The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025280	Salmonella enterica subsp. enterica strain USDA-ARS-USMARC-60983 chromosome, complete genome	4662027	670892	707258	4662027	capsid,terminase,integrase,holin,tRNA,head,tail,plate,portal	Escherichia_phage(26.67%)	49	660116:660139	709544:709567
660116:660139	attL	GATAAGCGCAGCGCCATCAGGCAA	NA	NA	NA	NA
QBJ36022.1|670892_671930_-|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	87.1	8.8e-175
QBJ36023.1|671929_672505_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	66.0	8.9e-68
QBJ36024.1|672637_672901_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	100.0	3.1e-44
QBJ36025.1|672931_673441_+	hypothetical protein	NA	A0A0M4QWN1	Salmonella_phage	99.4	4.3e-90
QBJ36026.1|673448_673676_+	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	90.7	7.3e-34
QBJ36027.1|673662_673863_+	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	92.4	3.7e-29
QBJ36028.1|673929_674163_+	DUF2732 domain-containing protein	NA	Q6K1F6	Salmonella_virus	77.9	1.1e-24
QBJ36029.1|674162_674390_+	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	70.7	3.1e-24
QBJ36030.1|674386_674695_+	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	45.9	2.1e-07
QBJ36031.1|674708_676949_+	replication endonuclease	NA	A0A0M3ULG0	Salmonella_phage	92.2	0.0e+00
QBJ36032.1|677065_677506_+	DinI family protein	NA	A0A218M4I0	Erwinia_phage	92.0	5.4e-65
QBJ36033.1|677788_678088_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ36034.1|678124_678433_+	XRE family transcriptional regulator	NA	E5E3S9	Burkholderia_phage	39.2	2.2e-12
QBJ36035.1|678410_679361_+	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	37.7	2.3e-36
QBJ36036.1|679500_679932_-	hypothetical protein	NA	S4TUD6	Salmonella_phage	95.1	1.4e-70
QBJ36037.1|679930_680125_+	hypothetical protein	NA	S4TRZ0	Salmonella_phage	92.2	3.4e-24
QBJ36038.1|680155_680425_-	hypothetical protein	NA	Q2P9X2	Enterobacteria_phage	82.6	1.1e-25
QBJ36039.1|680644_681682_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	79.3	2.0e-163
QBJ36040.1|681681_683451_-	oxidoreductase	NA	Q9T0R3	Escherichia_phage	81.2	1.5e-286
QBJ36041.1|683615_684479_+|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	76.3	2.2e-118
QBJ36042.1|684510_685671_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	62.8	9.6e-130
QBJ36043.1|685674_686433_+|terminase	terminase	terminase	Q94MJ2	Enterobacteria_phage	66.3	2.3e-79
QBJ36044.1|686530_687031_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	68.5	3.8e-59
QBJ36045.1|687030_687234_+|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	76.1	8.9e-23
QBJ36046.1|687224_687446_+	primosomal protein	NA	A0A218M4L5	Erwinia_phage	71.2	5.1e-24
QBJ36047.1|687429_687939_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	82.6	4.6e-76
QBJ36048.1|687935_688349_+	protein lysB	NA	O80310	Escherichia_phage	60.6	1.3e-36
QBJ36049.1|688248_688494_+|holin	holin	holin	S4TNY4	Salmonella_phage	73.1	2.5e-27
QBJ36050.1|688456_688924_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	69.7	1.1e-55
QBJ36051.1|688916_689366_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	69.4	1.0e-50
QBJ36052.1|689434_690076_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	82.2	3.8e-96
QBJ36053.1|690072_690420_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	70.4	2.8e-40
QBJ36054.1|690424_691333_+|plate	baseplate assembly protein	plate	Q37840	Escherichia_phage	83.8	2.6e-138
QBJ36055.1|691325_691859_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	88.6	5.6e-93
QBJ36056.1|691866_693612_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	75.5	9.2e-92
QBJ36057.1|693614_694139_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
QBJ36058.1|694268_695456_+|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	82.8	1.1e-189
QBJ36059.1|695468_695987_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	2.0e-71
QBJ36060.1|696049_696331_+|tail	phage tail assembly protein	tail	A0A0F7LBN9	Escherichia_phage	79.1	4.7e-30
QBJ36061.1|696363_696483_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	84.6	3.7e-13
QBJ36062.1|696475_698905_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	70.6	2.3e-266
QBJ36063.1|698916_699381_+|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	75.5	5.9e-62
QBJ36064.1|699383_700577_+	hypothetical protein	NA	Q6K1G4	Salmonella_virus	78.4	2.3e-166
QBJ36065.1|700616_700835_+	transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	86.1	4.6e-33
QBJ36066.1|701193_701700_+	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
QBJ36067.1|701823_703806_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	9.0e-35
QBJ36068.1|703820_705566_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
QBJ36069.1|705801_706017_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
QBJ36070.1|706244_707258_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.2e-109
709544:709567	attR	GATAAGCGCAGCGCCATCAGGCAA	NA	NA	NA	NA
>prophage 2
CP025280	Salmonella enterica subsp. enterica strain USDA-ARS-USMARC-60983 chromosome, complete genome	4662027	1177691	1270623	4662027	capsid,terminase,integrase,holin,tRNA,head,tail,portal	Cronobacter_phage(53.66%)	83	1215285:1215300	1244662:1244677
QBJ36516.1|1177691_1178921_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	86.1	1.5e-205
QBJ39754.1|1179519_1180683_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
QBJ36517.1|1180690_1182871_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	9.9e-19
QBJ36518.1|1182867_1184277_-	type I secretion protein TolC	NA	NA	NA	NA	NA
QBJ36519.1|1184341_1195816_-	Ig-like domain repeat protein	NA	NA	NA	NA	NA
QBJ39755.1|1196430_1196913_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
QBJ36520.1|1197062_1197539_+	ubiquinone-binding protein	NA	NA	NA	NA	NA
QBJ36521.1|1197528_1197819_+	RnfH family protein	NA	NA	NA	NA	NA
QBJ36522.1|1197984_1198323_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
QBJ36523.1|1198471_1200133_-	DNA repair protein RecN	NA	NA	NA	NA	NA
QBJ36524.1|1200218_1201097_-	NAD(+) kinase	NA	NA	NA	NA	NA
QBJ39756.1|1201028_1201223_+	molecular chaperone GrpE	NA	NA	NA	NA	NA
QBJ36525.1|1201219_1201810_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
QBJ36526.1|1201844_1202450_-	cytoplasmic protein	NA	NA	NA	NA	NA
QBJ36527.1|1202570_1203812_-	magnesium/cobalt efflux protein	NA	NA	NA	NA	NA
QBJ36528.1|1203876_1204668_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
QBJ36529.1|1204613_1204910_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ36530.1|1204833_1206195_+	signal recognition particle protein	NA	NA	NA	NA	NA
QBJ39757.1|1206447_1206696_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
QBJ36531.1|1206714_1207263_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
QBJ36532.1|1207307_1208075_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
QBJ36533.1|1208115_1208463_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
QBJ36534.1|1208619_1209840_-	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	37.0	1.7e-07
QBJ36535.1|1209832_1210351_-	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
QBJ36536.1|1210790_1211861_+	phospho-2-dehydro-3-deoxyheptonate aldolase Tyr-sensitive	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
QBJ36537.1|1211870_1212992_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
QBJ36538.1|1213049_1213958_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
QBJ36539.1|1213918_1215079_-	prephenate dehydratase	NA	NA	NA	NA	NA
QBJ39758.1|1215178_1215226_-	hypothetical protein	NA	NA	NA	NA	NA
1215285:1215300	attL	AAAACGCGCCCGAAGG	NA	NA	NA	NA
QBJ36540.1|1215389_1216409_-|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.2	1.4e-108
QBJ36541.1|1216448_1216754_-	XRE family transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	47.5	1.6e-15
QBJ36542.1|1216851_1217190_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ36543.1|1217215_1217548_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ36544.1|1217557_1218127_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.3	2.6e-43
QBJ36545.1|1218129_1218348_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ36546.1|1218386_1221044_+	bifunctional DNA primase/helicase	NA	A0A077K8T2	Ralstonia_phage	47.5	1.2e-244
QBJ36547.1|1221071_1221395_-	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	73.1	1.3e-36
QBJ36548.1|1221394_1222414_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	68.5	1.3e-135
QBJ36549.1|1222410_1224195_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	69.7	1.8e-247
QBJ36550.1|1224252_1225242_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	52.3	2.5e-46
QBJ36551.1|1225276_1226305_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	3.7e-133
QBJ36552.1|1226316_1227015_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	3.6e-63
QBJ36553.1|1227113_1227566_+|head	head completion protein	head	F1BUL8	Cronobacter_phage	64.7	1.2e-48
QBJ36554.1|1227562_1228045_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
QBJ36555.1|1228041_1228746_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.5	4.0e-70
QBJ36556.1|1228742_1229870_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	82.9	8.1e-174
QBJ36557.1|1229866_1230322_+	DUF2597 domain-containing protein	NA	F1BUL4	Cronobacter_phage	71.5	1.7e-58
QBJ36558.1|1230334_1230631_+|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
QBJ36559.1|1230627_1230969_+	hypothetical protein	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
QBJ36560.1|1230968_1231301_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	4.4e-35
QBJ36561.1|1231227_1231461_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	83.1	1.7e-30
QBJ36562.1|1231438_1231705_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.4e-20
QBJ36563.1|1231892_1233860_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	1.9e-271
QBJ36564.1|1233856_1234186_+	DUF2590 domain-containing protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
QBJ36565.1|1234182_1235367_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.6	5.1e-179
QBJ36566.1|1235353_1235947_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.4e-89
QBJ36567.1|1235956_1237969_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
QBJ36568.1|1237971_1238502_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
QBJ36569.1|1238491_1239217_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	3.8e-68
QBJ36570.1|1239188_1239734_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
QBJ36571.1|1239733_1241437_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	1.7e-223
QBJ36572.1|1242554_1244027_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ36573.1|1244162_1244549_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ36574.1|1244706_1245045_-	ribosomal subunit interface protein	NA	NA	NA	NA	NA
1244662:1244677	attR	AAAACGCGCCCGAAGG	NA	NA	NA	NA
QBJ36575.1|1245316_1246054_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
QBJ36576.1|1246185_1247166_+	ribosomal large subunit pseudouridine synthase D	NA	NA	NA	NA	NA
QBJ36577.1|1247162_1247894_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
QBJ36578.1|1248023_1250597_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	3.4e-127
QBJ36579.1|1250792_1250993_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ36580.1|1256423_1256879_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	49.3	8.6e-34
QBJ36581.1|1256982_1258284_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.2e-43
QBJ36582.1|1258280_1258604_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ36583.1|1258648_1260004_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
QBJ36584.1|1260118_1262779_-	protein lysine acetyltransferase Pat	NA	NA	NA	NA	NA
QBJ36585.1|1262832_1263513_-	DTW domain-containing protein	NA	NA	NA	NA	NA
QBJ36586.1|1263585_1264005_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
QBJ36587.1|1264208_1265246_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
QBJ36588.1|1265361_1266051_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
QBJ36589.1|1266369_1266753_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
QBJ36590.1|1266814_1267402_-	cysteine/O-acetylserine efflux protein	NA	NA	NA	NA	NA
QBJ39759.1|1267504_1268404_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
QBJ36591.1|1268421_1269756_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
QBJ36592.1|1269885_1270623_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
CP025280	Salmonella enterica subsp. enterica strain USDA-ARS-USMARC-60983 chromosome, complete genome	4662027	1722126	1731297	4662027	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
QBJ36997.1|1722126_1723074_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
QBJ36998.1|1723057_1723789_+	ABC transporter permease	NA	NA	NA	NA	NA
QBJ36999.1|1723769_1723877_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ37000.1|1723936_1724668_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
QBJ37001.1|1724890_1726576_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
QBJ37002.1|1726572_1727292_+	DNA-binding response regulator	NA	NA	NA	NA	NA
QBJ37003.1|1727338_1727806_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
QBJ37004.1|1727862_1728393_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
QBJ37005.1|1728564_1729023_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	73.2	7.6e-54
QBJ37006.1|1729263_1731297_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	6.1e-55
>prophage 4
CP025280	Salmonella enterica subsp. enterica strain USDA-ARS-USMARC-60983 chromosome, complete genome	4662027	1798489	1808996	4662027		Enterobacteria_phage(37.5%)	10	NA	NA
QBJ37061.1|1798489_1799893_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	2.3e-21
QBJ37062.1|1800070_1800964_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
QBJ37063.1|1801340_1802426_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
QBJ37064.1|1802425_1803325_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	6.7e-30
QBJ37065.1|1803372_1804251_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.7e-108
QBJ37066.1|1804251_1804803_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
QBJ37067.1|1804808_1805783_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
QBJ37068.1|1805798_1806572_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
QBJ37069.1|1806576_1807656_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	2.3e-16
QBJ37070.1|1807682_1808996_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 5
CP025280	Salmonella enterica subsp. enterica strain USDA-ARS-USMARC-60983 chromosome, complete genome	4662027	1891538	1898774	4662027		Morganella_phage(33.33%)	8	NA	NA
QBJ37152.1|1891538_1891958_+	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
QBJ37153.1|1891960_1893229_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.4	1.4e-227
QBJ37154.1|1893683_1893896_+	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
QBJ39776.1|1893906_1894095_+	cold-shock protein	NA	NA	NA	NA	NA
QBJ37155.1|1894355_1895534_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.0	2.5e-109
QBJ37156.1|1896183_1896483_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ37157.1|1896574_1897270_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
QBJ37158.1|1897343_1898774_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
CP025280	Salmonella enterica subsp. enterica strain USDA-ARS-USMARC-60983 chromosome, complete genome	4662027	2183484	2190141	4662027		Salmonella_phage(33.33%)	9	NA	NA
QBJ37442.1|2183484_2184291_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
QBJ37443.1|2184292_2185285_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
QBJ37444.1|2185284_2186175_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
QBJ37445.1|2186997_2187720_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	38.9	4.3e-35
QBJ37446.1|2188190_2188373_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	77.6	1.0e-22
QBJ37447.1|2188622_2188763_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	77.1	6.5e-09
QBJ37448.1|2188801_2189101_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	54.3	3.2e-13
QBJ37449.1|2189027_2189453_+	subtilase cytotoxin subunit B-like protein	NA	NA	NA	NA	NA
QBJ37450.1|2189826_2190141_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	86.1	4.3e-40
>prophage 7
CP025280	Salmonella enterica subsp. enterica strain USDA-ARS-USMARC-60983 chromosome, complete genome	4662027	2664630	2671868	4662027		Escherichia_phage(42.86%)	8	NA	NA
QBJ37915.1|2664630_2664870_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
QBJ39808.1|2665749_2666559_+	cytolethal distending toxin subunit B	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
QBJ37916.1|2666631_2667009_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
QBJ37917.1|2667156_2667699_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
QBJ37918.1|2667882_2668611_-	pertussis toxin-like subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.5	1.2e-61
QBJ37919.1|2668627_2669041_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	37.7	5.5e-19
QBJ37920.1|2670085_2671210_-	DUF3626 domain-containing protein	NA	NA	NA	NA	NA
QBJ37921.1|2671655_2671868_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	2.5e-20
>prophage 8
CP025280	Salmonella enterica subsp. enterica strain USDA-ARS-USMARC-60983 chromosome, complete genome	4662027	2677146	2724964	4662027	capsid,terminase,integrase,transposase,tRNA,tail,head,portal,lysis	Enterobacteria_phage(38.1%)	63	2671604:2671619	2720865:2720880
2671604:2671619	attL	TAATAAAAACGGGAAC	NA	NA	NA	NA
QBJ37925.1|2677146_2677263_+|tail	phage tail protein	tail	NA	NA	NA	NA
QBJ37926.1|2677453_2677654_+	phage virulence factor	NA	NA	NA	NA	NA
QBJ37927.1|2677751_2678336_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	84.8	1.7e-87
QBJ37928.1|2678335_2680777_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	62.0	7.3e-87
QBJ37929.1|2680830_2681073_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ37930.1|2681111_2684474_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.9	0.0e+00
QBJ37931.1|2684535_2685183_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.1	9.3e-90
QBJ37932.1|2685080_2685818_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	84.6	1.2e-128
QBJ37933.1|2685824_2686523_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	75.4	7.9e-103
QBJ37934.1|2686532_2686862_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	71.3	7.3e-43
QBJ37935.1|2686864_2689960_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.6	6.3e-277
QBJ37936.1|2689931_2690270_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
QBJ37937.1|2690266_2690662_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
QBJ37938.1|2690712_2691459_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
QBJ37939.1|2691466_2691868_-|tail	phage tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
QBJ37940.1|2691856_2693107_+|transposase	transposase	transposase	Q9G0F2	Phage_Gifsy-1	99.2	1.6e-215
QBJ37941.1|2693155_2693734_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.7	1.7e-82
QBJ37942.1|2693761_2694145_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
QBJ37943.1|2694155_2694521_-	DNA packaging protein	NA	NA	NA	NA	NA
QBJ37944.1|2694578_2695607_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
QBJ37945.1|2695661_2696009_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
QBJ37946.1|2696021_2697518_-	scaffolding protein	NA	A0A0K2FI53	Enterobacteria_phage	52.7	4.3e-98
QBJ37947.1|2697507_2699088_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
QBJ37948.1|2699084_2699288_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	72.3	9.5e-17
QBJ37949.1|2699271_2701203_-|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	1.8e-258
QBJ37950.1|2701174_2701720_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
QBJ37951.1|2701764_2701971_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ37952.1|2702005_2702407_+	inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
QBJ37953.1|2702633_2703098_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	84.7	1.8e-58
QBJ37954.1|2703198_2703738_-	lysozyme	NA	S5MQK2	Escherichia_phage	74.1	4.4e-77
QBJ39809.1|2703715_2704018_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
QBJ39810.1|2704267_2704723_+	DUF2441 domain-containing protein	NA	NA	NA	NA	NA
QBJ37955.1|2704734_2704953_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ37956.1|2705106_2705295_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ37957.1|2705429_2705618_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ37958.1|2705537_2706095_-	hypothetical protein	NA	A0A0N7C203	Escherichia_phage	78.5	9.5e-51
QBJ37959.1|2706144_2706369_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ37960.1|2706365_2706920_-	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	65.3	3.4e-64
QBJ37961.1|2706916_2707213_-	hypothetical protein	NA	K7P7Q1	Enterobacteria_phage	79.1	3.9e-35
QBJ37962.1|2707194_2707389_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	1.4e-12
QBJ37963.1|2707385_2707985_-	DUF1367 domain-containing protein	NA	A0A0U2RT94	Escherichia_phage	82.9	3.3e-97
QBJ37964.1|2708048_2708297_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ37965.1|2708830_2709337_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ37966.1|2709639_2710017_-	DUF977 domain-containing protein	NA	A0A088CBK9	Shigella_phage	36.1	2.2e-14
QBJ37967.1|2710034_2710787_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	76.1	8.5e-103
QBJ37968.1|2710793_2711663_-	DNA-binding protein	NA	A0A088CD36	Shigella_phage	58.5	6.9e-32
QBJ37969.1|2711707_2712202_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ37970.1|2712188_2712443_-	XRE family transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
QBJ37971.1|2712539_2712965_+	transcriptional regulator	NA	K7PH71	Enterobacterial_phage	56.3	9.3e-14
QBJ37972.1|2713275_2713431_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	4.7e-08
QBJ37973.1|2713809_2714094_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	53.2	1.7e-08
QBJ37974.1|2714168_2714504_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ37975.1|2714644_2717335_+	exonuclease VIII	NA	Q9QF34	Lambdoid_phage	83.5	6.8e-118
QBJ37976.1|2718192_2718513_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	59.2	1.8e-33
QBJ37977.1|2718505_2718838_+	hypothetical protein	NA	S4TNP2	Salmonella_phage	81.8	8.8e-20
QBJ37978.1|2718834_2719386_+	Eaa protein	NA	A0A192Y7X3	Salmonella_phage	34.5	2.8e-10
QBJ37979.1|2719435_2719672_+	excisionase	NA	NA	NA	NA	NA
QBJ37980.1|2719661_2720804_+|integrase	integrase	integrase	O21929	Phage_21	80.0	1.8e-173
QBJ37981.1|2720917_2722168_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.1e-19
2720865:2720880	attR	TAATAAAAACGGGAAC	NA	NA	NA	NA
QBJ37982.1|2722339_2723005_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
QBJ37983.1|2723001_2723331_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
QBJ37984.1|2723342_2723804_+	NUDIX hydrolase	NA	NA	NA	NA	NA
QBJ37985.1|2723857_2724964_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 9
CP025280	Salmonella enterica subsp. enterica strain USDA-ARS-USMARC-60983 chromosome, complete genome	4662027	4451947	4486673	4662027	capsid,terminase,integrase,holin,tail,head,portal	Cronobacter_phage(63.33%)	41	4451239:4451283	4482048:4482092
4451239:4451283	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTG	NA	NA	NA	NA
QBJ39517.1|4451947_4453672_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	63.0	1.3e-175
QBJ39518.1|4453679_4454222_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	56.0	7.1e-43
QBJ39519.1|4454193_4454916_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	40.3	1.2e-40
QBJ39520.1|4454905_4455493_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	55.5	1.0e-58
QBJ39521.1|4455492_4457439_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	68.1	1.7e-123
QBJ39522.1|4457450_4458044_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	63.8	4.7e-72
QBJ39523.1|4458036_4459221_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	69.2	1.2e-154
QBJ39524.1|4459213_4459549_-	DUF2590 domain-containing protein	NA	F1BUK8	Cronobacter_phage	58.7	1.2e-29
QBJ39525.1|4459545_4461660_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	41.3	2.6e-141
QBJ39526.1|4461661_4461841_-	hypothetical protein	NA	A5X9I8	Aeromonas_virus	63.0	6.4e-09
QBJ39527.1|4461849_4462119_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ39528.1|4462115_4462313_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ39529.1|4462221_4462605_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	38.5	1.2e-12
QBJ39530.1|4462604_4462943_-	hypothetical protein	NA	F1BUL3	Cronobacter_phage	84.2	8.9e-44
QBJ39531.1|4462929_4463241_-|holin	holin	holin	NA	NA	NA	NA
QBJ39532.1|4463245_4463701_-	DUF2597 domain-containing protein	NA	A5X9I1	Aeromonas_virus	52.3	1.5e-38
QBJ39533.1|4463704_4464847_-	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	61.6	1.1e-130
QBJ39534.1|4464849_4465545_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	58.4	6.7e-70
QBJ39535.1|4465541_4466018_-|tail	phage tail protein	tail	NA	NA	NA	NA
QBJ39536.1|4466014_4466488_-|head	head completion protein	head	F1BUL8	Cronobacter_phage	54.3	1.2e-30
QBJ39537.1|4466590_4467292_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	57.1	2.0e-69
QBJ39538.1|4467294_4468317_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	55.7	6.6e-98
QBJ39539.1|4468345_4469407_-|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	44.3	2.2e-32
QBJ39540.1|4469583_4471395_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	54.4	7.4e-185
QBJ39541.1|4471391_4472453_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	60.5	5.2e-122
QBJ39542.1|4472500_4472776_+	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	60.7	3.1e-26
QBJ39543.1|4472828_4474664_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ39544.1|4474755_4477392_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	37.9	3.5e-127
QBJ39545.1|4478481_4478871_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ39546.1|4478886_4479108_-	hypothetical protein	NA	A0A0M4S6M9	Salmonella_phage	50.0	2.2e-11
QBJ39547.1|4479245_4479521_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ39548.1|4479495_4480116_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ39549.1|4480116_4480389_-	hypothetical protein	NA	Q1JS20	Enterobacteria_phage	85.6	1.3e-40
QBJ39550.1|4480583_4480877_+	XRE family transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	77.3	2.0e-36
QBJ39551.1|4480946_4481927_+|integrase	integrase	integrase	Q7Y4C5	Escherichia_virus	85.0	1.2e-160
QBJ39552.1|4482116_4482617_-	stress adaptor protein CpxP	NA	NA	NA	NA	NA
4482048:4482092	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTG	NA	NA	NA	NA
QBJ39553.1|4482767_4483466_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
QBJ39554.1|4483462_4484836_+	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
QBJ39555.1|4484886_4485282_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
QBJ39556.1|4485293_4486046_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
QBJ39557.1|4486052_4486673_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
