The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034778	Klebsiella pneumoniae strain 18CPO060 chromosome, complete genome	5288751	1320479	1335201	5288751	tail,integrase	Morganella_phage(50.0%)	17	1320232:1320252	1340296:1340316
1320232:1320252	attL	CACATCAAGAAAAGCAAATAA	NA	NA	NA	NA
QBK42497.1|1320479_1321733_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	60.4	7.2e-147
QBK42498.1|1321828_1322836_+	hypothetical protein	NA	NA	NA	NA	NA
QBK42499.1|1322966_1323185_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
QBK42500.1|1323184_1323619_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	55.3	2.4e-25
QBK42501.1|1323632_1324235_+	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	57.8	1.2e-54
QBK42502.1|1324234_1324414_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
QBK42503.1|1324410_1325376_+	HAD family hydrolase	NA	A0A291AWU3	Escherichia_phage	44.3	3.9e-07
QBK42504.1|1325372_1325876_+	hypothetical protein	NA	NA	NA	NA	NA
QBK42505.1|1325872_1326082_+	hypothetical protein	NA	NA	NA	NA	NA
QBK42506.1|1326078_1326705_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	37.8	1.6e-25
QBK42507.1|1326714_1327065_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	70.0	3.4e-38
QBK42508.1|1327057_1329820_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	56.1	2.8e-292
QBK46081.1|1330159_1330606_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
QBK46082.1|1330619_1330970_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
QBK42509.1|1330974_1331448_+	hypothetical protein	NA	NA	NA	NA	NA
QBK42510.1|1331801_1332128_+	hypothetical protein	NA	NA	NA	NA	NA
QBK42511.1|1332135_1335201_+|tail	tail protein (tape measure)	tail	B1GS57	Salmonella_phage	40.5	2.0e-94
1340296:1340316	attR	CACATCAAGAAAAGCAAATAA	NA	NA	NA	NA
>prophage 2
CP034778	Klebsiella pneumoniae strain 18CPO060 chromosome, complete genome	5288751	1677103	1684008	5288751		Planktothrix_phage(33.33%)	6	NA	NA
QBK46095.1|1677103_1677967_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
QBK42812.1|1677977_1678751_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	5.1e-26
QBK46096.1|1678991_1679885_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
QBK42813.1|1680130_1681492_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
QBK42814.1|1681810_1682533_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
QBK42815.1|1682529_1684008_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.4e-29
>prophage 3
CP034778	Klebsiella pneumoniae strain 18CPO060 chromosome, complete genome	5288751	1888298	1955072	5288751	tail,head,integrase,tRNA,terminase,capsid,protease,holin,portal	Klebsiella_phage(52.08%)	85	1888151:1888210	1926172:1926296
1888151:1888210	attL	GATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATTG	NA	NA	NA	NA
QBK42970.1|1888298_1889333_-|integrase	integrase	integrase	K7PLZ2	Enterobacterial_phage	64.0	7.0e-124
QBK42971.1|1889332_1889563_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
QBK42972.1|1889595_1889868_-	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	44.8	5.0e-13
QBK42973.1|1889864_1890140_-	hypothetical protein	NA	NA	NA	NA	NA
QBK42974.1|1890136_1890619_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	81.3	1.4e-71
QBK42975.1|1890620_1890956_-	hypothetical protein	NA	NA	NA	NA	NA
QBK42976.1|1891083_1891869_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.5	4.0e-63
QBK42977.1|1891868_1892168_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	46.7	9.4e-13
QBK42978.1|1892786_1893443_-	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	87.2	2.0e-108
QBK42979.1|1893541_1893739_+	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	86.2	1.1e-25
QBK42980.1|1893884_1894208_-	hypothetical protein	NA	NA	NA	NA	NA
QBK42981.1|1894266_1894734_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	85.8	7.4e-65
QBK42982.1|1894971_1895151_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	4.6e-15
QBK42983.1|1895140_1896094_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	67.4	3.5e-85
QBK42984.1|1896908_1897286_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	72.8	6.7e-48
QBK42985.1|1897298_1898279_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.2	4.9e-135
QBK42986.1|1898292_1898871_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.1	9.3e-49
QBK42987.1|1898953_1899433_-	hypothetical protein	NA	F1C594	Cronobacter_phage	55.6	2.9e-40
QBK42988.1|1899687_1900035_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	71.0	1.5e-38
QBK42989.1|1900037_1900577_+	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	1.1e-101
QBK42990.1|1900573_1900921_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.0	3.0e-39
QBK42991.1|1900917_1901193_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	85.7	1.7e-05
QBK46111.1|1901143_1901338_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	82.5	3.6e-21
QBK42992.1|1901518_1902142_-	hypothetical protein	NA	NA	NA	NA	NA
QBK42993.1|1902319_1902565_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	98.8	1.6e-34
QBK42994.1|1902631_1902853_+	hypothetical protein	NA	NA	NA	NA	NA
QBK42995.1|1902908_1903199_+	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	94.8	2.9e-51
QBK42996.1|1903211_1903421_+	serine acetyltransferase	NA	A0A286N2R4	Klebsiella_phage	84.1	2.4e-23
QBK42997.1|1903542_1903977_+	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	100.0	6.2e-74
QBK42998.1|1903986_1905519_+|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	99.8	1.1e-295
QBK42999.1|1905521_1906799_+|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	100.0	6.2e-247
QBK43000.1|1906804_1907485_+|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	100.0	1.6e-124
QBK43001.1|1907496_1908660_+|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	99.7	1.0e-211
QBK43002.1|1908696_1908939_+	hypothetical protein	NA	NA	NA	NA	NA
QBK43003.1|1908886_1909213_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	100.0	7.5e-56
QBK43004.1|1909273_1909471_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	100.0	1.7e-26
QBK43005.1|1909472_1909805_+|head,tail	head-tail adaptor protein	head,tail	A0A286S2A2	Klebsiella_phage	99.1	2.0e-56
QBK43006.1|1909797_1910337_+	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	100.0	1.0e-94
QBK43007.1|1910333_1910699_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	91.7	1.9e-60
QBK43008.1|1910755_1911247_+|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	99.4	2.5e-87
QBK43009.1|1911290_1911644_+|tail	phage tail protein	tail	A0A286S1N4	Klebsiella_phage	99.1	3.8e-61
QBK46112.1|1911676_1911940_+|tail	phage tail protein	tail	A0A286S1P2	Klebsiella_phage	98.8	5.9e-43
QBK43010.1|1912005_1912473_+	hypothetical protein	NA	NA	NA	NA	NA
QBK43011.1|1912517_1914965_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	66.1	1.2e-275
QBK43012.1|1914964_1915444_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	95.6	8.1e-91
QBK43013.1|1915430_1915913_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	98.8	3.0e-85
QBK43014.1|1915922_1916303_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	96.0	1.4e-69
QBK43015.1|1916299_1919368_+	kinase	NA	A0A286S259	Klebsiella_phage	97.1	0.0e+00
QBK43016.1|1919442_1921596_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	42.2	3.6e-90
QBK43017.1|1921608_1922343_+	hypothetical protein	NA	NA	NA	NA	NA
QBK43018.1|1922354_1922684_-	hypothetical protein	NA	NA	NA	NA	NA
QBK43019.1|1922720_1923050_-	hypothetical protein	NA	NA	NA	NA	NA
QBK43020.1|1923404_1923644_+	DNA polymerase V	NA	I6PD82	Cronobacter_phage	55.7	1.5e-21
QBK43021.1|1923600_1923969_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	49.1	2.3e-24
QBK43022.1|1924141_1925893_-	hypothetical protein	NA	NA	NA	NA	NA
QBK43023.1|1926455_1927337_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
1926172:1926296	attR	GATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATTGGGAAATACAGAATAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTACGGGTGGTTTTTTTGTT	NA	NA	NA	NA
QBK43024.1|1927435_1928104_+	YecA family protein	NA	NA	NA	NA	NA
QBK43025.1|1928128_1929340_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
QBK46113.1|1929531_1929771_+	DUF2492 family protein	NA	NA	NA	NA	NA
QBK43026.1|1929806_1930304_-	non-heme ferritin	NA	NA	NA	NA	NA
QBK46114.1|1930361_1930541_-	hypothetical protein	NA	NA	NA	NA	NA
QBK43027.1|1930712_1931351_+	hypothetical protein	NA	NA	NA	NA	NA
QBK43028.1|1931400_1932822_-	MFS transporter	NA	NA	NA	NA	NA
QBK43029.1|1932972_1933224_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
QBK43030.1|1933261_1934824_-	MFS transporter	NA	NA	NA	NA	NA
QBK43031.1|1934838_1934997_+	succinate dehydrogenase	NA	NA	NA	NA	NA
QBK43032.1|1935067_1935577_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
QBK43033.1|1935670_1935874_+	hypothetical protein	NA	NA	NA	NA	NA
QBK43034.1|1936468_1937449_+	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
QBK43035.1|1937511_1939026_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	30.0	6.9e-11
QBK46115.1|1939040_1940021_+	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
QBK43036.1|1940182_1940971_+	trehalose-phosphatase	NA	NA	NA	NA	NA
QBK43037.1|1940945_1942370_+	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
QBK43038.1|1942393_1942822_-	universal stress protein UspC	NA	NA	NA	NA	NA
QBK43039.1|1943174_1944758_+	MFS transporter	NA	NA	NA	NA	NA
QBK43040.1|1944762_1945902_+	glycoside hydrolase family 105 protein	NA	NA	NA	NA	NA
QBK43041.1|1945963_1947697_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	1.4e-87
QBK43042.1|1947932_1948502_+	VOC family protein	NA	NA	NA	NA	NA
QBK43043.1|1948578_1949322_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
QBK43044.1|1949403_1950408_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
QBK43045.1|1950404_1951148_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.4	1.4e-25
QBK43046.1|1951187_1951583_-	hypothetical protein	NA	NA	NA	NA	NA
QBK43047.1|1951635_1952454_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.1e-60
QBK43048.1|1952450_1953017_-	hydrolase	NA	NA	NA	NA	NA
QBK43049.1|1953284_1955072_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.2	1.3e-11
>prophage 4
CP034778	Klebsiella pneumoniae strain 18CPO060 chromosome, complete genome	5288751	2755909	2766796	5288751		Escherichia_phage(87.5%)	9	NA	NA
QBK43789.1|2755909_2759017_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.5	0.0e+00
QBK43790.1|2759071_2760337_+	MFS transporter	NA	NA	NA	NA	NA
QBK43791.1|2760367_2761456_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	99.7	1.0e-210
QBK43792.1|2761542_2761803_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
QBK43793.1|2762100_2762961_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
QBK43794.1|2762981_2763743_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	99.6	5.5e-134
QBK43795.1|2764003_2764906_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
QBK43796.1|2764917_2766183_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	6.6e-233
QBK43797.1|2766175_2766796_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 5
CP034778	Klebsiella pneumoniae strain 18CPO060 chromosome, complete genome	5288751	2802079	2883091	5288751	tail,head,lysis,integrase,transposase,terminase,capsid,protease,portal	Salmonella_phage(18.6%)	88	2806701:2806717	2881890:2881906
QBK46167.1|2802079_2802817_+|protease	serine protease	protease	NA	NA	NA	NA
QBK43830.1|2802830_2802947_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
QBK43831.1|2802990_2803320_-	multidrug efflux SMR transporter subunit KpnF	NA	NA	NA	NA	NA
QBK43832.1|2803306_2803669_-	multidrug efflux SMR transporter subunit KpnE	NA	NA	NA	NA	NA
QBK43833.1|2804111_2805146_+	AI-2E family transporter	NA	NA	NA	NA	NA
QBK43834.1|2805370_2807026_+	malonate decarboxylase subunit alpha	NA	NA	NA	NA	NA
2806701:2806717	attL	TGCCGCTGGCGCCGGTG	NA	NA	NA	NA
QBK43835.1|2807025_2807868_+	2-(5''-triphosphoribosyl)-3'-dephosphocoenzyme-A synthase	NA	NA	NA	NA	NA
QBK43836.1|2807885_2808185_+	malonate decarboxylase acyl carrier protein	NA	NA	NA	NA	NA
QBK43837.1|2808177_2809011_+	biotin-independent malonate decarboxylase subunit beta	NA	NA	NA	NA	NA
QBK43838.1|2809010_2809811_+	biotin-independent malonate decarboxylase subunit gamma	NA	NA	NA	NA	NA
QBK43839.1|2809947_2810907_+	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	2.7e-53
QBK43840.1|2810910_2811528_+	malonate decarboxylase holo-ACP synthase	NA	NA	NA	NA	NA
QBK43841.1|2811527_2812430_+	malonate decarboxylase subunit epsilon	NA	NA	NA	NA	NA
QBK43842.1|2812419_2813346_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
QBK43843.1|2813503_2815159_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
QBK43844.1|2815423_2816344_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
QBK43845.1|2816507_2816864_-	hypothetical protein	NA	NA	NA	NA	NA
QBK43846.1|2817019_2818636_+	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
QBK43847.1|2818632_2819352_+	two-component system response regulator DcuR	NA	NA	NA	NA	NA
QBK43848.1|2819332_2820283_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
QBK43849.1|2820350_2823128_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.0	6.8e-65
QBK43850.1|2823214_2823346_-	transcriptional regulator	NA	NA	NA	NA	NA
QBK43851.1|2823770_2825282_+	anion permease	NA	NA	NA	NA	NA
QBK43852.1|2825336_2826989_+	class I fumarate hydratase	NA	NA	NA	NA	NA
QBK43853.1|2827151_2828768_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
QBK43854.1|2829375_2829765_-	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
QBK43855.1|2829757_2830522_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
QBK43856.1|2830511_2831864_-	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
QBK46168.1|2831873_2833076_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
QBK43857.1|2833086_2833743_-	CoA transferase subunit B	NA	NA	NA	NA	NA
QBK43858.1|2833753_2834440_-	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
QBK43859.1|2834609_2835416_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
QBK43860.1|2835412_2835976_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
QBK43861.1|2836077_2836986_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
QBK43862.1|2837152_2838463_+	amidohydrolase	NA	NA	NA	NA	NA
QBK43863.1|2838462_2839908_+	amidohydrolase	NA	NA	NA	NA	NA
QBK43864.1|2840027_2841146_+	aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
QBK43865.1|2841274_2842375_+|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	56.8	8.3e-115
QBK43866.1|2843575_2843875_-	hypothetical protein	NA	NA	NA	NA	NA
QBK43867.1|2844042_2844687_+	hypothetical protein	NA	NA	NA	NA	NA
QBK43868.1|2844742_2845477_-	hypothetical protein	NA	NA	NA	NA	NA
QBK43869.1|2845489_2847643_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	42.2	6.2e-90
QBK43870.1|2847715_2850793_-	kinase	NA	A0A286S259	Klebsiella_phage	61.8	0.0e+00
QBK43871.1|2850789_2851170_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	79.4	7.9e-57
QBK43872.1|2851182_2851659_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	64.6	5.3e-50
QBK43873.1|2851645_2852119_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	61.4	1.2e-54
QBK43874.1|2852140_2855719_-|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	59.1	1.2e-242
QBK43875.1|2855781_2856303_-	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	45.2	1.7e-09
QBK43876.1|2856377_2856683_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
QBK43877.1|2856685_2857090_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	54.6	3.6e-31
QBK43878.1|2857120_2857825_-|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	66.5	1.6e-79
QBK43879.1|2857881_2858229_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
QBK43880.1|2858225_2858675_-	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
QBK43881.1|2858662_2859010_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	74.1	1.5e-41
QBK43882.1|2859268_2860192_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.1	2.8e-172
QBK43883.1|2860401_2860605_-	hypothetical protein	NA	M1FN89	Enterobacteria_phage	42.4	2.3e-07
QBK43884.1|2860643_2861852_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	84.5	9.9e-194
QBK46169.1|2861866_2862520_-|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	86.9	1.0e-104
QBK43885.1|2862506_2863736_-|portal	phage portal protein	portal	U5P411	Shigella_phage	81.2	5.0e-201
QBK43886.1|2863735_2863921_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	63.9	5.2e-14
QBK43887.1|2863930_2865661_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	83.0	2.3e-300
QBK43888.1|2865657_2866152_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	92.0	1.2e-81
QBK43889.1|2866282_2866633_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	80.2	7.1e-52
QBK43890.1|2866620_2866854_-	hypothetical protein	NA	NA	NA	NA	NA
QBK43891.1|2867264_2867615_-	hypothetical protein	NA	H2EQH5	Salmonella_phage	39.7	2.1e-11
QBK43892.1|2867611_2868151_-	lysozyme	NA	K7PM52	Enterobacteria_phage	79.0	1.0e-81
QBK43893.1|2868153_2868402_-|lysis	lysis protein	lysis	NA	NA	NA	NA
QBK43894.1|2868652_2869738_+	hypothetical protein	NA	NA	NA	NA	NA
QBK43895.1|2869737_2870730_+	hypothetical protein	NA	NA	NA	NA	NA
QBK43896.1|2870769_2871117_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	85.0	4.0e-55
QBK43897.1|2871135_2872116_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	1.9e-134
QBK43898.1|2872128_2872506_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	5.1e-48
QBK43899.1|2872515_2873325_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.7	1.6e-110
QBK43900.1|2873321_2874290_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	66.4	4.6e-85
QBK43901.1|2874327_2874459_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	76.7	2.4e-13
QBK43902.1|2874696_2875149_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	87.8	2.6e-67
QBK43903.1|2875177_2875441_-	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	47.9	3.7e-13
QBK43904.1|2875542_2876019_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	45.3	2.0e-12
QBK43905.1|2876190_2877345_+	type I restriction endonuclease subunit R	NA	A0A1S5SAB0	Streptococcus_phage	28.2	1.5e-34
QBK43906.1|2877728_2878652_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.8	4.5e-106
QBK43907.1|2878739_2879039_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	46.7	9.4e-13
QBK43908.1|2879038_2879824_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.9	5.3e-63
QBK43909.1|2879951_2880296_+	hypothetical protein	NA	NA	NA	NA	NA
QBK43910.1|2880288_2880951_+	morphogenetic protein	NA	Q71T76	Escherichia_phage	56.0	2.2e-54
QBK43911.1|2880947_2881133_+	hypothetical protein	NA	NA	NA	NA	NA
QBK43912.1|2881252_2881513_+	pyocin activator protein PrtN	NA	A0A1L5C290	Pseudoalteromonas_phage	43.7	1.5e-11
QBK43913.1|2882124_2882283_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
2881890:2881906	attR	TGCCGCTGGCGCCGGTG	NA	NA	NA	NA
QBK43914.1|2882575_2883091_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.9	2.0e-23
>prophage 6
CP034778	Klebsiella pneumoniae strain 18CPO060 chromosome, complete genome	5288751	3472525	3481989	5288751	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
QBK44427.1|3472525_3474247_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
QBK44428.1|3474291_3474993_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
QBK44429.1|3475346_3475565_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
QBK44430.1|3475685_3477965_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
QBK44431.1|3477995_3478313_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
QBK44432.1|3478638_3478860_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
QBK44433.1|3478936_3480877_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	40.1	1.2e-36
QBK44434.1|3480873_3481989_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 1
CP034777	Klebsiella pneumoniae strain 18CPO060 plasmid pKPCKP060, complete sequence	109503	5222	43421	109503	integrase,transposase	Escherichia_phage(29.41%)	36	NA	NA
QBK41192.1|5222_6938_-|integrase	integrase	integrase	NA	NA	NA	NA
QBK41193.1|7047_10077_+|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
QBK41194.1|10183_11209_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
QBK41195.1|11205_11985_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
QBK41196.1|11981_12221_+	hypothetical protein	NA	NA	NA	NA	NA
QBK41197.1|12272_13154_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
QBK41198.1|13403_14723_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
QBK41199.1|14999_16184_-|transposase	ISAs1-like element ISKpn31 family transposase	transposase	NA	NA	NA	NA
QBK41200.1|16687_17047_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	62.0	3.6e-19
QBK41201.1|19087_19798_-	AAA family ATPase	NA	NA	NA	NA	NA
QBK41202.1|19871_20288_-	PIN domain-containing protein	NA	NA	NA	NA	NA
QBK41300.1|20284_20515_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
QBK41203.1|20498_20933_+	hypothetical protein	NA	NA	NA	NA	NA
QBK41204.1|20856_21051_-	hypothetical protein	NA	NA	NA	NA	NA
QBK41205.1|21102_21321_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
QBK41206.1|21322_21628_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
QBK41301.1|21832_22192_+	hypothetical protein	NA	NA	NA	NA	NA
QBK41207.1|22218_22542_+	hypothetical protein	NA	NA	NA	NA	NA
QBK41208.1|22538_23555_+	hypothetical protein	NA	NA	NA	NA	NA
QBK41209.1|23889_25158_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.4	1.1e-59
QBK41210.1|25162_28420_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
QBK41211.1|28420_29695_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
QBK41212.1|29691_31719_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
QBK41213.1|31872_32667_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
QBK41302.1|33090_33270_-	Par-like protein	NA	NA	NA	NA	NA
QBK41303.1|33389_34016_-	cobyrinic acid ac-diamide synthase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
QBK41214.1|34603_34984_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
QBK41215.1|34980_35328_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
QBK41216.1|35377_36916_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
QBK41217.1|37122_37998_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
QBK41218.1|38409_39681_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.0	3.1e-153
QBK41219.1|39680_40112_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
QBK41220.1|40344_41316_+	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
QBK41221.1|41318_41990_+	Mediator of plasmid stability	NA	NA	NA	NA	NA
QBK41222.1|42052_42283_+	hypothetical protein	NA	NA	NA	NA	NA
QBK41223.1|42719_43421_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	9.3e-27
>prophage 1
CP034776	Klebsiella pneumoniae strain 18CPO060 plasmid phvKP060, complete sequence	218147	5108	67686	218147	transposase	Enterobacteria_phage(22.22%)	57	NA	NA
QBK40998.1|5108_6032_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.1	2.8e-172
QBK40999.1|6709_7027_-	hypothetical protein	NA	NA	NA	NA	NA
QBK41000.1|7178_7502_-	hypothetical protein	NA	NA	NA	NA	NA
QBK41001.1|8253_9213_-	DNA replication protein	NA	NA	NA	NA	NA
QBK41002.1|9255_9663_-	hypothetical protein	NA	NA	NA	NA	NA
QBK41003.1|9672_10116_-	hypothetical protein	NA	NA	NA	NA	NA
QBK41004.1|11379_12348_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	7.3e-14
QBK41005.1|12616_14209_-|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.6	1.6e-175
QBK41006.1|14239_14590_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
QBK41007.1|14586_15027_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	53.8	4.4e-19
QBK41008.1|15223_15406_+	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	57.1	9.1e-11
QBK41009.1|16654_17626_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	89.7	6.6e-156
QBK41010.1|17625_18792_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	2.0e-223
QBK41011.1|18747_18996_+	hypothetical protein	NA	NA	NA	NA	NA
QBK41012.1|19210_19492_-	hypothetical protein	NA	NA	NA	NA	NA
QBK41013.1|19521_20532_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	53.5	1.1e-86
QBK41014.1|22851_23388_-	plasmid transfer protein	NA	NA	NA	NA	NA
QBK41015.1|26138_26921_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.1	3.0e-135
QBK41178.1|29267_29705_-	hypothetical protein	NA	NA	NA	NA	NA
QBK41016.1|29704_30736_-	ParB/RepB/Spo0J family partition protein	NA	S5WII0	Leptospira_phage	26.1	2.9e-08
QBK41017.1|30735_31602_-	ParA family protein	NA	NA	NA	NA	NA
QBK41018.1|32579_34271_+	hypothetical protein	NA	NA	NA	NA	NA
QBK41019.1|34333_35257_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.5	1.1e-165
QBK41020.1|35347_35638_-	hypothetical protein	NA	NA	NA	NA	NA
QBK41021.1|35989_36196_+	hypothetical protein	NA	NA	NA	NA	NA
QBK41022.1|36185_36479_-	korC	NA	NA	NA	NA	NA
QBK41023.1|36494_37628_-	hypothetical protein	NA	NA	NA	NA	NA
QBK41024.1|38235_38466_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
QBK41025.1|38462_38906_+	PIN domain-containing protein	NA	NA	NA	NA	NA
QBK41026.1|41192_41468_-	GAF domain-containing protein	NA	NA	NA	NA	NA
QBK41027.1|41395_41599_-	hypothetical protein	NA	NA	NA	NA	NA
QBK41028.1|41689_42610_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
QBK41029.1|42658_43150_-	hypothetical protein	NA	NA	NA	NA	NA
QBK41030.1|43212_43488_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
QBK41031.1|43571_44000_-	DUF417 family protein	NA	NA	NA	NA	NA
QBK41032.1|44037_44598_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
QBK41033.1|44639_44900_-	DUF1471 domain-containing protein	NA	A0A1B2IE60	Erwinia_phage	51.0	1.1e-06
QBK41034.1|45566_47768_-	TonB-dependent receptor	NA	NA	NA	NA	NA
QBK41035.1|47849_49127_-	lysine 6-monooxygenase	NA	NA	NA	NA	NA
QBK41036.1|49130_50864_-	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
QBK41037.1|50863_51811_-	N-acetyltransferase	NA	NA	NA	NA	NA
QBK41038.1|51811_53536_-	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
QBK41039.1|53668_54892_+	MFS transporter	NA	NA	NA	NA	NA
QBK41040.1|55241_55448_+	hypothetical protein	NA	NA	NA	NA	NA
QBK41041.1|55589_55784_+	hypothetical protein	NA	NA	NA	NA	NA
QBK41042.1|56644_57154_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	8.8e-19
QBK41043.1|57703_58021_-	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
QBK41044.1|58017_58257_-	hypothetical protein	NA	NA	NA	NA	NA
QBK41045.1|58257_58644_-	transcriptional repressor	NA	NA	NA	NA	NA
QBK41046.1|58741_59941_+	cobalamin biosynthesis protein CobW	NA	NA	NA	NA	NA
QBK41047.1|60323_61031_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
QBK41048.1|61693_62692_-	iron ABC transporter permease	NA	NA	NA	NA	NA
QBK41049.1|62697_63654_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
QBK41050.1|63675_64503_-	ABC transporter ATP-binding protein	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.4	2.2e-11
QBK41051.1|65247_66171_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.5	1.1e-165
QBK41052.1|66285_66444_-	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.7	2.2e-05
QBK41053.1|66756_67686_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.4	5.6e-72
