical protein	NA	A0A2H4J4R0	uncultured_Caudovirales_phage	36.1	8.1e-26
BBI32030.1|1754262_1755510_+|terminase	putative terminase, large subunit - phage associated	terminase	A0A0S0KEN9	Bacillus_phage	57.4	4.6e-138
BBI32031.1|1755521_1756982_+|portal	portal protein	portal	S5MNW1	Brevibacillus_phage	56.9	5.4e-146
BBI32032.1|1756974_1757181_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32033.1|1757177_1758875_+	hypothetical protein	NA	A0A0A8WIE7	Clostridium_phage	50.0	7.8e-96
1757800:1757813	attR	TAACAAGCGGTGTA	NA	NA	NA	NA
BBI32034.1|1758879_1759134_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32035.1|1759316_1759889_+	hypothetical protein	NA	S5MUG0	Brevibacillus_phage	47.0	4.7e-29
BBI32036.1|1759911_1760868_+	hypothetical protein	NA	A0A1J0MCK3	Streptomyces_phage	60.7	3.2e-94
BBI32037.1|1760880_1761249_+	hypothetical protein	NA	S5MC61	Brevibacillus_phage	45.6	3.1e-05
BBI32038.1|1761211_1761604_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32039.1|1761605_1761971_+	phage protein	NA	S5MBV4	Brevibacillus_phage	57.9	7.9e-30
BBI32040.1|1761970_1762375_+	phage protein	NA	A0A0A7RTT0	Clostridium_phage	45.5	1.0e-25
BBI32041.1|1762379_1762808_+	hypothetical protein	NA	S5MUN8	Brevibacillus_phage	43.4	2.1e-29
BBI32042.1|1762804_1762996_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32043.1|1762996_1764310_+	hypothetical protein	NA	A0A0K2CNL4	Brevibacillus_phage	49.9	2.0e-115
BBI32044.1|1764311_1764776_+	phage protein	NA	S5MA61	Brevibacillus_phage	67.8	7.7e-54
BBI32045.1|1764806_1765232_+|portal	phage portal protein	portal	A0A0A7RTN3	Clostridium_phage	35.7	1.2e-13
BBI32046.1|1765462_1766107_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32047.1|1766160_1768665_+	hypothetical protein	NA	A0A0K2CP22	Brevibacillus_phage	28.9	1.2e-49
BBI32048.1|1768661_1769366_+	peptidoglycan-binding protein LysM	NA	S5MUH0	Brevibacillus_phage	52.4	2.5e-56
BBI32049.1|1769381_1769546_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32050.1|1769540_1769795_-	hypothetical protein	NA	NA	NA	NA	NA
BBI32051.1|1769889_1770849_+	hypothetical protein	NA	S5MNC9	Brevibacillus_phage	56.2	6.4e-103
BBI32052.1|1770852_1771149_+	phage protein	NA	S5MC71	Brevibacillus_phage	42.7	3.7e-17
BBI32053.1|1771151_1771553_+	hypothetical protein	NA	S5M612	Brevibacillus_phage	50.4	1.3e-28
BBI32054.1|1771545_1772625_+|tail	phage tail protein	tail	S5MUH6	Brevibacillus_phage	47.2	5.7e-92
BBI32055.1|1772632_1773205_+|portal	phage portal protein	portal	A0A0K2CNM8	Brevibacillus_phage	46.5	9.8e-35
BBI32056.1|1773201_1773486_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32057.1|1773485_1774391_+	hypothetical protein	NA	A0A1D8KSC4	Synechococcus_phage	39.5	2.6e-05
BBI32058.1|1774414_1775587_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32059.1|1775567_1775948_+	hypothetical protein	NA	A0A0S2GM64	Bacillus_phage	40.2	7.3e-10
BBI32060.1|1775961_1776246_+	hypothetical protein	NA	A0A0A7RUL4	Clostridium_phage	44.6	3.7e-11
BBI32061.1|1776242_1777829_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32062.1|1778107_1778341_+	hypothetical protein	NA	A0A1B2APZ1	Phage_Wrath	44.9	3.8e-09
BBI32063.1|1778330_1778528_+	hypothetical protein	NA	A0A2I7SCV7	Paenibacillus_phage	49.2	1.9e-06
>prophage 4
AP019400	Cohnella sp. HS21 DNA, complete genome	7059027	2082698	2104626	7059027	capsid,terminase	Clostridium_phage(42.11%)	26	NA	NA
BBI32347.1|2082698_2083289_+	hypothetical protein	NA	A0A0K2CZ91	Paenibacillus_phage	70.9	3.4e-54
BBI32348.1|2083298_2084879_+	putative DEAD box family helicase, phage associated	NA	A0A2I7SC38	Paenibacillus_phage	88.8	7.9e-276
BBI32349.1|2084917_2085187_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32350.1|2085466_2085691_-	hypothetical protein	NA	NA	NA	NA	NA
BBI32351.1|2085772_2088034_+	hypothetical protein	NA	A0A0K2CZ75	Paenibacillus_phage	82.4	0.0e+00
BBI32352.1|2088375_2088702_+	hypothetical protein	NA	A0A2I7SC39	Paenibacillus_phage	72.4	2.0e-40
BBI32353.1|2088705_2088945_+	hypothetical protein	NA	A0A2I7SC31	Paenibacillus_phage	66.7	9.4e-24
BBI32354.1|2088963_2089488_+	hypothetical protein	NA	S5MNT8	Brevibacillus_phage	54.9	4.9e-49
BBI32355.1|2089931_2090516_+	hypothetical protein	NA	D2J052	Enterococcus_phage	49.1	3.1e-36
BBI32356.1|2090508_2091903_+|terminase	terminase	terminase	A0A090EUA8	Clostridium_phage	69.4	6.5e-189
BBI32357.1|2091906_2092095_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32358.1|2092081_2093587_+	hypothetical protein	NA	M9Q246	Clostridium_phage	62.2	1.6e-177
BBI32359.1|2093583_2094729_+	hypothetical protein	NA	M9Q2F2	Clostridium_phage	43.4	6.5e-86
BBI32360.1|2094945_2095527_+	hypothetical protein	NA	S5MUG0	Brevibacillus_phage	45.9	2.0e-27
BBI32361.1|2095556_2096432_+|capsid	phage capsid protein	capsid	M9Q2F4	Clostridium_phage	50.7	2.4e-72
BBI32362.1|2096467_2096761_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32363.1|2096765_2097131_+	hypothetical protein	NA	M9Q2K9	Clostridium_phage	48.8	4.2e-23
BBI32364.1|2097130_2097457_+	hypothetical protein	NA	M9Q2I3	Clostridium_phage	69.5	1.7e-36
BBI32365.1|2097456_2097834_+	hypothetical protein	NA	M9Q249	Clostridium_phage	43.5	1.6e-25
BBI32366.1|2097830_2098217_+	hypothetical protein	NA	M9Q2F6	Clostridium_phage	60.2	2.6e-39
BBI32367.1|2098226_2098682_+	hypothetical protein	NA	O03972	Lactobacillus_phage	29.4	1.0e-10
BBI32368.1|2098711_2099014_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32369.1|2099039_2099363_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32370.1|2099366_2101829_+	hypothetical protein	NA	R9TQH4	Paenibacillus_phage	40.1	3.3e-47
BBI32371.1|2101825_2102194_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32372.1|2102196_2104626_+	hypothetical protein	NA	A0A1B1IPM9	uncultured_Mediterranean_phage	26.0	4.4e-07
>prophage 5
AP019400	Cohnella sp. HS21 DNA, complete genome	7059027	2148206	2236427	7059027	integrase,portal,terminase,coat,tRNA,protease	Clostridium_phage(19.35%)	104	2172451:2172495	2206604:2206648
BBI32422.1|2148206_2149394_-|coat	endospore coat-associated protein YheD	coat	NA	NA	NA	NA
BBI32423.1|2149469_2150642_-	hypothetical protein	NA	NA	NA	NA	NA
BBI32424.1|2150638_2152015_-|coat	endospore coat-associated protein YheD	coat	NA	NA	NA	NA
BBI32425.1|2151995_2153168_-|coat	endospore coat-associated protein YheC	coat	NA	NA	NA	NA
BBI32426.1|2153142_2154510_-	hypothetical protein	NA	NA	NA	NA	NA
BBI32427.1|2154707_2155469_+	methyltransferase	NA	NA	NA	NA	NA
BBI32428.1|2155465_2156515_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
BBI32429.1|2156736_2156937_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32430.1|2157028_2157235_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32431.1|2157527_2158367_-|integrase	integrase	integrase	A0A2I6AZV9	Macacine_betaherpesvirus	25.7	2.0e-07
BBI32432.1|2158474_2158795_-	hypothetical protein	NA	NA	NA	NA	NA
BBI32433.1|2159428_2159977_-	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	49.4	2.2e-39
BBI32434.1|2160132_2161218_+	sporulation protein	NA	NA	NA	NA	NA
BBI32435.1|2161222_2162320_-	hypothetical protein	NA	NA	NA	NA	NA
BBI32436.1|2162339_2163485_-	hypothetical protein	NA	NA	NA	NA	NA
BBI32437.1|2163488_2164835_-	hypothetical protein	NA	NA	NA	NA	NA
BBI32438.1|2164972_2165719_+	ribonuclease PH	NA	NA	NA	NA	NA
BBI32439.1|2165715_2166375_+	hypothetical protein	NA	A0A1K0ISQ7	Cassava_brown_streak_virus	27.6	2.7e-12
BBI32440.1|2167380_2169237_-	asparagine synthetase B	NA	A0A1V0SGM7	Hokovirus	25.8	2.4e-34
BBI32441.1|2169374_2169704_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32442.1|2169727_2170066_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32443.1|2170105_2170237_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32444.1|2170316_2170892_-	N-acetyltransferase	NA	NA	NA	NA	NA
BBI32445.1|2171201_2172230_-	hypothetical protein	NA	NA	NA	NA	NA
2172451:2172495	attL	ATGGAGCGGGTGAAGGGAATCGAACCCTCGCCTCAAGCTTGGGAA	NA	NA	NA	NA
BBI32446.1|2172545_2173943_-|integrase	site-specific integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	34.6	1.8e-61
BBI32447.1|2174068_2174401_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32448.1|2174599_2174812_-	hypothetical protein	NA	NA	NA	NA	NA
BBI32449.1|2174936_2175113_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32450.1|2175030_2175384_-	hypothetical protein	NA	A0A0K2CNE0	Brevibacillus_phage	67.7	8.2e-16
BBI32451.1|2175543_2175768_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32452.1|2175780_2176038_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32453.1|2176167_2176428_+	hypothetical protein	NA	S5MNZ7	Brevibacillus_phage	61.2	4.5e-19
BBI32454.1|2176440_2176701_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32455.1|2176922_2177102_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32456.1|2177221_2178223_+	hypothetical protein	NA	A0A2I7SDJ4	Paenibacillus_phage	49.1	1.5e-22
BBI32457.1|2178203_2178512_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32458.1|2178504_2178783_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32459.1|2178748_2179057_+	hypothetical protein	NA	A0A0A7RTP9	Clostridium_phage	47.4	4.1e-11
BBI32460.1|2179053_2179854_+	SAM-dependent methyltransferase	NA	Q24LC8	Clostridium_phage	41.6	1.6e-54
BBI32461.1|2179912_2180260_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32462.1|2180286_2180973_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32463.1|2180974_2181481_+	hypothetical protein	NA	A0A2I6UGC7	Salinibacter_virus	44.0	7.1e-29
BBI32464.1|2181504_2181825_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32465.1|2181877_2182126_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32466.1|2182159_2182378_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32467.1|2182412_2182703_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32468.1|2182654_2183008_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32469.1|2183004_2183367_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32470.1|2183353_2184337_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32471.1|2184333_2184567_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32472.1|2184663_2185020_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32473.1|2185415_2185604_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32474.1|2185600_2186158_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	50.5	4.1e-46
BBI32475.1|2186519_2186723_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32476.1|2186848_2187208_+	hypothetical protein	NA	A0A0U4JV93	Exiguobacterium_phage	58.7	8.9e-26
BBI32477.1|2187204_2188938_+|terminase	terminase	terminase	A6XMJ4	Bacillus_virus	72.8	6.7e-252
BBI32478.1|2189002_2190148_+|portal	phage portal protein	portal	A6XMJ5	Bacillus_virus	62.7	2.1e-145
BBI32479.1|2190137_2190719_+	hypothetical protein	NA	Q0H262	Geobacillus_phage	63.7	5.2e-68
BBI32480.1|2190718_2192032_+	hypothetical protein	NA	Q0H261	Geobacillus_phage	52.5	5.5e-89
BBI32481.1|2192055_2192190_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32482.1|2192180_2192465_+	hypothetical protein	NA	A6XMJ8	Bacillus_virus	71.1	5.2e-29
BBI32483.1|2192451_2193069_+	hypothetical protein	NA	R9TPZ2	Paenibacillus_phage	42.0	8.2e-11
BBI32484.1|2193068_2193497_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32485.1|2193483_2193900_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32486.1|2193913_2194981_+|portal	phage portal protein	portal	A0A0A7S0D2	Clostridium_phage	41.7	2.3e-61
BBI32487.1|2194995_2195421_+	hypothetical protein	NA	A0A0A7RVT1	Clostridium_phage	40.3	1.2e-26
BBI32488.1|2195474_2195861_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32489.1|2196057_2197926_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32490.1|2197940_2198366_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32491.1|2198370_2199450_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32492.1|2199446_2199704_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32493.1|2199716_2200148_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32494.1|2200140_2201184_+	hypothetical protein	NA	A0A0A7RUN3	Clostridium_phage	36.4	8.6e-45
BBI32495.1|2201173_2201716_+	hypothetical protein	NA	A0A0A7RTU9	Clostridium_phage	35.9	5.7e-16
BBI32496.1|2201718_2203080_+	hypothetical protein	NA	S6B1J7	Thermus_phage	33.2	7.8e-38
BBI32497.1|2203086_2203473_+	hypothetical protein	NA	S6C455	Thermus_phage	58.1	2.4e-32
BBI32498.1|2203472_2203616_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32499.1|2203651_2204020_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32500.1|2204033_2204378_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32501.1|2204379_2205186_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32502.1|2205252_2205828_-	hypothetical protein	NA	A0A0K2CP90	Brevibacillus_phage	27.2	3.1e-12
BBI32503.1|2206125_2206464_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32504.1|2206957_2207884_+	hypothetical protein	NA	NA	NA	NA	NA
2206604:2206648	attR	ATGGAGCGGGTGAAGGGAATCGAACCCTCGCCTCAAGCTTGGGAA	NA	NA	NA	NA
BBI32505.1|2207988_2209278_+	trigger factor	NA	NA	NA	NA	NA
BBI32506.1|2209461_2210064_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	59.5	7.9e-59
BBI32507.1|2210121_2211378_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.6	1.9e-147
BBI32508.1|2211497_2212598_+	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin)	NA	NA	NA	NA	NA
BBI32509.1|2212617_2213076_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32510.1|2213103_2216388_+	helicase SNF	NA	A0A160DHD3	Gordonia_phage	27.5	2.1e-36
BBI32511.1|2217501_2219265_+|protease	ATP-dependent protease LonB	protease	NA	NA	NA	NA
BBI32512.1|2219446_2221831_+|protease	Lon protease 1	protease	A0A0R6PGP8	Moraxella_phage	44.9	1.1e-183
BBI32513.1|2221849_2222500_+	putative GTP-binding protein EngB	NA	NA	NA	NA	NA
BBI32514.1|2222776_2224189_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
BBI32515.1|2224217_2225039_+	protein HemX	NA	NA	NA	NA	NA
BBI32516.1|2225082_2225718_+	precorrin-2 dehydrogenase	NA	NA	NA	NA	NA
BBI32517.1|2225725_2226664_+	porphobilinogen deaminase	NA	NA	NA	NA	NA
BBI32518.1|2226668_2228219_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32519.1|2228223_2229213_+	delta-aminolevulinic acid dehydratase	NA	NA	NA	NA	NA
BBI32520.1|2229232_2230534_+	glutamate-1-semialdehyde 2,1-aminomutase 2	NA	NA	NA	NA	NA
BBI32521.1|2230685_2231981_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32522.1|2232057_2232255_-	hypothetical protein	NA	NA	NA	NA	NA
BBI32523.1|2232261_2232561_-	hypothetical protein	NA	NA	NA	NA	NA
BBI32524.1|2233318_2233534_+	hypothetical protein	NA	NA	NA	NA	NA
BBI32525.1|2233760_2236427_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	41.6	3.1e-163
>prophage 6
AP019400	Cohnella sp. HS21 DNA, complete genome	7059027	2954869	2964984	7059027		Staphylococcus_phage(50.0%)	11	NA	NA
BBI33142.1|2954869_2955304_+	peptidyl-prolyl cis-trans isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	47.2	1.0e-23
BBI33143.1|2956551_2956989_-	hypothetical protein	NA	NA	NA	NA	NA
BBI33144.1|2957124_2958267_+	riboflavin biosynthesis protein RibD	NA	A0A2H4PQS8	Staphylococcus_phage	38.3	2.0e-55
BBI33145.1|2958267_2958933_+	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	42.6	2.6e-39
BBI33146.1|2958947_2960177_+	riboflavin biosynthesis protein RibBA	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	6.6e-121
BBI33147.1|2960219_2960690_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	57.0	1.5e-41
BBI33148.1|2960761_2961553_+	segregation and condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	29.6	1.6e-06
BBI33149.1|2961521_2962205_+	segregation and condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	39.7	1.5e-13
BBI33150.1|2962269_2962956_+	hypothetical protein	NA	NA	NA	NA	NA
BBI33151.1|2963059_2963548_+	putative spore protein YtfJ	NA	NA	NA	NA	NA
BBI33152.1|2963772_2964984_+	D-alanyl-D-alanine carboxypeptidase DacB	NA	B6DZZ7	Stx2-converting_phage	33.8	4.4e-24
>prophage 7
AP019400	Cohnella sp. HS21 DNA, complete genome	7059027	3504655	3512501	7059027		Bacillus_phage(57.14%)	9	NA	NA
BBI33666.1|3504655_3505492_+	putative endonuclease 4	NA	A0A146JI69	Tokyovirus	26.7	1.8e-16
BBI33667.1|3505494_3505842_+	hypothetical protein	NA	A0A0A0RP18	Bacillus_phage	38.2	5.8e-06
BBI33668.1|3505945_3506152_+	hypothetical protein	NA	NA	NA	NA	NA
BBI33669.1|3506151_3506928_+	putative ABC transporter ATP-binding protein YlmA	NA	G3M9Y6	Bacillus_virus	24.9	6.4e-13
BBI33670.1|3506927_3507950_+	hypothetical protein	NA	NA	NA	NA	NA
BBI33671.1|3508066_3509686_+	hypothetical protein	NA	L7RGQ5	Acanthamoeba_polyphaga_moumouvirus	31.3	4.2e-22
BBI33672.1|3509858_3510557_+	putative transcriptional regulatory protein YkoG	NA	W8CYM9	Bacillus_phage	31.4	2.3e-30
BBI33673.1|3510553_3511909_+	sensor histidine kinase YkoH	NA	W8CYF6	Bacillus_phage	32.4	1.7e-29
BBI33674.1|3512006_3512501_-	hypothetical protein	NA	A0A076G910	Bacillus_phage	33.0	8.3e-06
>prophage 8
AP019400	Cohnella sp. HS21 DNA, complete genome	7059027	5747049	5761547	7059027		Prochlorococcus_phage(20.0%)	12	NA	NA
BBI35702.1|5747049_5748597_-	bifunctional purine biosynthesis protein PurH	NA	Q58MG4	Prochlorococcus_phage	52.3	4.5e-74
BBI35703.1|5748611_5749265_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	3.1e-24
BBI35704.1|5749261_5750308_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	45.3	2.7e-70
BBI35705.1|5750586_5752050_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.0	5.8e-47
BBI35706.1|5752079_5754335_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	42.3	1.1e-166
BBI35707.1|5754312_5755005_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
BBI35708.1|5755012_5755255_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FJ99	Synechococcus_phage	39.0	1.1e-08
BBI35709.1|5755554_5756439_-	phosphoribosylaminoimidazole-succinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	33.8	2.4e-40
BBI35710.1|5756463_5757759_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.4	9.7e-22
BBI35711.1|5757765_5759022_-	N5-carboxyaminoimidazole ribonucleotide synthase	NA	NA	NA	NA	NA
BBI35712.1|5759018_5759504_-	N5-carboxyaminoimidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.9	9.6e-23
BBI35713.1|5760158_5761547_-	permease	NA	A0A0R6PHV4	Moraxella_phage	30.5	5.3e-42
>prophage 9
AP019400	Cohnella sp. HS21 DNA, complete genome	7059027	6291154	6300149	7059027		Staphylococcus_phage(16.67%)	11	NA	NA
BBI36165.1|6291154_6292357_-	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	69.3	1.4e-155
BBI36166.1|6292515_6292782_-	hypothetical protein	NA	A0A1P8CX76	Bacillus_phage	36.9	6.4e-05
BBI36167.1|6292895_6293753_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
BBI36168.1|6293787_6294762_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	45.1	9.7e-75
BBI36169.1|6294769_6295327_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A218MN57	uncultured_virus	44.9	7.1e-38
BBI36170.1|6295341_6296085_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	44.4	5.2e-52
BBI36171.1|6296205_6296706_-	hypothetical protein	NA	NA	NA	NA	NA
BBI36172.1|6296809_6297724_-	biofilm formation protein PslC	NA	NA	NA	NA	NA
BBI36173.1|6297638_6297875_-	hypothetical protein	NA	NA	NA	NA	NA
BBI36174.1|6298176_6299004_-	hypothetical protein	NA	NA	NA	NA	NA
BBI36175.1|6298982_6300149_-	glycosyl transferase family 1	NA	B6EFC4	Stygiolobus_rod-shaped_virus	30.9	2.0e-05
