The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025278	Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1913 chromosome, complete genome	4985589	1145620	1285766	4985589	tRNA,capsid,integrase,terminase,portal,plate,tail,transposase,lysis,holin,head	Salmonella_phage(52.71%)	164	1251457:1251492	1282354:1282389
QBJ50581.1|1145620_1146710_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	87.7	6.7e-141
QBJ50582.1|1146690_1147802_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.0	8.4e-06
QBJ50583.1|1148424_1148889_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ50584.1|1148961_1149804_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ50585.1|1149815_1151516_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
QBJ50586.1|1151593_1152715_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ50587.1|1152789_1154202_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ54282.1|1154549_1155779_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	89.2	1.0e-214
QBJ50588.1|1156105_1157116_-|integrase	integrase	integrase	F1BUN9	Cronobacter_phage	85.7	9.5e-174
QBJ50589.1|1157115_1157682_-	Repressor protein CI	NA	F1BUN8	Cronobacter_phage	59.7	1.1e-65
QBJ50590.1|1157827_1158031_+	hypothetical protein	NA	F1BUN7	Cronobacter_phage	52.0	1.0e-10
QBJ50591.1|1158068_1158572_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	71.3	1.5e-58
QBJ50592.1|1158581_1158809_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ50593.1|1158798_1159224_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
QBJ50594.1|1159223_1159625_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
QBJ50595.1|1159692_1159923_+	DUF2732 domain-containing protein	NA	NA	NA	NA	NA
QBJ50596.1|1159913_1160243_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	45.2	2.0e-11
QBJ50597.1|1160232_1161066_+	adenine methylase	NA	F1BUN1	Cronobacter_phage	68.3	1.6e-105
QBJ50598.1|1161062_1163084_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.9	1.9e-298
QBJ50599.1|1163196_1163415_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	49.1	3.6e-06
QBJ50600.1|1163388_1163712_-	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
QBJ50601.1|1163708_1164770_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.1	6.0e-163
QBJ50602.1|1164766_1166542_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	82.6	7.0e-289
QBJ50603.1|1166702_1167506_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	56.4	4.1e-79
QBJ50604.1|1167567_1168590_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
QBJ50605.1|1168593_1169295_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
QBJ50606.1|1169340_1169844_+|head	head completion protein	head	F1BUL8	Cronobacter_phage	82.0	5.2e-64
QBJ50607.1|1169840_1170347_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
QBJ50608.1|1170343_1171051_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.9	6.8e-102
QBJ50609.1|1171047_1172175_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
QBJ50610.1|1172171_1172627_+	DUF2597 domain-containing protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
QBJ50611.1|1172636_1172930_+|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
QBJ50612.1|1172926_1173268_+	hypothetical protein	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
QBJ50613.1|1173267_1173600_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	6.7e-36
QBJ50614.1|1173571_1173760_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	80.6	1.1e-22
QBJ50615.1|1173746_1174004_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
QBJ50616.1|1174191_1176162_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	68.8	9.2e-266
QBJ50617.1|1176158_1176488_+	DUF2590 domain-containing protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
QBJ50618.1|1176484_1177669_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	6.7e-179
QBJ50619.1|1177655_1178249_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
QBJ50620.1|1178258_1180364_+|tail	phage tail protein	tail	S4TP62	Salmonella_phage	69.0	8.8e-198
QBJ54283.1|1180472_1180931_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	93.2	1.6e-75
QBJ50621.1|1180920_1181646_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.0	5.5e-67
QBJ50622.1|1181617_1182163_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
QBJ50623.1|1182162_1183866_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	4.9e-223
QBJ50624.1|1184546_1185665_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ50625.1|1187290_1187539_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ50626.1|1187750_1188797_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ50627.1|1188786_1189827_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	92.7	1.7e-189
QBJ50628.1|1189830_1190463_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	58.1	1.6e-65
QBJ50629.1|1190579_1190822_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
QBJ50630.1|1190854_1191364_+	hypothetical protein	NA	E5G6L3	Salmonella_phage	93.5	1.9e-82
QBJ50631.1|1191371_1191668_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.4e-21
QBJ50632.1|1191785_1192127_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
QBJ50633.1|1192194_1192428_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	97.4	8.3e-33
QBJ50634.1|1192427_1192655_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
QBJ50635.1|1192651_1193509_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.9	1.9e-162
QBJ50636.1|1193505_1195920_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.6	0.0e+00
QBJ50637.1|1196072_1196261_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
QBJ50638.1|1196199_1196505_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
QBJ50639.1|1196564_1197296_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ50640.1|1197635_1198703_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ54284.1|1198705_1199020_+	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
QBJ50641.1|1199019_1199514_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ50642.1|1199599_1200625_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.9	1.1e-172
QBJ50643.1|1200624_1202391_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
QBJ50644.1|1202533_1203367_+|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	6.3e-123
QBJ50645.1|1203383_1204442_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
QBJ50646.1|1204445_1205096_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
QBJ50647.1|1205191_1205656_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
QBJ50648.1|1205655_1205859_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
QBJ50649.1|1205862_1206078_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
QBJ54285.1|1206097_1206571_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
QBJ50650.1|1206572_1206950_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.9e-16
QBJ50651.1|1206946_1207375_+	hypothetical protein	NA	E5G6N2	Salmonella_phage	75.9	1.4e-46
QBJ50652.1|1207304_1207508_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	1.0e-23
QBJ50653.1|1207470_1207902_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	8.4e-71
QBJ50654.1|1207894_1208341_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	83.6	6.2e-61
QBJ50655.1|1208409_1208988_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	2.1e-93
QBJ50656.1|1208984_1209344_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
QBJ50657.1|1209330_1210239_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.1	1.7e-142
QBJ50658.1|1210231_1210837_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
QBJ50659.1|1210833_1212225_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	73.6	2.2e-152
QBJ50660.1|1212211_1212409_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ50661.1|1212377_1212983_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	80.9	1.2e-86
QBJ50662.1|1212982_1213534_-|tail	phage tail protein	tail	Q9MCR6	Enterobacteria_phage	67.6	5.2e-57
QBJ50663.1|1213561_1214128_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
QBJ50664.1|1214270_1215443_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	2.1e-204
QBJ50665.1|1215452_1215968_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.2	2.4e-88
QBJ50666.1|1216022_1216325_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
QBJ50667.1|1216339_1216459_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
QBJ50668.1|1216451_1219529_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	69.3	0.0e+00
QBJ50669.1|1219525_1220011_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	4.8e-67
QBJ50670.1|1220007_1221108_+	late control protein D	NA	A0A1S6KZZ5	Salmonella_phage	88.5	3.4e-177
QBJ50671.1|1221176_1221395_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	77.8	7.5e-28
QBJ50672.1|1221421_1221904_-	hypothetical protein	NA	Q19UP0	Mannheimia_phage	33.1	1.7e-16
QBJ54286.1|1222461_1223625_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
QBJ50673.1|1223632_1225813_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
QBJ50674.1|1225809_1227219_-	type I secretion protein TolC	NA	NA	NA	NA	NA
QBJ50675.1|1227283_1238758_-	Ig-like domain repeat protein	NA	NA	NA	NA	NA
QBJ54287.1|1239377_1239860_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
QBJ50676.1|1240009_1240486_+	ubiquinone-binding protein	NA	NA	NA	NA	NA
QBJ50677.1|1240475_1240766_+	RnfH family protein	NA	NA	NA	NA	NA
QBJ50678.1|1240931_1241270_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
QBJ50679.1|1241418_1243080_-	DNA repair protein RecN	NA	NA	NA	NA	NA
QBJ54289.1|1243165_1244044_-	NAD(+) kinase	NA	NA	NA	NA	NA
QBJ54288.1|1244167_1244758_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
QBJ50680.1|1244792_1245398_-	cytoplasmic protein	NA	NA	NA	NA	NA
QBJ50681.1|1245517_1246759_-	magnesium/cobalt efflux protein	NA	NA	NA	NA	NA
QBJ50682.1|1246823_1247615_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
QBJ50683.1|1247560_1247857_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ50684.1|1247780_1249142_+	signal recognition particle protein	NA	NA	NA	NA	NA
QBJ54290.1|1249455_1249704_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
QBJ50685.1|1249722_1250271_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
QBJ50686.1|1250315_1251083_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
QBJ50687.1|1251123_1251471_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
1251457:1251492	attL	GAGCGTCTTAACTAAGAACGCGCTTTCGCAACATCC	NA	NA	NA	NA
QBJ50688.1|1251615_1251834_-	transcriptional regulator	NA	Q37973	Salmonella_virus	100.0	1.2e-38
QBJ50689.1|1251909_1253079_-	hypothetical protein	NA	A0A0M5M5V5	Salmonella_phage	97.4	1.7e-211
QBJ50690.1|1253075_1253561_-|tail	phage tail protein	tail	Q6K1G5	Salmonella_virus	99.4	1.0e-85
QBJ50691.1|1253575_1256020_-|tail	phage tail tape measure protein	tail	Q6K1G6	Salmonella_virus	94.5	0.0e+00
QBJ50692.1|1256012_1256168_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
QBJ50693.1|1256164_1256500_-|tail	phage tail assembly protein	tail	A0A218M4J8	Erwinia_phage	97.3	2.6e-51
QBJ50694.1|1256562_1257081_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	99.4	1.4e-93
QBJ50695.1|1257096_1258275_-|tail	phage tail protein	tail	S4TRX2	Salmonella_phage	99.5	2.9e-222
QBJ50696.1|1258409_1258958_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	100.0	9.9e-101
QBJ50697.1|1258970_1260947_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	99.2	0.0e+00
QBJ50698.1|1260957_1261488_-|tail	phage tail protein I	tail	Q6K1H3	Salmonella_virus	97.2	1.5e-101
QBJ50699.1|1261480_1262389_-|plate	baseplate assembly protein	plate	Q6K1H4	Salmonella_virus	98.3	7.7e-159
QBJ50700.1|1262395_1262743_-|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	96.5	1.0e-55
QBJ50701.1|1262739_1263381_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	96.7	5.5e-111
QBJ50702.1|1263449_1263899_-	phage virion morphogenesis protein	NA	A0A0M3UL83	Salmonella_phage	94.6	7.4e-70
QBJ50703.1|1263891_1264359_-|tail	phage tail protein	tail	S4TTA5	Salmonella_phage	100.0	1.1e-84
QBJ50704.1|1264321_1264495_-|lysis	phage lysis protein	lysis	S4TNY4	Salmonella_phage	98.2	2.8e-25
QBJ50705.1|1264466_1264880_-	protein lysB	NA	A0A0M4R2N5	Salmonella_phage	97.8	1.2e-45
QBJ50706.1|1264876_1265374_-	lysozyme	NA	S4TUB1	Salmonella_phage	99.4	1.2e-92
QBJ50707.1|1265360_1265657_-|holin	holin	holin	Q6K1I2	Salmonella_virus	100.0	5.8e-47
QBJ50708.1|1265660_1265864_-|tail	phage tail protein	tail	A0A0M3ULF4	Salmonella_phage	100.0	3.6e-32
QBJ50709.1|1265863_1266370_-|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	98.8	2.9e-91
QBJ50710.1|1266463_1267213_-|terminase	terminase	terminase	Q6K1I5	Salmonella_virus	98.4	1.5e-128
QBJ50711.1|1267216_1268284_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	99.7	1.2e-198
QBJ50712.1|1268360_1269215_-|capsid	capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	94.7	3.6e-150
QBJ50713.1|1269380_1271153_+	oxidoreductase	NA	S4TT96	Salmonella_phage	99.8	0.0e+00
QBJ50714.1|1271149_1271896_+	hypothetical protein	NA	Q6K1I9	Salmonella_virus	96.8	6.6e-140
QBJ50715.1|1271892_1272915_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	99.7	1.5e-198
QBJ50716.1|1273049_1273232_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ50717.1|1273436_1273631_-	hypothetical protein	NA	S4TRZ0	Salmonella_phage	79.7	2.5e-19
QBJ50718.1|1273764_1273974_-	hypothetical protein	NA	Q6K1F0	Salmonella_virus	97.1	2.6e-33
QBJ50719.1|1274169_1274403_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	98.7	8.0e-36
QBJ50720.1|1274406_1274589_-	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	100.0	4.1e-27
QBJ50721.1|1274706_1276929_-	replication endonuclease	NA	A0A0M3ULG0	Salmonella_phage	95.9	0.0e+00
QBJ50722.1|1276925_1277756_-	hypothetical protein	NA	A0A0M4RCP6	Salmonella_phage	97.1	7.1e-159
QBJ50723.1|1277759_1278038_-	hypothetical protein	NA	A0A0M4R2Q0	Salmonella_phage	87.0	2.0e-41
QBJ50724.1|1278038_1278260_-	hypothetical protein	NA	A0A0M4S5Q7	Salmonella_phage	98.6	7.1e-34
QBJ50725.1|1278259_1278487_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	97.3	9.9e-31
QBJ50726.1|1278556_1278757_-	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	97.0	3.0e-31
QBJ50727.1|1278743_1278971_-	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	97.3	1.2e-36
QBJ50728.1|1278978_1279488_-	hypothetical protein	NA	Q6K1F8	Salmonella_virus	98.8	9.5e-90
QBJ50729.1|1279538_1279892_-	Cro/Cl family transcriptional regulator	NA	Q6K1F9	Salmonella_virus	100.0	2.3e-58
QBJ50730.1|1280005_1280851_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	73.7	4.9e-115
QBJ50731.1|1280859_1281198_+	DUF2511 domain-containing protein	NA	A0A0M3ULF8	Salmonella_phage	72.1	1.4e-41
QBJ50732.1|1281222_1282272_+|integrase	integrase	integrase	A0A0M4S6G4	Salmonella_phage	90.3	5.4e-188
QBJ50733.1|1282524_1283745_-	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
1282354:1282389	attR	GAGCGTCTTAACTAAGAACGCGCTTTCGCAACATCC	NA	NA	NA	NA
QBJ50734.1|1283737_1284256_-	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
QBJ50735.1|1284695_1285766_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
>prophage 2
CP025278	Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1913 chromosome, complete genome	4985589	1544033	1581462	4985589	terminase,portal,tail,lysis,coat,protease	Salmonella_phage(77.19%)	59	NA	NA
QBJ50961.1|1544033_1544972_+|protease	outer membrane protease PgtE	protease	NA	NA	NA	NA
QBJ50962.1|1544993_1545224_-	hypothetical protein	NA	C6ZR23	Salmonella_phage	81.8	1.2e-10
QBJ50963.1|1545233_1545437_-	hypothetical protein	NA	C6ZR24	Salmonella_phage	95.5	4.7e-32
QBJ50964.1|1545533_1546169_-	Eac protein	NA	A0A075B8I7	Enterobacteria_phage	88.2	6.3e-107
QBJ50965.1|1546413_1546680_-	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	96.6	1.1e-44
QBJ50966.1|1547651_1547909_-	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	95.3	5.9e-40
QBJ50967.1|1547910_1548543_-	hypothetical protein	NA	A0A1R3Y5T1	Salmonella_virus	44.5	2.1e-25
QBJ50968.1|1548539_1548950_-	hypothetical protein	NA	A0A1R3Y5S0	Salmonella_virus	94.1	5.7e-69
QBJ50969.1|1548946_1549117_-	DUF2737 domain-containing protein	NA	A0A220NQV6	Salmonella_phage	100.0	6.1e-25
QBJ50970.1|1549127_1549421_-	RecBCD nuclease inhibitor	NA	A0A2H4FNA1	Salmonella_phage	97.9	6.1e-49
QBJ50971.1|1549436_1549985_-	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	99.5	1.0e-105
QBJ50972.1|1549993_1550500_-	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	90.5	7.3e-82
QBJ50973.1|1550500_1551208_-	recombinase	NA	K7PKU3	Enterobacteria_phage	88.9	9.4e-120
QBJ50974.1|1551216_1551405_-	hypothetical protein	NA	C6ZR38	Salmonella_phage	98.4	3.8e-28
QBJ50975.1|1551401_1551515_-	host cell division inhibitory peptide Kil	NA	C6ZR39	Salmonella_phage	100.0	7.8e-13
QBJ50976.1|1551507_1551654_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	C6ZR40	Salmonella_phage	97.9	1.5e-19
QBJ50977.1|1551880_1552381_-	HNH endonuclease	NA	A5H1L2	Xanthomonas_virus	44.2	2.6e-31
QBJ50978.1|1552464_1552659_-	restriction endonuclease	NA	E7C9Q6	Salmonella_phage	100.0	2.5e-30
QBJ50979.1|1552737_1553076_-	hypothetical protein	NA	E7C9Q7	Salmonella_phage	96.4	1.0e-55
QBJ50980.1|1553427_1554078_-	LexA family transcriptional repressor	NA	B1B6L9	Salmonella_phage	99.5	2.1e-121
QBJ50981.1|1554158_1554344_+	hypothetical protein	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
QBJ50982.1|1554450_1554741_+	hypothetical protein	NA	I6RSP4	Salmonella_phage	100.0	2.4e-45
QBJ50983.1|1554909_1555758_+	replication protein	NA	C6ZR51	Salmonella_phage	95.7	8.5e-152
QBJ50984.1|1555868_1557749_+	bifunctional DNA primase/helicase	NA	A0A0M4R313	Salmonella_phage	99.2	0.0e+00
QBJ50985.1|1557749_1558028_+	hypothetical protein	NA	C6ZR54	Salmonella_phage	97.8	1.9e-47
QBJ50986.1|1558083_1558539_+	hypothetical protein	NA	C6ZR55	Salmonella_phage	95.9	1.8e-76
QBJ50987.1|1558535_1558709_+	protein ninD	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
QBJ50988.1|1558675_1558852_+	NinE family protein	NA	I6RSQ2	Salmonella_phage	98.3	1.8e-27
QBJ50989.1|1558854_1559256_+	hypothetical protein	NA	G9L690	Escherichia_phage	85.0	2.7e-63
QBJ50990.1|1559248_1559425_+	protein ninF	NA	I6S668	Salmonella_phage	93.0	3.1e-24
QBJ50991.1|1559417_1559636_+	hypothetical protein	NA	S4TUE0	Salmonella_phage	68.1	5.6e-23
QBJ50992.1|1559636_1559927_+	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	100.0	1.7e-51
QBJ50993.1|1559923_1560319_+	hypothetical protein	NA	A0A220NQY4	Salmonella_phage	96.2	5.5e-69
QBJ50994.1|1560315_1560519_+	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
QBJ50995.1|1560499_1560679_+	hypothetical protein	NA	E7C9S6	Salmonella_phage	96.6	4.6e-23
QBJ50996.1|1560675_1561299_+	antitermination protein	NA	C6ZR62	Salmonella_phage	99.0	1.5e-113
QBJ50997.1|1561572_1561770_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ50998.1|1561857_1562376_+	endodeoxyribonuclease	NA	A0A1V0E5R7	Salmonella_phage	100.0	5.9e-95
QBJ50999.1|1562599_1562872_+	hypothetical protein	NA	A0A1V0E5R8	Salmonella_phage	100.0	1.1e-41
QBJ51000.1|1562871_1563369_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	100.0	1.4e-93
QBJ51001.1|1563365_1563833_+|lysis	lysis protein	lysis	A0A1V0E5Q6	Salmonella_phage	98.7	3.8e-77
QBJ51002.1|1563867_1564092_+	hypothetical protein	NA	A0A1V0E5I0	Salmonella_phage	88.7	1.6e-25
QBJ51003.1|1564045_1564576_+	hypothetical protein	NA	B8K1H1	Salmonella_phage	97.2	5.3e-91
QBJ51004.1|1564832_1565075_+	hypothetical protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
QBJ51005.1|1565076_1565565_+	hypothetical protein	NA	A0A1B2IBG8	Erwinia_phage	34.2	5.1e-16
QBJ51006.1|1565570_1566059_+	DNA-packaging protein	NA	A8CGG1	Salmonella_phage	100.0	2.9e-88
QBJ51007.1|1566036_1567536_+|terminase	terminase	terminase	A0A1R3Y5N2	Salmonella_virus	100.0	2.8e-307
QBJ51008.1|1567535_1569713_+|portal	portal protein	portal	I6R968	Salmonella_phage	98.2	0.0e+00
QBJ51009.1|1569726_1570638_+	scaffolding protein	NA	A0A1R3Y5R6	Salmonella_virus	99.7	1.1e-160
QBJ51010.1|1570637_1571930_+|coat	coat protein	coat	Q76H21	Enterobacteria_phage	99.3	1.8e-241
QBJ51011.1|1571970_1572531_+	hypothetical protein	NA	I6S1J7	Salmonella_phage	98.4	7.0e-102
QBJ51012.1|1572514_1573015_+	hypothetical protein	NA	I1TEJ0	Salmonella_phage	98.2	1.2e-89
QBJ51013.1|1572974_1574393_+	hypothetical protein	NA	I1TEJ1	Salmonella_phage	98.7	7.3e-273
QBJ51014.1|1574396_1575035_+|tail	phage tail protein	tail	A0A088CPT1	Enterobacteria_phage	94.8	3.4e-84
QBJ51015.1|1575034_1575490_+	hypothetical protein	NA	E7C9U3	Salmonella_phage	99.3	8.8e-87
QBJ51016.1|1575492_1576182_+	DNA transfer protein	NA	B9UDK9	Salmonella_phage	91.7	5.6e-93
QBJ54298.1|1576224_1577562_+	DNA transfer protein	NA	I1TEJ5	Salmonella_phage	98.0	7.7e-240
QBJ51017.1|1577561_1579628_+	DNA transfer protein	NA	B9UDL1	Salmonella_phage	81.1	1.1e-288
QBJ51018.1|1579704_1581462_+	hypothetical protein	NA	A0A0M4RD19	Salmonella_phage	51.6	1.8e-55
>prophage 3
CP025278	Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1913 chromosome, complete genome	4985589	1828170	1837341	4985589	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
QBJ51245.1|1828170_1829118_+	ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.3e-23
QBJ51246.1|1829101_1829833_+	ABC transporter permease	NA	NA	NA	NA	NA
QBJ51247.1|1829813_1829921_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ51248.1|1829980_1830712_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
QBJ51249.1|1830934_1832620_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
QBJ51250.1|1832616_1833336_+	DNA-binding response regulator	NA	NA	NA	NA	NA
QBJ51251.1|1833382_1833850_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.0e-74
QBJ51252.1|1833906_1834437_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
QBJ51253.1|1834608_1835067_-	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
QBJ51254.1|1835307_1837341_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
CP025278	Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1913 chromosome, complete genome	4985589	2121372	2165711	4985589	lysis,tail,integrase,head	Salmonella_phage(17.02%)	64	2138745:2138759	2170867:2170881
QBJ51528.1|2121372_2121603_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	58.8	8.5e-14
QBJ51529.1|2121740_2122115_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
QBJ51530.1|2122115_2122991_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ51531.1|2123007_2123361_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
QBJ51532.1|2123419_2123539_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ51533.1|2123744_2124824_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.8	1.3e-101
QBJ51534.1|2124798_2125077_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
QBJ54317.1|2125137_2125374_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ51535.1|2125664_2125850_-	hypothetical protein	NA	A0A0U2QL97	Escherichia_phage	59.6	2.9e-12
QBJ51536.1|2125896_2126727_-	recombination and repair protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	2.9e-104
QBJ51537.1|2126719_2129410_-	exonuclease VIII	NA	Q9QF34	Lambdoid_phage	75.6	9.8e-117
QBJ51538.1|2129550_2129886_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ51539.1|2129960_2130245_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	53.2	1.7e-08
QBJ51540.1|2130664_2130889_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ51541.1|2131202_2131628_-	transcriptional regulator	NA	K7PH71	Enterobacterial_phage	56.3	1.2e-13
QBJ51542.1|2131724_2131979_+	XRE family transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
QBJ51543.1|2131965_2132460_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ51544.1|2132503_2133511_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	68.1	2.4e-124
QBJ51545.1|2133503_2133965_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.8	7.8e-67
QBJ51546.1|2133977_2134373_+	DUF977 domain-containing protein	NA	A0A088CBK9	Shigella_phage	38.1	1.7e-17
QBJ51547.1|2134369_2134642_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ51548.1|2134845_2135001_+	type I toxin-antitoxin system hok family toxin	NA	A0A0U2QV81	Escherichia_phage	82.4	2.0e-14
QBJ51549.1|2135250_2135499_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ51550.1|2135562_2136162_+	DUF1367 domain-containing protein	NA	A0A0U2RT94	Escherichia_phage	83.9	5.0e-98
QBJ51551.1|2136158_2136353_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	6.1e-13
QBJ51552.1|2136349_2136631_+	hypothetical protein	NA	K7P7Q1	Enterobacteria_phage	79.1	1.7e-35
QBJ51553.1|2136627_2137182_+	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	64.6	2.8e-63
QBJ51554.1|2137127_2137385_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ51555.1|2137427_2137604_+	addiction module toxin, HicA family	NA	A0A0M3LQ86	Mannheimia_phage	60.3	1.2e-12
QBJ51556.1|2137654_2138062_+	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	63.0	1.4e-38
QBJ54318.1|2138211_2138514_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
QBJ51557.1|2138491_2139031_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	71.8	3.4e-77
2138745:2138759	attL	ATAAAGCGCTGGCAT	NA	NA	NA	NA
QBJ51558.1|2139131_2139596_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	81.7	6.3e-56
QBJ51559.1|2139821_2140004_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ51560.1|2140074_2140704_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	98.1	9.6e-108
QBJ51561.1|2140706_2142326_+	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	81.2	1.5e-261
QBJ51562.1|2142325_2143846_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	43.9	3.1e-104
QBJ51563.1|2143886_2144576_+|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	49.6	4.5e-58
QBJ51564.1|2144572_2145919_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.2	4.2e-68
QBJ51565.1|2145920_2146403_+	hypothetical protein	NA	A0A1X9SFC3	Acinetobacter_phage	48.8	1.1e-26
QBJ51566.1|2146402_2147431_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	48.7	2.3e-82
QBJ51567.1|2147434_2147782_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	3.0e-10
QBJ51568.1|2147788_2148244_+	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	40.8	2.4e-15
QBJ51569.1|2148237_2148822_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.6	3.2e-17
QBJ51570.1|2148818_2149184_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	39.7	8.8e-21
QBJ51571.1|2149168_2149714_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ51572.1|2149694_2151179_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	41.0	4.0e-96
QBJ51573.1|2151179_2151626_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
QBJ51574.1|2151625_2152030_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	8.2e-20
QBJ51575.1|2152071_2152254_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
QBJ51576.1|2152237_2154409_+	transglycosylase	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
QBJ51577.1|2154405_2155116_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	5.0e-28
QBJ51578.1|2155115_2155418_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	50.5	2.4e-24
QBJ51579.1|2155414_2156284_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
QBJ51580.1|2156264_2156942_+	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	36.0	1.6e-31
QBJ51581.1|2156954_2157311_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	1.6e-19
QBJ51582.1|2157307_2158549_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.9	9.1e-102
QBJ51583.1|2158550_2159153_+	DUF2612 domain-containing protein	NA	H9C0Y0	Aeromonas_phage	43.2	5.9e-30
QBJ51584.1|2159142_2160594_+	short-chain dehydrogenase	NA	E5G6P0	Salmonella_phage	70.2	7.3e-42
QBJ51585.1|2160590_2161415_+|tail	phage tail protein	tail	A0A0M4QWS3	Salmonella_phage	93.4	1.2e-150
QBJ51586.1|2161404_2161974_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.4	4.2e-94
QBJ51587.1|2162123_2162978_+	protein YibB	NA	NA	NA	NA	NA
QBJ51588.1|2163046_2164588_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ51589.1|2165351_2165711_-|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	39.3	8.4e-16
2170867:2170881	attR	ATGCCAGCGCTTTAT	NA	NA	NA	NA
>prophage 5
CP025278	Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1913 chromosome, complete genome	4985589	2719905	2768239	4985589	capsid,integrase,terminase,portal,tail,tRNA,lysis,protease,head	Salmonella_phage(43.33%)	68	2733285:2733299	2768637:2768651
QBJ52119.1|2719905_2722293_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
QBJ52120.1|2722308_2723292_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
QBJ54343.1|2723428_2723473_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
QBJ52121.1|2723593_2723950_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
QBJ52122.1|2724000_2724198_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
QBJ52123.1|2724293_2724836_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	4.8e-15
QBJ52124.1|2724839_2726768_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.6	1.6e-129
QBJ52125.1|2727099_2728368_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	95.0	2.9e-236
QBJ52126.1|2728370_2728790_-	translesion error-prone DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	59.8	3.8e-36
QBJ52127.1|2729026_2730325_-|tail	phage tail protein	tail	I6R0Q9	Salmonella_phage	99.1	5.0e-244
QBJ52128.1|2730335_2731295_-	hypothetical protein	NA	H6WRW5	Salmonella_phage	99.7	2.8e-183
QBJ52129.1|2731303_2734024_-|tail	phage tail protein	tail	S4TTF5	Salmonella_phage	99.9	0.0e+00
2733285:2733299	attL	GTATAGCGCTTCTCA	NA	NA	NA	NA
QBJ52130.1|2734023_2734422_-	hypothetical protein	NA	S4TR39	Salmonella_phage	94.7	2.9e-70
QBJ52131.1|2734428_2735013_-	hypothetical protein	NA	S4TND4	Salmonella_phage	96.9	1.0e-103
QBJ52132.1|2735012_2735606_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	99.0	4.3e-110
QBJ52133.1|2735768_2736023_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ52134.1|2736393_2739684_-|tail	phage tail tape measure protein	tail	Q9MCS3	Enterobacteria_phage	69.6	0.0e+00
QBJ52135.1|2739747_2740347_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ52136.1|2740414_2740711_-	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	100.0	2.9e-46
QBJ52137.1|2740722_2741094_-|tail	phage tail protein	tail	S4TSQ0	Salmonella_phage	90.9	4.4e-60
QBJ52138.1|2741121_2741826_-|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	74.4	4.4e-93
QBJ52139.1|2741882_2742230_-	DUF3168 domain-containing protein	NA	S4TTG3	Salmonella_phage	96.5	5.5e-57
QBJ52140.1|2742226_2742676_-	hypothetical protein	NA	S4TR46	Salmonella_phage	95.3	3.5e-72
QBJ52141.1|2742672_2743011_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	70.5	6.6e-39
QBJ52142.1|2743020_2743347_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	85.2	5.2e-49
QBJ52143.1|2743346_2743571_-	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	66.0	2.5e-10
QBJ52144.1|2743614_2744832_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.9	6.0e-199
QBJ52145.1|2744841_2745690_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	87.9	1.3e-131
QBJ52146.1|2745703_2747011_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	85.1	9.3e-214
QBJ52147.1|2747010_2748753_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.3	5.9e-139
QBJ52148.1|2748706_2749171_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.3e-48
QBJ52149.1|2749303_2749648_-	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	75.7	1.0e-47
QBJ52150.1|2749766_2750234_-|lysis	lysis protein	lysis	A0A1V0E5Q6	Salmonella_phage	98.7	3.8e-77
QBJ52151.1|2750230_2750728_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	100.0	1.4e-93
QBJ52152.1|2750727_2751000_-	hypothetical protein	NA	A0A1V0E5R8	Salmonella_phage	98.9	5.7e-41
QBJ52153.1|2751223_2751742_-	endodeoxyribonuclease	NA	A0A1V0E5R7	Salmonella_phage	100.0	5.9e-95
QBJ52154.1|2751829_2752027_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ52155.1|2752294_2753068_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	99.6	5.3e-132
QBJ52156.1|2753064_2753247_-	hypothetical protein	NA	C6ZR61	Salmonella_phage	95.0	6.1e-23
QBJ52157.1|2753234_2753705_-	hypothetical protein	NA	C6ZR60	Salmonella_phage	100.0	7.9e-91
QBJ52158.1|2753685_2753922_-	hypothetical protein	NA	C6ZR59	Salmonella_phage	88.5	3.4e-34
QBJ52159.1|2753914_2754085_-	NinF family protein	NA	I6R994	Salmonella_phage	87.0	7.4e-23
QBJ52160.1|2754081_2754258_-	NinE family protein	NA	I6RSI9	Salmonella_phage	98.3	1.5e-26
QBJ52161.1|2754254_2754665_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	100.0	3.2e-72
QBJ52162.1|2754636_2754993_-	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	96.5	4.6e-59
QBJ52163.1|2755209_2755290_-	histone H1	NA	Q9MCP6	Enterobacteria_phage	96.2	1.7e-06
QBJ52164.1|2755289_2756741_-	helicase DnaB	NA	Q7Y2K5	Escherichia_phage	99.2	7.2e-276
QBJ52165.1|2756715_2757606_-	DNA replication protein	NA	Q716D3	Shigella_phage	99.3	3.8e-158
QBJ52166.1|2757788_2758067_-	hypothetical protein	NA	K7P8A8	Enterobacteria_phage	100.0	1.1e-42
QBJ52167.1|2758175_2758370_-	Cro/Cl family transcriptional regulator	NA	K7PLQ6	Enterobacteria_phage	98.4	6.7e-28
QBJ52168.1|2758476_2759193_+	helix-turn-helix domain-containing protein	NA	K7PGR7	Enterobacteria_phage	100.0	9.2e-123
QBJ52169.1|2759210_2759579_+	hypothetical protein	NA	K7P6G1	Enterobacteria_phage	99.2	1.3e-56
QBJ52170.1|2760154_2760460_+	hypothetical protein	NA	A5VW99	Enterobacteria_phage	91.8	2.9e-25
QBJ54344.1|2760468_2760735_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ52171.1|2760790_2761240_+	hypothetical protein	NA	I6RSN8	Salmonella_phage	89.3	8.7e-71
QBJ52172.1|2761318_2761789_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	98.7	3.1e-87
QBJ52173.1|2761878_2762154_+	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	100.0	1.6e-46
QBJ52174.1|2762408_2763116_+	recombinase	NA	K7PKU3	Enterobacteria_phage	88.5	1.6e-119
QBJ52175.1|2763115_2763400_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
QBJ52176.1|2763446_2763740_+	RecBCD nuclease inhibitor	NA	Q76H42	Enterobacteria_phage	97.9	8.8e-48
QBJ52177.1|2763750_2763921_+	DUF2737 domain-containing protein	NA	I6S642	Salmonella_phage	100.0	6.1e-25
QBJ52178.1|2763917_2764415_+	Eae protein	NA	A0A0N6WGF1	Salmonella_phage	82.4	3.5e-73
QBJ52179.1|2764411_2764642_+	hypothetical protein	NA	G8C7U9	Escherichia_phage	89.3	5.5e-29
QBJ52180.1|2764638_2764884_+	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	92.3	1.0e-33
QBJ52181.1|2764880_2765648_+	Ead protein	NA	A0A075B8K3	Enterobacteria_phage	60.1	1.3e-69
QBJ52182.1|2765649_2765907_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	95.3	5.9e-40
QBJ52183.1|2766836_2767082_+	hypothetical protein	NA	A0A1P8DTG1	Proteus_phage	56.7	9.1e-14
QBJ52184.1|2767027_2768239_-|integrase	integrase	integrase	I6R9B6	Salmonella_phage	99.3	2.1e-236
2768637:2768651	attR	GTATAGCGCTTCTCA	NA	NA	NA	NA
>prophage 6
CP025278	Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1913 chromosome, complete genome	4985589	3000142	3046635	4985589	integrase,terminase,tail,lysis,protease,head	Salmonella_phage(45.28%)	69	2997080:2997093	3047557:3047570
2997080:2997093	attL	CACGCTGCAAACGC	NA	NA	NA	NA
QBJ54354.1|3000142_3000463_-	hypothetical protein	NA	E5G6P3	Salmonella_phage	76.6	6.8e-09
QBJ52429.1|3000486_3000723_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ52430.1|3001113_3001989_+	SPI-2 type III secretion system effector PipB	NA	NA	NA	NA	NA
QBJ52431.1|3002210_3002891_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	2.6e-82
QBJ52432.1|3003279_3003546_+	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	78.4	7.3e-33
QBJ52433.1|3003602_3004250_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ54355.1|3004292_3004490_-	hypothetical protein	NA	S4TTF2	Salmonella_phage	97.0	1.4e-09
QBJ52434.1|3005115_3005508_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	37.4	8.5e-14
QBJ52435.1|3005617_3006226_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	44.7	1.1e-31
QBJ52436.1|3006288_3006474_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ52437.1|3006722_3007241_-|tail	phage tail protein	tail	A0A0U2QV64	Escherichia_phage	53.8	2.0e-47
QBJ52438.1|3007255_3008788_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	66.2	1.4e-128
QBJ52439.1|3008787_3009468_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	96.0	5.5e-125
QBJ52440.1|3009464_3010664_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	96.7	5.5e-213
QBJ52441.1|3010664_3011018_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	95.7	3.0e-58
QBJ52442.1|3011017_3011770_-	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	69.8	9.7e-91
QBJ52443.1|3011888_3012344_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ52444.1|3012427_3012760_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	69.1	1.7e-23
QBJ52445.1|3012756_3013824_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	91.5	2.0e-174
QBJ52446.1|3013826_3014129_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	100.0	4.2e-53
QBJ52447.1|3014128_3014704_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	99.5	9.1e-97
QBJ52448.1|3014703_3016713_-	lytic transglycosylase	NA	A0A0M4REK7	Salmonella_phage	95.2	0.0e+00
QBJ54356.1|3016702_3016879_-	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	72.9	4.7e-12
QBJ52449.1|3016890_3017343_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	78.7	1.3e-61
QBJ52450.1|3017346_3017787_-	DUF3277 domain-containing protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	73.3	2.5e-54
QBJ52451.1|3017798_3018944_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.8	5.9e-164
QBJ52452.1|3018947_3019493_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	50.8	7.4e-48
QBJ52453.1|3019485_3019890_-|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	69.2	4.1e-43
QBJ52454.1|3019889_3020399_-	hypothetical protein	NA	A0A2H4J488	uncultured_Caudovirales_phage	40.7	8.5e-22
QBJ52455.1|3020395_3020806_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	57.4	2.5e-32
QBJ52456.1|3020774_3021143_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ52457.1|3021192_3022140_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	55.9	1.2e-98
QBJ52458.1|3022151_3022655_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	46.4	3.4e-31
QBJ52459.1|3022666_3023944_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	42.8	1.6e-77
QBJ52460.1|3023995_3024529_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.9	5.5e-48
QBJ52461.1|3024599_3026069_-	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	55.7	1.1e-157
QBJ52462.1|3026108_3027527_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	70.0	6.8e-186
QBJ52463.1|3027492_3028245_-	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	55.2	2.6e-11
QBJ54357.1|3028308_3028497_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
QBJ52464.1|3028809_3029277_-|lysis	lysis protein	lysis	S4TNN7	Salmonella_phage	80.6	2.5e-60
QBJ52465.1|3029273_3030185_-	site-specific DNA-methyltransferase	NA	A0A088FRS2	Escherichia_phage	53.0	3.2e-88
QBJ52466.1|3030181_3030670_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	68.1	4.6e-57
QBJ54358.1|3030647_3030950_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
QBJ52467.1|3031152_3031341_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ52468.1|3031733_3032312_-	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	52.0	2.4e-44
QBJ52469.1|3032308_3032602_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	65.3	2.1e-33
QBJ52470.1|3032598_3033195_-	DUF1367 domain-containing protein	NA	H9C173	Pectobacterium_phage	73.7	1.5e-81
QBJ52471.1|3033263_3033455_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ52472.1|3033638_3033977_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	86.6	3.7e-50
QBJ52473.1|3033976_3034147_-	methyltransferase	NA	I6S1S6	Salmonella_phage	87.5	6.3e-06
QBJ52474.1|3034143_3034746_-	adenine methylase	NA	G9L699	Escherichia_phage	87.3	1.7e-98
QBJ52475.1|3034738_3034987_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ52476.1|3034990_3035671_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ52477.1|3035708_3037097_-	replicative DNA helicase	NA	Q76H51	Enterobacteria_phage	47.1	1.2e-105
QBJ52478.1|3037093_3038074_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	80.6	2.3e-44
QBJ52479.1|3038076_3038301_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	44.7	1.0e-08
QBJ52480.1|3038323_3038770_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	50.4	5.5e-25
QBJ54359.1|3038704_3038920_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ52481.1|3038834_3039068_-	XRE family transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	48.6	6.2e-12
QBJ52482.1|3039166_3039631_+	transcriptional regulator	NA	A0A0U2QW76	Escherichia_phage	51.7	2.7e-35
QBJ52483.1|3040315_3040639_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ52484.1|3040646_3040892_+	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	53.8	3.5e-13
QBJ52485.1|3040921_3043195_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.0	9.4e-105
QBJ52486.1|3043191_3043746_+	hypothetical protein	NA	H9C156	Pectobacterium_phage	59.3	1.3e-47
QBJ52487.1|3043748_3043931_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ52488.1|3043980_3044178_+	hypothetical protein	NA	H9C154	Pectobacterium_phage	58.5	8.3e-10
QBJ52489.1|3044143_3044368_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
QBJ52490.1|3044368_3045388_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	53.5	1.2e-91
QBJ52491.1|3045975_3046635_+	transmembrane protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
3047557:3047570	attR	CACGCTGCAAACGC	NA	NA	NA	NA
>prophage 7
CP025278	Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1913 chromosome, complete genome	4985589	3280173	3322131	4985589	integrase,terminase,portal,tail,lysis,holin,coat	Salmonella_phage(70.0%)	68	3279724:3279745	3322197:3322218
3279724:3279745	attL	CGTTCAACTTAGTATAAAAAAG	NA	NA	NA	NA
QBJ52693.1|3280173_3280536_+	GtrA family protein	NA	I1TED9	Salmonella_phage	82.5	6.2e-51
QBJ52694.1|3280532_3281450_+	glycosyltransferase	NA	I1TED8	Salmonella_phage	93.1	1.3e-161
QBJ52695.1|3281446_3282898_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ52696.1|3282933_3284694_-	hypothetical protein	NA	I6S5Y0	Salmonella_phage	88.3	3.0e-58
QBJ52697.1|3284793_3285672_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	78.9	1.1e-96
QBJ52698.1|3285734_3285908_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
QBJ52699.1|3285996_3286233_+	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	59.2	2.2e-17
QBJ52700.1|3286229_3286439_+	hypothetical protein	NA	I6R975	Salmonella_phage	98.6	5.9e-30
QBJ52701.1|3286413_3286599_-	hypothetical protein	NA	I6RSG3	Salmonella_phage	100.0	1.1e-08
QBJ52702.1|3286624_3286849_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ52703.1|3286862_3287228_-	hypothetical protein	NA	A0A192Y6W5	Salmonella_phage	100.0	2.1e-67
QBJ52704.1|3287258_3287447_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ52705.1|3287464_3289330_-	DNA transfer protein	NA	A0A2H4FNB8	Salmonella_phage	98.4	0.0e+00
QBJ52706.1|3289329_3290727_-	DNA transfer protein	NA	A0A2H4FND5	Salmonella_phage	85.8	6.9e-215
QBJ52707.1|3290737_3291430_-	DNA transfer protein	NA	A0A0M4RTU3	Salmonella_phage	96.1	3.7e-105
QBJ52708.1|3291432_3291888_-	hypothetical protein	NA	E7C9U3	Salmonella_phage	99.3	6.7e-87
QBJ52709.1|3291887_3292526_-|tail	phage tail protein	tail	A0A088CPT1	Enterobacteria_phage	99.1	7.0e-90
QBJ52710.1|3292529_3293948_-	hypothetical protein	NA	I1TEJ1	Salmonella_phage	98.9	1.5e-273
QBJ52711.1|3293907_3294408_-	hypothetical protein	NA	I1TEJ0	Salmonella_phage	98.2	1.2e-89
QBJ52712.1|3294391_3294952_-	hypothetical protein	NA	I6S1J7	Salmonella_phage	98.4	7.0e-102
QBJ52713.1|3294992_3296285_-|coat	coat protein	coat	Q76H21	Enterobacteria_phage	99.3	1.8e-241
QBJ52714.1|3296284_3297196_-	scaffolding protein	NA	A0A1R3Y5R6	Salmonella_virus	99.7	1.1e-160
QBJ52715.1|3297209_3299387_-|portal	portal protein	portal	I6R968	Salmonella_phage	98.2	0.0e+00
QBJ52716.1|3299386_3300886_-|terminase	terminase	terminase	A0A0M4S5Z3	Salmonella_phage	99.6	3.1e-306
QBJ52717.1|3300863_3301352_-	DNA-packaging protein	NA	A8CGG1	Salmonella_phage	100.0	2.9e-88
QBJ52718.1|3301355_3301760_-	Decoration protein	NA	C6ZR73	Salmonella_phage	99.3	1.5e-66
QBJ52719.1|3301762_3302005_-	hypothetical protein	NA	A0A1R3Y5V5	Salmonella_virus	100.0	1.7e-36
QBJ52720.1|3302108_3302489_-	hypothetical protein	NA	Q716B1	Shigella_phage	99.2	1.4e-66
QBJ52721.1|3302772_3303291_-	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	100.0	3.2e-93
QBJ52722.1|3303496_3303934_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	95.9	4.2e-70
QBJ52723.1|3303930_3304407_-	lysozyme	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
QBJ52724.1|3304390_3304714_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
QBJ52725.1|3304951_3305149_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ52726.1|3305421_3306045_-	antitermination protein	NA	C6ZR62	Salmonella_phage	98.1	9.8e-113
QBJ52727.1|3306041_3306221_-	hypothetical protein	NA	A0A1V0E5I7	Salmonella_phage	100.0	7.1e-24
QBJ52728.1|3306201_3306405_-	protein ninH	NA	I6RSQ6	Salmonella_phage	97.0	1.4e-31
QBJ52729.1|3306401_3306626_-	protein ninY	NA	I6R0N9	Salmonella_phage	98.6	1.8e-37
QBJ52730.1|3306622_3307279_-	HNH endonuclease	NA	A0A2I7QND8	Vibrio_phage	45.4	3.4e-39
QBJ52731.1|3307275_3307671_-	hypothetical protein	NA	A0A0M4REJ2	Salmonella_phage	97.7	2.2e-70
QBJ52732.1|3307667_3307964_-	hypothetical protein	NA	A0A0M3ULJ7	Salmonella_phage	97.8	7.5e-47
QBJ52733.1|3307926_3308103_-	NinF family protein	NA	A0A0M4S6T3	Salmonella_phage	96.6	1.8e-27
QBJ52734.1|3308099_3308276_-	NinE family protein	NA	I6RSI9	Salmonella_phage	100.0	2.3e-27
QBJ52735.1|3308242_3308416_-	protein ninD	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
QBJ52736.1|3308412_3308850_-	recombination protein NinB	NA	A0A192Y6T2	Salmonella_phage	98.6	9.4e-78
QBJ52737.1|3308864_3309071_-	hypothetical protein	NA	I1TEG6	Salmonella_phage	98.5	2.7e-35
QBJ52738.1|3309074_3309359_-	hypothetical protein	NA	A0A2H4FNE3	Salmonella_phage	57.8	4.9e-27
QBJ52739.1|3309358_3309553_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ52740.1|3309626_3309905_-	hypothetical protein	NA	Q5G8S7	Enterobacteria_phage	93.5	1.0e-45
QBJ52741.1|3309905_3311786_-	bifunctional DNA primase/helicase	NA	I6S1U6	Salmonella_phage	97.9	0.0e+00
QBJ52742.1|3311893_3312742_-	replication protein	NA	C6ZR51	Salmonella_phage	94.7	8.0e-150
QBJ52743.1|3312924_3313203_-	hypothetical protein	NA	A0A220NRS4	Escherichia_phage	93.5	2.2e-40
QBJ52744.1|3313310_3313526_-	XRE family transcriptional regulator	NA	A0A0M4RTV8	Salmonella_phage	100.0	4.1e-34
QBJ54367.1|3313644_3314307_+	LexA family transcriptional repressor	NA	A0A0M4QWY1	Salmonella_phage	99.1	1.8e-125
QBJ52745.1|3314674_3315007_+	hypothetical protein	NA	A0A1R3Y5R1	Salmonella_virus	95.5	1.0e-52
QBJ52746.1|3315015_3315486_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	98.7	3.1e-87
QBJ52747.1|3315645_3315900_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ52748.1|3316104_3316299_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ52749.1|3316386_3316575_+	hypothetical protein	NA	C6ZR38	Salmonella_phage	82.3	1.7e-23
QBJ52750.1|3316583_3317291_+	recombinase	NA	A0A2H4FN95	Salmonella_phage	89.4	5.0e-121
QBJ52751.1|3317290_3317575_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
QBJ52752.1|3317621_3317915_+	RecBCD nuclease inhibitor	NA	A0A2H4FNA1	Salmonella_phage	96.9	1.4e-48
QBJ52753.1|3317925_3318096_+	DUF2737 domain-containing protein	NA	A0A220NQV6	Salmonella_phage	98.2	1.3e-24
QBJ52754.1|3318092_3318503_+	hypothetical protein	NA	A0A1R3Y5S0	Salmonella_virus	94.1	4.4e-69
QBJ52755.1|3318499_3319132_+	hypothetical protein	NA	A0A1R3Y5T1	Salmonella_virus	44.5	2.7e-25
QBJ52756.1|3319133_3319391_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	95.3	5.9e-40
QBJ52757.1|3320275_3320542_+	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	96.6	6.3e-45
QBJ52758.1|3320864_3321083_+	excisionase	NA	A0A1V0E5M4	Salmonella_phage	100.0	5.7e-36
QBJ52759.1|3321060_3322131_+|integrase	integrase	integrase	A0A1V0E5M7	Salmonella_phage	100.0	1.0e-154
3322197:3322218	attR	CGTTCAACTTAGTATAAAAAAG	NA	NA	NA	NA
>prophage 8
CP025278	Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1913 chromosome, complete genome	4985589	4581945	4629592	4985589	tail,plate,tRNA	Burkholderia_phage(36.36%)	51	NA	NA
QBJ53871.1|4581945_4582944_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
QBJ53872.1|4583031_4584342_-	conjugal transfer protein	NA	NA	NA	NA	NA
QBJ53873.1|4584588_4585104_+	transcriptional regulator Zur	NA	NA	NA	NA	NA
QBJ53874.1|4585202_4585412_-	CsbD family protein	NA	NA	NA	NA	NA
QBJ54420.1|4585433_4585547_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ53875.1|4585543_4586869_-	MATE family efflux transporter	NA	NA	NA	NA	NA
QBJ53876.1|4587047_4587656_-	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
QBJ53877.1|4587764_4588133_-	diacylglycerol kinase	NA	NA	NA	NA	NA
QBJ53878.1|4588303_4590724_+	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
QBJ53879.1|4590822_4591695_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
QBJ53880.1|4591708_4592206_-	chorismate lyase	NA	NA	NA	NA	NA
QBJ53881.1|4592386_4593304_-	maltose operon protein MalM	NA	NA	NA	NA	NA
QBJ53882.1|4593467_4594823_-	maltoporin	NA	NA	NA	NA	NA
QBJ53883.1|4594911_4596021_-	maltose/maltodextrin import ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
QBJ53884.1|4596382_4597573_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
QBJ53885.1|4597704_4599249_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
QBJ53886.1|4599263_4600154_+	maltose ABC transporter permease	NA	NA	NA	NA	NA
QBJ53887.1|4600319_4600730_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
QBJ53888.1|4600872_4602969_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
QBJ53889.1|4602968_4603706_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ53890.1|4603702_4604341_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
QBJ53891.1|4604404_4604647_-	outer membrane protein	NA	NA	NA	NA	NA
QBJ53892.1|4605090_4606740_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
QBJ53893.1|4607128_4608478_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
QBJ53894.1|4608612_4608960_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	52.6	7.5e-22
QBJ53895.1|4609536_4609824_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
QBJ53896.1|4609826_4610432_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	58.8	1.0e-58
QBJ53897.1|4610444_4610759_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
QBJ53898.1|4610918_4611374_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ53899.1|4611370_4611568_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	5.1e-07
QBJ53900.1|4611557_4612985_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	1.8e-194
QBJ53901.1|4612984_4613509_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	1.8e-67
QBJ53902.1|4613560_4613878_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
QBJ53903.1|4613837_4613966_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
QBJ53904.1|4614062_4616417_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.5	3.4e-65
QBJ53905.1|4616416_4617370_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
QBJ53906.1|4617369_4617579_+	hypothetical protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
QBJ53907.1|4617566_4618610_+	phage protein D	NA	A4JWL3	Burkholderia_virus	45.6	1.5e-76
QBJ53908.1|4618619_4619342_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
QBJ53909.1|4619350_4619593_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ53910.1|4619668_4620031_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
QBJ53911.1|4620027_4620957_+	glycosyltransferase	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
QBJ53912.1|4620956_4622504_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	30.4	5.0e-49
QBJ53913.1|4622667_4623027_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
QBJ53914.1|4623017_4624133_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.7	3.1e-101
QBJ53915.1|4624125_4624758_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
QBJ53916.1|4624760_4626419_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	8.0e-53
QBJ53917.1|4626425_4627040_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
QBJ53918.1|4627036_4627492_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ54421.1|4627868_4628285_+	serine acetyltransferase	NA	NA	NA	NA	NA
QBJ53919.1|4628863_4629592_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 9
CP025278	Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1913 chromosome, complete genome	4985589	4699177	4794971	4985589	capsid,integrase,terminase,portal,plate,tail,tRNA,lysis,holin,head	Escherichia_phage(41.3%)	99	4759287:4759333	4790025:4790071
QBJ53970.1|4699177_4700278_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
QBJ53971.1|4700324_4700684_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ53972.1|4700699_4701335_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
QBJ53973.1|4701336_4701525_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ53974.1|4701533_4702934_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
QBJ53975.1|4702916_4703834_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
QBJ53976.1|4704117_4705494_-	argininosuccinate lyase	NA	NA	NA	NA	NA
QBJ53977.1|4705611_4706388_-	acetylglutamate kinase	NA	NA	NA	NA	NA
QBJ53978.1|4706395_4707400_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
QBJ53979.1|4707488_4708640_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
QBJ53980.1|4709031_4711683_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
QBJ53981.1|4711893_4713627_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
QBJ53982.1|4713787_4714624_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
QBJ53983.1|4714878_4715541_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	2.5e-29
QBJ53984.1|4715552_4716656_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
QBJ53985.1|4716914_4717538_+	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
QBJ53986.1|4717595_4719776_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
QBJ53987.1|4719940_4720831_-	5,10-methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
QBJ53988.1|4721025_4722582_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
QBJ53989.1|4722717_4723842_+	cytoplasmic protein	NA	NA	NA	NA	NA
QBJ53990.1|4724076_4725075_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ53991.1|4725077_4725935_+	mechanosensitive ion channel protein MscS	NA	NA	NA	NA	NA
QBJ53992.1|4726060_4728493_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
QBJ53993.1|4728495_4729656_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
QBJ53994.1|4729920_4730238_+	met repressor	NA	NA	NA	NA	NA
QBJ53995.1|4730694_4732485_+	aryl-sulfate sulfotransferase	NA	NA	NA	NA	NA
QBJ54423.1|4732777_4732963_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ53996.1|4733480_4733693_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
QBJ53997.1|4733896_4736095_+	primosomal protein N'	NA	NA	NA	NA	NA
QBJ53998.1|4736249_4737275_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
QBJ53999.1|4737368_4738343_+	cell division protein FtsN	NA	NA	NA	NA	NA
QBJ54000.1|4738434_4738965_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
QBJ54001.1|4738974_4740306_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
QBJ54002.1|4740372_4741302_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
QBJ54003.1|4741394_4741880_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
QBJ54004.1|4742101_4742341_-	cell division protein ZapB	NA	NA	NA	NA	NA
QBJ54005.1|4742739_4743585_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
QBJ54006.1|4743605_4745114_+	glycerol kinase	NA	NA	NA	NA	NA
QBJ54007.1|4745225_4746236_+	fructose-bisphosphatase class II	NA	NA	NA	NA	NA
QBJ54008.1|4746332_4747079_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
QBJ54009.1|4747188_4747617_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
QBJ54010.1|4747717_4748314_+	DUF1454 domain-containing protein	NA	NA	NA	NA	NA
QBJ54011.1|4748426_4749194_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
QBJ54012.1|4749303_4750608_-	citrate transporter	NA	NA	NA	NA	NA
QBJ54424.1|4750705_4751428_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
QBJ54013.1|4751490_4752531_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
QBJ54014.1|4752540_4753500_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
QBJ54015.1|4753510_4754845_-	MFS transporter	NA	NA	NA	NA	NA
QBJ54016.1|4755109_4755865_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
QBJ54017.1|4755965_4756955_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
QBJ54018.1|4757158_4758121_-	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
QBJ54019.1|4758305_4759208_-	cation-efflux pump FieF	NA	NA	NA	NA	NA
4759287:4759333	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
QBJ54020.1|4759444_4759699_-	transcriptional regulator	NA	M1SNR2	Escherichia_phage	100.0	1.3e-44
QBJ54021.1|4759744_4760908_-	hypothetical protein	NA	U5N3V4	Enterobacteria_phage	99.2	7.0e-205
QBJ54022.1|4760907_4761387_-|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	1.5e-84
QBJ54023.1|4761401_4763849_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	94.8	0.0e+00
QBJ54024.1|4763841_4763961_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
QBJ54025.1|4763993_4764269_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
QBJ54026.1|4764325_4764844_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
QBJ54027.1|4764856_4766047_-|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	4.8e-225
QBJ54028.1|4766106_4766700_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	97.0	1.8e-103
QBJ54029.1|4767506_4768040_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	80.3	5.7e-77
QBJ54030.1|4768044_4768662_-|tail	tail assembly chaperone	tail	A0A1S6KZY8	Salmonella_phage	83.6	5.3e-95
QBJ54031.1|4768631_4770098_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	84.6	1.1e-143
QBJ54032.1|4770154_4770706_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	1.5e-104
QBJ54033.1|4770698_4771607_-|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	100.0	8.8e-163
QBJ54034.1|4771611_4771959_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
QBJ54035.1|4771955_4772591_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	9.0e-114
QBJ54036.1|4772657_4773110_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
QBJ54037.1|4773102_4773570_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	8.7e-82
QBJ54038.1|4773532_4773706_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
QBJ54039.1|4773677_4774103_-	protein lysB	NA	U5N3W5	Enterobacteria_phage	96.5	4.7e-66
QBJ54040.1|4774090_4774516_-	protein lysA	NA	U5N096	Enterobacteria_phage	95.7	2.8e-58
QBJ54041.1|4774530_4775028_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
QBJ54042.1|4775027_4775309_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
QBJ54043.1|4775312_4775516_-|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
QBJ54044.1|4775515_4776025_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
QBJ54045.1|4776124_4776868_-|terminase	terminase	terminase	Q94MH3	Enterobacteria_phage	98.0	3.1e-121
QBJ54046.1|4776871_4777945_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	100.0	6.7e-202
QBJ54047.1|4778003_4778858_-|capsid	capsid scaffolding protein	capsid	Q94MF5	Enterobacteria_phage	99.6	2.2e-139
QBJ54048.1|4779031_4780804_+	oxidoreductase	NA	A0A0F7LCM8	Escherichia_phage	99.8	0.0e+00
QBJ54049.1|4780803_4781838_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	4.2e-201
QBJ54050.1|4782178_4784011_-	hypothetical protein	NA	Q2P9X5	Enterobacteria_phage	32.5	4.1e-90
QBJ54051.1|4784127_4786410_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.4	0.0e+00
QBJ54052.1|4786399_4786675_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	97.8	1.6e-43
QBJ54053.1|4786671_4786896_-	hypothetical protein	NA	A0A0F7LDG9	Escherichia_phage	97.3	8.5e-35
QBJ54054.1|4786895_4787198_-	hypothetical protein	NA	U5N0U2	Enterobacteria_phage	97.0	2.5e-45
QBJ54055.1|4787197_4787422_-	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	98.6	2.3e-32
QBJ54056.1|4787485_4787986_-	replication protein B	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
QBJ54057.1|4788155_4788428_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
QBJ54058.1|4788564_4788858_+	transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
QBJ54059.1|4788927_4789908_+|integrase	integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
QBJ54060.1|4790093_4790594_-	stress adaptor protein CpxP	NA	NA	NA	NA	NA
4790025:4790071	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
QBJ54061.1|4790744_4791443_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
QBJ54062.1|4791439_4792813_+	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
QBJ54063.1|4792860_4793064_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ54064.1|4793184_4793580_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
QBJ54065.1|4793591_4794344_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
QBJ54066.1|4794350_4794971_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
