The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LS483496	Haemophilus influenzae strain NCTC8455 genome assembly, chromosome: 1	1865137	111749	121929	1865137	tRNA	Bacillus_phage(33.33%)	12	NA	NA
SQK92370.1|111749_112766_+	nucleoid-associated protein NdpA	NA	A0A1V0E8C0	Vibrio_phage	44.6	5.6e-73
SQK92371.1|112831_113245_+	small protein A	NA	NA	NA	NA	NA
SQK92372.1|113295_113979_+	DNA-binding response regulator in two-component regulatory system with CpxA	NA	W8CYM9	Bacillus_phage	39.3	3.4e-34
SQK92373.1|114062_114422_+	sensory histidine kinase in two-component regulatory system with CpxR	NA	W8CYF6	Bacillus_phage	36.1	1.2e-09
SQK92374.1|114454_115426_-|tRNA	lysyl-tRNA synthetase	tRNA	A0A2K9L3L6	Tupanvirus	27.1	3.1e-28
SQK92375.1|115636_117436_+	fumarate reductase (anaerobic) catalytic and NAD/flavoprotein subunit	NA	M1HTN0	Paramecium_bursaria_Chlorella_virus	24.9	3.8e-16
SQK92376.1|117428_118199_+	fumarate reductase (anaerobic), Fe-S subunit	NA	NA	NA	NA	NA
SQK92377.1|118209_118620_+	fumarate reductase (anaerobic), membrane anchor subunit	NA	NA	NA	NA	NA
SQK92378.1|118631_118976_+	fumarate reductase (anaerobic), membrane anchor subunit	NA	NA	NA	NA	NA
SQK92379.1|119082_119667_-	biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
SQK92380.1|119809_120115_-	DNA-binding transcriptional repressor, tryptophan-binding	NA	NA	NA	NA	NA
SQK92381.1|120147_121929_-	intracellular septation protein A	NA	K4NWI2	Pseudomonas_phage	39.5	2.6e-17
>prophage 2
LS483496	Haemophilus influenzae strain NCTC8455 genome assembly, chromosome: 1	1865137	864161	876026	1865137		Liberibacter_phage(28.57%)	9	NA	NA
SQK93283.1|864161_865958_+	aerobic respiration control sensor protein ArcB	NA	A0A1V0SGX0	Hokovirus	31.8	5.4e-39
SQK93284.1|866171_866801_+	inner membrane protein	NA	NA	NA	NA	NA
SQK93285.1|866947_868399_-	type I restriction-modification system	NA	A0A220A398	Liberibacter_phage	32.0	2.9e-06
SQK93286.1|868514_870023_-	type I restriction-modification system	NA	A0A220A398	Liberibacter_phage	24.3	4.2e-16
SQK93287.1|870407_871631_-	Probable type I restriction-modification system specificity determinant	NA	A0A1V0SLK8	Klosneuvirus	26.0	6.0e-13
SQK93288.1|871772_872201_-	DNA binding protein	NA	Q9JMN3	Wolbachia_phage	42.6	4.5e-16
SQK93289.1|872203_873052_-	putative type I restriction-modification system methyltransferase subunit	NA	A0A2H4PQP4	Staphylococcus_phage	44.8	3.6e-49
SQK93290.1|873248_873749_-	putative type I restriction-modification system methyltransferase subunit	NA	NA	NA	NA	NA
SQK93292.1|873980_876026_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	24.8	4.6e-50
>prophage 3
LS483496	Haemophilus influenzae strain NCTC8455 genome assembly, chromosome: 1	1865137	1035588	1133641	1865137	tail,terminase,lysis,holin,head,protease,portal,capsid	Mannheimia_phage(26.92%)	79	NA	NA
SQK93581.1|1035588_1036053_+|protease	metalloprotease	protease	NA	NA	NA	NA
SQK93583.1|1036071_1036857_+	haloacid dehalogenase-like protein	NA	NA	NA	NA	NA
SQK93585.1|1036893_1038693_-	long chain fatty acid CoA ligase	NA	A0A1V0SBX8	Catovirus	24.7	1.9e-44
SQK93587.1|1038886_1039906_-	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
SQK93590.1|1040156_1040783_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.6	7.5e-20
SQK93592.1|1040845_1041112_+	RNA polymerase subunit omega	NA	NA	NA	NA	NA
SQK93594.1|1041403_1043518_+	bifunctional (p)ppGpp synthetase II/ guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	38.8	2.5e-11
SQK93597.1|1043514_1045596_+	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
SQK93599.1|1045625_1046435_+	glutamate racemase	NA	NA	NA	NA	NA
SQK93601.1|1046645_1047791_+	L-lactate dehydrogenase, FMN-linked	NA	NA	NA	NA	NA
SQK93603.1|1053853_1054783_+	DNA-binding transcriptional activator, homocysteine-binding	NA	NA	NA	NA	NA
SQK93605.1|1054792_1055512_+	branched-chain amino acid permease	NA	NA	NA	NA	NA
SQK93608.1|1055508_1055838_+	branched-chain amino acid permease	NA	NA	NA	NA	NA
SQK93610.1|1055940_1056174_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
SQK93612.1|1056249_1057830_-	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	26.1	3.3e-32
SQK93653.1|1058159_1058948_+	enoyl-ACP reductase	NA	NA	NA	NA	NA
SQK93655.1|1059027_1061007_+	ribonuclease II	NA	Q0GXV6	Lactococcus_phage	25.1	3.8e-25
SQK93656.1|1061386_1066870_+	hemophilus surface fibril	NA	NA	NA	NA	NA
SQK93658.1|1067106_1067748_+	allophanate hydrolase subunit 1	NA	NA	NA	NA	NA
SQK93660.1|1067744_1068674_+	allophanate hydrolase subunit 2	NA	NA	NA	NA	NA
SQK93662.1|1068660_1069398_+	lactam utilization protein	NA	NA	NA	NA	NA
SQK93663.1|1069441_1070635_+	Mn2+ and Fe2+ transporter of the NRAMP family	NA	NA	NA	NA	NA
SQK93665.1|1070715_1072050_-	argininosuccinate synthetase	NA	A0A140XAJ5	Dickeya_phage	79.4	2.2e-53
SQK93667.1|1072226_1073099_-	phosphoribosylaminoimidazole-succinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	35.7	4.3e-50
SQK93668.1|1073264_1075613_-	penicillin-binding protein 1b	NA	NA	NA	NA	NA
SQK93670.1|1075619_1076018_-	Uncharacterised protein family (UPF0231)	NA	NA	NA	NA	NA
SQK93672.1|1075974_1076319_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	48.6	1.7e-26
SQK93674.1|1076454_1077261_+	methionine aminopeptidase	NA	NA	NA	NA	NA
SQK93675.1|1077353_1079945_+	uridylyltransferase	NA	NA	NA	NA	NA
SQK93677.1|1080733_1081801_+	UDP-GlcNAc:undecaprenylphosphate GlcNAc-1-phosphate transferase	NA	NA	NA	NA	NA
SQK93679.1|1082098_1082647_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.7	2.7e-29
SQK93681.1|1082717_1083758_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
SQK93683.1|1083915_1084173_+	phosphohistidinoprotein-hexose phosphotransferase component of PTS system (Hpr)	NA	NA	NA	NA	NA
SQK93685.1|1084252_1085980_+	PEP-protein phosphotransferase of PTS system (enzyme I)	NA	NA	NA	NA	NA
SQK93688.1|1086039_1086540_+	glucose-specific enzyme IIA component of PTS	NA	NA	NA	NA	NA
SQK93690.1|1086887_1087253_+	putative outer membrane protein	NA	A0A1I9LJU6	Stx_converting_phage	34.2	5.9e-09
SQK93691.1|1087316_1087982_+	DNA-binding response regulator in two-component regulatory system with QseC	NA	NA	NA	NA	NA
SQK93692.1|1087978_1089334_+	sensory histidine kinase in two-component regulatory system with QseB	NA	W8CYF6	Bacillus_phage	26.8	2.1e-14
SQK93693.1|1089683_1091627_+|holin	choline transporter of high affinity	holin	A0A2I7QNT1	Vibrio_phage	24.8	1.5e-18
SQK93694.1|1091663_1093139_-	aminopeptidase A	NA	Q6GYZ8	Mycoplasma_phage	35.2	4.2e-45
SQK93695.1|1093245_1094349_+	permease	NA	NA	NA	NA	NA
SQK93696.1|1094345_1095422_+	permease	NA	NA	NA	NA	NA
SQK93697.1|1095615_1097886_+	5- methyltetrahydropteroyltriglutamate/homocysteine S-methyltransferase	NA	NA	NA	NA	NA
SQK93698.1|1098533_1099544_-|portal	portal vertex protein	portal	Q19UT6	Mannheimia_phage	60.4	6.2e-117
SQK93699.1|1099553_1101119_-	Terminase, ATPase subunit	NA	A0A0M3LRV4	Mannheimia_phage	63.7	1.8e-195
SQK93700.1|1101202_1101388_+|capsid	Probable bacteriophage capsid scaffolding protein	capsid	NA	NA	NA	NA
SQK93701.1|1101409_1102459_+|capsid	major capsid protein	capsid	Q19UT3	Mannheimia_phage	50.7	1.4e-87
SQK93702.1|1102470_1103121_+|terminase	terminase, endonuclease subunit	terminase	Q19US0	Mannheimia_phage	45.5	3.5e-44
SQK93703.1|1103413_1103920_+|head	putative phage head completion	head	A0A0M3LNL8	Mannheimia_phage	51.0	8.1e-33
SQK93704.1|1103919_1104129_+|tail	Probable bacteriophage tail protein X	tail	A0A0M3LPY0	Mannheimia_phage	45.3	4.7e-11
SQK93705.1|1104130_1104352_+|holin	holin	holin	NA	NA	NA	NA
SQK93706.1|1104344_1104863_+	phage-like lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	47.7	1.5e-37
SQK93707.1|1104847_1105198_+|lysis	phage lysis regulatory protein, LysB family	lysis	NA	NA	NA	NA
SQK93708.1|1105372_1105570_+	putative zinc finger DksA/TraR C4-type	NA	NA	NA	NA	NA
SQK93709.1|1105720_1106143_+|tail	bacteriophage tail completion protein gpS-like protein	tail	A0A2H4J927	uncultured_Caudovirales_phage	50.9	2.1e-18
SQK93710.1|1106234_1106630_+|tail	phage-related tail protein	tail	NA	NA	NA	NA
SQK93711.1|1106731_1107880_+|tail	phage-like tail protein	tail	V5YUN9	Pseudomonas_phage	39.5	2.0e-55
SQK93712.1|1108308_1109682_-	Na+-dependent transporters of the SNF family	NA	NA	NA	NA	NA
SQK93713.1|1109739_1110375_-	DNA glycosylase and apyrimidinic (AP) lyase	NA	NA	NA	NA	NA
SQK93714.1|1110554_1111262_-	inner membrane NADH-quinone reductase	NA	NA	NA	NA	NA
SQK93715.1|1111263_1111887_-	oxidoreductase	NA	NA	NA	NA	NA
SQK93716.1|1111886_1112963_-	inner membrane oxidoreductase	NA	NA	NA	NA	NA
SQK93717.1|1112967_1115427_-	electron transport complex protein RnfC	NA	NA	NA	NA	NA
SQK93718.1|1115427_1116009_-	electron transport complex protein RnfB	NA	NA	NA	NA	NA
SQK93719.1|1116096_1116675_-	inner membrane subunit	NA	NA	NA	NA	NA
SQK93720.1|1117022_1118084_-	inner membrane peptidase	NA	A0A2H4UUF9	Bodo_saltans_virus	31.7	7.4e-20
SQK93721.1|1118283_1118949_+	Uncharacterized protein conserved in bacteria (DUF2057)	NA	NA	NA	NA	NA
SQK93722.1|1119016_1121173_+	inner membrane protein	NA	NA	NA	NA	NA
SQK93723.1|1121271_1121814_-	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase	NA	A0A140XBD6	Dickeya_phage	42.6	9.0e-22
SQK93724.1|1121823_1122759_-	arabinose-5-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	35.5	3.6e-42
SQK93725.1|1123372_1124044_-	regulator of cell morphogenesis and cell wall metabolism	NA	NA	NA	NA	NA
SQK93726.1|1125593_1126076_+	molybdopterin biosynthesis, protein C	NA	NA	NA	NA	NA
SQK93727.1|1126077_1126323_+	molybdopterin synthase, small subunit	NA	NA	NA	NA	NA
SQK93728.1|1126323_1126776_+	molybdopterin synthase, large subunit	NA	NA	NA	NA	NA
SQK93729.1|1126830_1129476_-	paraquat-inducible protein B-like protein	NA	NA	NA	NA	NA
SQK93730.1|1129459_1130542_-	paraquat-inducible protein A-like protein	NA	NA	NA	NA	NA
SQK93731.1|1130642_1130774_+	Uncharacterised protein	NA	NA	NA	NA	NA
SQK93732.1|1130893_1131532_+	structural transport element	NA	NA	NA	NA	NA
SQK93733.1|1131559_1133641_+|protease	carboxy-terminal protease	protease	A0A0R6PIZ1	Moraxella_phage	32.3	5.5e-83
>prophage 4
LS483496	Haemophilus influenzae strain NCTC8455 genome assembly, chromosome: 1	1865137	1270782	1374756	1865137	integrase,tail,terminase,lysis,plate,holin,protease,portal,capsid,tRNA	Mannheimia_phage(36.59%)	104	1284971:1284990	1343926:1343945
SQK93919.1|1270782_1271235_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	56.1	2.5e-25
SQK93920.1|1271270_1273136_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
SQK93921.1|1273189_1274080_-	geranyltranstransferase	NA	NA	NA	NA	NA
SQK93922.1|1274079_1274349_-	exonuclease VII small subunit	NA	NA	NA	NA	NA
SQK93923.1|1274507_1275965_+	sulfurtransferase required for thiamine and 4-thiouridine biosynthesis	NA	NA	NA	NA	NA
SQK93924.1|1275980_1276301_+	Domain of uncharacterised function, DUF446	NA	NA	NA	NA	NA
SQK93925.1|1276294_1277014_+|tRNA	tRNA pseudouridine synthase	tRNA	NA	NA	NA	NA
SQK93926.1|1277006_1277165_+	Uncharacterized protein conserved in bacteria	NA	NA	NA	NA	NA
SQK93927.1|1277311_1277530_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	53.1	2.2e-11
SQK93928.1|1277597_1278044_-	macrodomain Ter protein	NA	NA	NA	NA	NA
SQK93929.1|1278170_1279946_+|protease	protease La	protease	NA	NA	NA	NA
SQK93930.1|1280115_1280649_+	beta-hydroxydecanoyl thioester dehydrase	NA	NA	NA	NA	NA
SQK93931.1|1280887_1281613_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
SQK93932.1|1281609_1281744_+	Uncharacterised protein	NA	NA	NA	NA	NA
SQK93933.1|1282876_1284316_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
SQK93934.1|1284479_1284956_+	transcription elongation factor greA	NA	NA	NA	NA	NA
1284971:1284990	attL	GTTAAAAATGACCGCACTTT	NA	NA	NA	NA
SQK93935.1|1284995_1285295_-	23S rRNA methyltransferase J	NA	NA	NA	NA	NA
SQK93936.1|1285421_1286051_+	ribosomal RNA large subunit methyltransferase J	NA	NA	NA	NA	NA
SQK93937.1|1286141_1288049_+|protease	protease, ATP-dependent zinc-metallo	protease	M4QMW8	Micromonas_pusilla_virus	42.5	5.0e-115
SQK93938.1|1288160_1288988_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.5	1.4e-13
SQK93939.1|1289025_1290363_+	phosphoglucosamine mutase	NA	A0A127AWJ1	Bacillus_phage	23.4	2.9e-13
SQK93940.1|1290421_1290916_+	phosphohistidine phosphatase	NA	NA	NA	NA	NA
SQK93941.1|1291128_1291692_+	Late embryogenesis abundant protein	NA	NA	NA	NA	NA
SQK93942.1|1291768_1293133_-	outer membrane efflux protein	NA	NA	NA	NA	NA
SQK93943.1|1293849_1295517_+|tRNA	glutamyl-tRNA synthetase	tRNA	A0A222YZ70	Escherichia_phage	77.2	5.3e-254
SQK93944.1|1295594_1296047_+	Uncharacterized conserved protein	NA	NA	NA	NA	NA
SQK93945.1|1296117_1298208_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
SQK93946.1|1298217_1300413_+	glycogen branching enzyme	NA	NA	NA	NA	NA
SQK93947.1|1300560_1302540_+	glycogen operon protein	NA	NA	NA	NA	NA
SQK93948.1|1302562_1303864_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
SQK93949.1|1303971_1305402_+	glycogen synthase	NA	NA	NA	NA	NA
SQK93950.1|1305648_1308114_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	54.2	5.0e-19
SQK93951.1|1309097_1309871_-	DNA-binding transcriptional dual regulator	NA	NA	NA	NA	NA
SQK93952.1|1309961_1310054_+	Uncharacterised protein	NA	NA	NA	NA	NA
SQK93953.1|1310463_1311051_+|integrase	phage integrase family protein	integrase	A0A0M3LRG1	Mannheimia_phage	47.9	3.2e-41
SQK93954.1|1311058_1311466_+|integrase	putative integrase/recombinase	integrase	Q19US1	Mannheimia_phage	56.7	4.4e-37
SQK93955.1|1311462_1311753_-	Uncharacterised protein	NA	A0A0M3LQ35	Mannheimia_phage	42.4	5.0e-11
SQK93956.1|1311739_1312168_-	Uncharacterised protein	NA	B3GVZ0	Streptococcus_phage	36.2	3.0e-12
SQK93957.1|1312140_1312302_-	Uncharacterised protein	NA	A0A0M3LTD8	Mannheimia_phage	85.3	2.6e-09
SQK93958.1|1312303_1312798_-	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
SQK93959.1|1312817_1314998_-	Probable bacteriophage replication protein A	NA	Q94N00	Haemophilus_virus	45.0	2.4e-174
SQK93960.1|1315017_1315299_-	Uncharacterised protein	NA	Q775F7	Haemophilus_virus	55.9	2.6e-20
SQK93961.1|1315515_1315629_-	Uncharacterised protein	NA	NA	NA	NA	NA
SQK93962.1|1315621_1315873_-	Uncharacterised protein	NA	NA	NA	NA	NA
SQK93963.1|1315887_1316082_-	Uncharacterised protein	NA	NA	NA	NA	NA
SQK93964.1|1316065_1316494_-	Uncharacterised protein	NA	NA	NA	NA	NA
SQK93965.1|1316508_1316778_-	Uncharacterised protein	NA	NA	NA	NA	NA
SQK93966.1|1316843_1317248_-|tail	tail fiber protein	tail	Q19UQ3	Mannheimia_phage	48.8	1.7e-28
SQK93967.1|1317250_1317790_-|tail	Probable bacteriophage tail protein gpI	tail	Q19UQ4	Mannheimia_phage	55.2	1.4e-51
SQK93968.1|1317779_1318694_-|plate	phage-like baseplate assembly protein	plate	Q19UQ5	Mannheimia_phage	61.2	8.5e-97
SQK93969.1|1318690_1319029_-|plate	baseplate assembly protein W	plate	Q19UQ6	Mannheimia_phage	49.5	5.8e-19
SQK93970.1|1319028_1319568_-|plate	phage P2-like baseplate assembly protein	plate	A0A0M3LPY9	Mannheimia_phage	58.0	4.7e-39
SQK93971.1|1319681_1322387_-|tail	phage-related tail protein	tail	V5YUN9	Pseudomonas_phage	33.5	1.1e-75
SQK93972.1|1322457_1322610_+	Uncharacterised protein	NA	NA	NA	NA	NA
SQK93973.1|1322663_1323131_-|tail	Probable bacteriophage tail completion protein	tail	F1BUP9	Erwinia_phage	45.2	4.3e-28
SQK93974.1|1323145_1323358_-	DnaK suppressor protein	NA	F1BUS2	Erwinia_phage	50.0	9.0e-10
SQK93975.1|1323505_1323829_-|lysis	phage lysis regulatory protein, LysB family	lysis	NA	NA	NA	NA
SQK93976.1|1323813_1324332_-	phage-related lysozyme	NA	A0A0M3LQY4	Mannheimia_phage	46.8	2.6e-34
SQK93977.1|1324312_1324540_-|holin	holin	holin	NA	NA	NA	NA
SQK93978.1|1324544_1324754_-|tail	Probable bacteriophage tail protein X	tail	R4JDL4	Burkholderia_phage	46.3	1.6e-06
SQK93979.1|1324753_1325263_-|capsid	capsid completion protein	capsid	A0A0M3LPQ0	Mannheimia_phage	47.0	1.5e-31
SQK93980.1|1325382_1326033_-|terminase	terminase, endonuclease subunit	terminase	Q19US0	Mannheimia_phage	46.1	1.1e-45
SQK93981.1|1326037_1327078_-|capsid	major capsid protein	capsid	E5E3W8	Burkholderia_phage	53.1	4.5e-94
SQK93982.1|1327137_1327965_-|capsid	Probable bacteriophage capsid scaffolding protein	capsid	Q19UT4	Mannheimia_phage	55.4	1.1e-71
SQK93983.1|1328131_1329910_+	Terminase, ATPase subunit	NA	A0A0M3LRV4	Mannheimia_phage	64.7	1.8e-215
SQK93984.1|1329919_1330930_+|portal	portal vertex protein	portal	Q19UT6	Mannheimia_phage	61.1	8.7e-119
SQK93985.1|1331608_1332628_+	dihydro-orotate oxidase, FMN-linked	NA	NA	NA	NA	NA
SQK93986.1|1332627_1333452_+	TrpH	NA	NA	NA	NA	NA
SQK93987.1|1333547_1334156_-	Uncharacterised protein	NA	NA	NA	NA	NA
SQK93988.1|1334283_1335678_-	fumarate hydratase	NA	NA	NA	NA	NA
SQK93989.1|1335913_1336348_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
SQK93990.1|1336432_1336603_+	Uncharacterised protein	NA	NA	NA	NA	NA
SQK93991.1|1336568_1337186_+	Uncharacterized protein conserved in bacteria	NA	NA	NA	NA	NA
SQK93992.1|1337212_1337527_+	ASCH domain	NA	NA	NA	NA	NA
SQK93993.1|1337549_1338188_+|tRNA	valyl-tRNA synthetase	tRNA	NA	NA	NA	NA
SQK93994.1|1338235_1341100_+|tRNA	valyl-tRNA synthetase	tRNA	A0A1V0SK04	Klosneuvirus	37.5	4.6e-149
SQK93995.1|1341134_1341410_-	hydrogenase 2 accessory protein	NA	NA	NA	NA	NA
SQK93996.1|1341540_1342971_-	fused indole-3-glycerolphosphate synthetase/N-(5-phosphoribosyl)anthranilate isomerase	NA	A0A0P0IR83	Acinetobacter_phage	38.3	5.5e-34
SQK93997.1|1343001_1344003_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	37.1	9.4e-49
1343926:1343945	attR	GTTAAAAATGACCGCACTTT	NA	NA	NA	NA
SQK93998.1|1344055_1344442_-	anthranilate phosphoribosyltransferase	NA	NA	NA	NA	NA
SQK93999.1|1344490_1345072_-	anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	39.4	1.0e-34
SQK94000.1|1345084_1346641_-	component I of anthranilate synthase	NA	A0A0B5J984	Pandoravirus	33.2	4.7e-23
SQK94001.1|1347023_1347521_-	ferritin like protein 2	NA	NA	NA	NA	NA
SQK94002.1|1347536_1348025_-	ferritin iron storage protein	NA	NA	NA	NA	NA
SQK94003.1|1348585_1348813_+	Uncharacterised protein	NA	NA	NA	NA	NA
SQK94004.1|1348923_1349943_+	phosphate transporter subunit	NA	A0A222YW41	Synechococcus_phage	40.1	5.4e-52
SQK94005.1|1350033_1350981_+	phosphate transporter subunit	NA	NA	NA	NA	NA
SQK94006.1|1350982_1351831_+	phosphate transporter subunit	NA	NA	NA	NA	NA
SQK94007.1|1351840_1352608_+	phosphate transporter subunit	NA	G3M9Y6	Bacillus_virus	30.5	7.3e-17
SQK94008.1|1352684_1353380_+	two component system DNA-binding response regulator	NA	NA	NA	NA	NA
SQK94009.1|1353376_1354642_+	sensory histidine kinase in two-component regulatory system with PhoB	NA	W8CYF6	Bacillus_phage	31.0	1.6e-24
SQK94010.1|1354868_1355009_-	Uncharacterised protein	NA	NA	NA	NA	NA
SQK94011.1|1355462_1356884_-	exonuclease I	NA	NA	NA	NA	NA
SQK94012.1|1356896_1357772_-	cell division protein MukB	NA	NA	NA	NA	NA
SQK94013.1|1357775_1358684_-	Uncharacterized conserved protein	NA	NA	NA	NA	NA
SQK94014.1|1358753_1363286_-	Structural maintenance of chromosome-related protein	NA	NA	NA	NA	NA
SQK94015.1|1363285_1364020_-	protein involved in chromosome partitioning	NA	NA	NA	NA	NA
SQK94016.1|1364168_1365503_-	condesin subunit F	NA	NA	NA	NA	NA
SQK94017.1|1365652_1366585_+|tRNA	C32 tRNA thiolase	tRNA	A0A0U2S5Z2	Escherichia_phage	80.5	1.3e-121
SQK94018.1|1366586_1366916_+|tRNA	tRNA 2-thiouridine synthesizing protein E	tRNA	A0A2H4J8B6	uncultured_Caudovirales_phage	51.9	5.8e-24
SQK94019.1|1367034_1367244_+	molybdenum-pterin binding protein	NA	NA	NA	NA	NA
SQK94020.1|1367406_1369818_+	Probable TonB-dependent transport protein	NA	NA	NA	NA	NA
SQK94021.1|1369921_1372702_+|protease	putative zinc protease	protease	NA	NA	NA	NA
SQK94022.1|1372824_1374756_-|tRNA	threonyl-tRNA synthetase	tRNA	A0A2K9L297	Tupanvirus	38.4	3.8e-131
>prophage 5
LS483496	Haemophilus influenzae strain NCTC8455 genome assembly, chromosome: 1	1865137	1767905	1794808	1865137	head,plate,tail	Haemophilus_phage(57.14%)	32	NA	NA
SQK94386.1|1767905_1769750_+	abc transporter atp-binding protein	NA	W8CYL7	Bacillus_phage	28.1	1.2e-28
SQK94387.1|1769875_1770154_-	copper chaperone MerP-like protein	NA	NA	NA	NA	NA
SQK94388.1|1770596_1772240_+	phage protein	NA	B7SDN0	Haemophilus_phage	78.6	5.9e-250
SQK94389.1|1772243_1773881_+	Mu-like prophage FluMu protein gp29	NA	B7SDN1	Haemophilus_phage	66.4	3.6e-199
SQK94390.1|1773867_1775145_+|head	SPP1 family phage head morphogenesis protein	head	B7SDN5	Haemophilus_phage	52.7	1.8e-121
SQK94391.1|1775255_1775741_+	phage virion morphogenesis protein	NA	B7SDN8	Haemophilus_phage	50.3	1.3e-32
SQK94392.1|1775994_1777044_+	bacteriophage Mu I protein GP32	NA	B7SDN9	Haemophilus_phage	61.0	2.5e-108
SQK94393.1|1777043_1777964_+	bacteriophage mu T protein	NA	B7SDP1	Haemophilus_phage	71.9	7.9e-127
SQK94394.1|1778003_1778309_+	Uncharacterised protein	NA	B7SDP3	Haemophilus_phage	50.0	1.6e-20
SQK94395.1|1778318_1778750_+	Mu-like prophage protein GP36	NA	B7SDP4	Haemophilus_phage	60.9	6.1e-37
SQK94396.1|1778733_1779396_+	Mu-like prophage protein gp37	NA	A0A0M3LQJ7	Mannheimia_phage	45.0	9.3e-45
SQK94397.1|1779367_1780858_+|tail	bacteriophage Mu tail sheath family protein	tail	A0A0M3LQC3	Mannheimia_phage	63.6	2.4e-149
SQK94398.1|1780867_1781239_+	Uncharacterised protein	NA	A0A0M3LRV6	Mannheimia_phage	65.0	6.8e-37
SQK94399.1|1781238_1781580_+	Uncharacterised protein	NA	A0A0M3LSI2	Mannheimia_phage	50.5	1.8e-20
SQK94400.1|1781847_1782003_+|tail	phage tail length determination protein	tail	NA	NA	NA	NA
SQK94401.1|1782120_1783986_+|tail	phage tail length determination protein	tail	A0A0M3LPB6	Mannheimia_phage	35.2	2.9e-67
SQK94402.1|1784138_1785473_+	putative phage virion protein	NA	F6MIL2	Haemophilus_phage	45.6	1.4e-108
SQK94403.1|1785462_1785714_+	bacteriophage Mu P family protein	NA	A0A0M3LPS4	Mannheimia_phage	63.0	1.8e-20
SQK94404.1|1785706_1786591_+	bacteriophage Mu P family protein	NA	F6MIL3	Haemophilus_phage	73.4	8.7e-115
SQK94405.1|1786600_1787236_+|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	57.2	1.6e-62
SQK94406.1|1787305_1787656_+	phage GP46 family protein	NA	A0A0M3LQK5	Mannheimia_phage	74.1	2.4e-44
SQK94407.1|1787670_1787961_+|tail	Mu phage tail protein gp47	tail	F6MIL6	Haemophilus_phage	78.7	2.5e-34
SQK94408.1|1787965_1788736_+|tail	Mu phage tail protein gp47	tail	F6MIL6	Haemophilus_phage	61.6	1.5e-83
SQK94409.1|1788732_1789329_+	Uncharacterized protein conserved in bacteria (DUF2313)	NA	F6MIL7	Haemophilus_phage	64.0	2.0e-67
SQK94410.1|1789332_1790241_+|tail	phage tail fiber protein	tail	Q7Y5S2	Haemophilus_phage	79.0	5.0e-25
SQK94411.1|1790237_1791311_+|tail	tail fiber protein	tail	H6W7W2	Escherichia_phage	30.9	2.5e-07
SQK94412.1|1791304_1791940_+	HP1	NA	Q94MX9	Haemophilus_virus	50.0	2.2e-27
SQK94413.1|1791932_1792241_+	Uncharacterised protein	NA	F6MIM0	Haemophilus_phage	48.3	1.6e-15
SQK94414.1|1792599_1792719_+	mu com-like protein	NA	NA	NA	NA	NA
SQK94415.1|1792780_1793626_+	D12 class N6 adenine-specific DNA methyltransferase	NA	F6MIM2	Haemophilus_phage	71.0	2.6e-116
SQK94416.1|1793683_1793902_+	Uncharacterised protein	NA	NA	NA	NA	NA
SQK94417.1|1794271_1794808_-	antimicrobial peptide transporter subunit	NA	Q6GZ03	Mycoplasma_phage	33.3	2.4e-06
>prophage 6
LS483496	Haemophilus influenzae strain NCTC8455 genome assembly, chromosome: 1	1865137	1818504	1827051	1865137		Escherichia_phage(71.43%)	10	NA	NA
SQK94440.1|1818504_1819158_+	BexA	NA	M1HXU1	Acanthocystis_turfacea_Chlorella_virus	25.7	3.2e-05
SQK94441.1|1819297_1819621_+	superoxide dismutase, Cu, Zn	NA	Q9MC02	Salmonella_phage	56.1	8.6e-12
SQK94442.1|1819948_1820227_-	putative heavy metal transport/detoxification protein	NA	NA	NA	NA	NA
SQK94443.1|1820236_1820599_-	putative mercuric transport protein MerT	NA	NA	NA	NA	NA
SQK94444.1|1820573_1821683_-	transglutaminase domain-containing protein	NA	NA	NA	NA	NA
SQK94445.1|1821935_1824359_+	dimethyl sulfoxide reductase, anaerobic subunit A	NA	A0A077SK27	Escherichia_phage	50.6	9.1e-223
SQK94446.1|1824369_1824987_+	oxidoreductase, Fe-S subunit	NA	A0A077SL61	Escherichia_phage	57.8	5.8e-73
SQK94447.1|1824988_1825828_+	oxidoreductase, membrane subunit	NA	A0A077SK59	Escherichia_phage	31.1	8.5e-19
SQK94448.1|1825939_1826551_+	twin-argninine leader-binding protein for DmsA and TorA	NA	A0A077SLS7	Escherichia_phage	32.5	2.3e-21
SQK94449.1|1826550_1827051_+	ferredoxin	NA	A0A077SLP0	Escherichia_phage	30.3	1.5e-10
