The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR133909	Salmonella enterica subsp. enterica serovar Daytona strain NCTC7102 genome assembly, chromosome: 1	4926237	484326	530534	4926237	tRNA,protease	Organic_Lake_phycodnavirus(25.0%)	50	NA	NA
VDY37571.1|484326_485292_-|tRNA	tRNA-dihydrouridine synthase B	tRNA	NA	NA	NA	NA
VDY37573.1|486276_486711_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
VDY37575.1|486977_488306_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
VDY37577.1|488295_488538_-	Membrane protein	NA	NA	NA	NA	NA
VDY37579.1|488646_489996_-	biotin carboxylase	NA	NA	NA	NA	NA
VDY37581.1|490006_490477_-	Biotin carboxyl carrier protein of acetyl-CoA carboxylase	NA	NA	NA	NA	NA
VDY37583.1|490869_491469_-	Membrane protein YedZ	NA	NA	NA	NA	NA
VDY37585.1|491469_492474_-	reductase	NA	NA	NA	NA	NA
VDY37587.1|492591_493566_-	oxidoreductase	NA	NA	NA	NA	NA
VDY37589.1|493769_495710_+	lipoprotein	NA	NA	NA	NA	NA
VDY37591.1|496017_497061_+	rod shape-determining protein mreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
VDY37593.1|497125_498178_+	rod shape-determining protein	NA	NA	NA	NA	NA
VDY37595.1|498177_498594_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
VDY37597.1|498678_499116_+	Septum formation protein Maf	NA	NA	NA	NA	NA
VDY37599.1|499261_500677_+	ribonuclease G	NA	NA	NA	NA	NA
VDY37601.1|500838_503079_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY37602.1|503095_503287_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY37604.1|503524_504643_+	Uncharacterized protein involved in outer membrane biogenesis	NA	NA	NA	NA	NA
VDY37606.1|504787_505684_+|protease	protease TldD	protease	NA	NA	NA	NA
VDY37608.1|505705_506032_+|protease	protease TldD	protease	NA	NA	NA	NA
VDY37610.1|506118_506238_+|protease	protease TldD	protease	NA	NA	NA	NA
VDY37612.1|506441_507080_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDY37614.1|507069_507294_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDY37616.1|507691_508192_+	Fusaric acid resistance protein fusE	NA	NA	NA	NA	NA
VDY37618.1|508184_508625_+	Fusaric acid resistance protein fusE	NA	NA	NA	NA	NA
VDY37620.1|508630_510598_+	fusaric acid resistance protein FusB/ fusaricacid resistance protein FusC	NA	NA	NA	NA	NA
VDY37622.1|510770_511043_+	putative ribonuclease inhibitor	NA	NA	NA	NA	NA
VDY37624.1|511106_511370_-	membrane protein	NA	NA	NA	NA	NA
VDY37626.1|511473_511737_-	membrane protein	NA	NA	NA	NA	NA
VDY37628.1|512101_512572_-	arginine repressor	NA	NA	NA	NA	NA
VDY37629.1|512985_513924_+	malate dehydrogenase	NA	NA	NA	NA	NA
VDY37631.1|514043_514673_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
VDY37633.1|514659_515325_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDY37635.1|515535_516450_+	possible membrane transport protein	NA	Q6A201	Oenococcus_phage	32.8	4.6e-34
VDY37637.1|516483_516804_+	possible membrane transport protein	NA	NA	NA	NA	NA
VDY37639.1|516836_517736_+	tartrate dehydratase subunit alpha	NA	NA	NA	NA	NA
VDY37641.1|517735_518353_+	L(+)-tartrate dehydratase subunit beta	NA	NA	NA	NA	NA
VDY37643.1|518509_518752_+	oxaloacetate decarboxylase subunit gamma	NA	NA	NA	NA	NA
VDY37645.1|518767_520537_+	oxaloacetate decarboxylase alpha subunit	NA	NA	NA	NA	NA
VDY37647.1|520552_521851_+	oxaloacetate decarboxylase subunit beta	NA	NA	NA	NA	NA
VDY37649.1|521903_522602_+	membrane protein	NA	NA	NA	NA	NA
VDY37651.1|522635_523706_-|protease	serine endoprotease	protease	NA	NA	NA	NA
VDY37653.1|523798_525166_-|protease	serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.0	2.3e-21
VDY37655.1|525322_525721_-	cytochrome d ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
VDY37657.1|525913_527038_+	ATP/GTP-binding protein	NA	NA	NA	NA	NA
VDY37659.1|527338_527767_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
VDY37661.1|527782_528175_+	30S ribosomal subunit protein S9	NA	NA	NA	NA	NA
VDY37663.1|528332_529127_+	Cytoplasmic protein	NA	NA	NA	NA	NA
VDY37665.1|529389_530028_+	stringent starvation protein A	NA	NA	NA	NA	NA
VDY37667.1|530033_530534_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.8	2.5e-26
>prophage 2
LR133909	Salmonella enterica subsp. enterica serovar Daytona strain NCTC7102 genome assembly, chromosome: 1	4926237	867081	920157	4926237	transposase,protease,integrase,tRNA	Prochlorococcus_phage(21.43%)	66	899300:899315	918537:918552
VDY38410.1|867081_867483_+|transposase	ISPsy11, transposase OrfA	transposase	NA	NA	NA	NA
VDY38411.1|867653_868337_+|integrase	integrase	integrase	Q6H9S3	Enterobacteria_phage	34.5	2.6e-18
VDY38413.1|868588_869431_+	membrane transport protein	NA	NA	NA	NA	NA
VDY38414.1|869630_870521_+	putative hydrolase or acyltransferase	NA	NA	NA	NA	NA
VDY38415.1|870726_871647_+	agmatine ureohydrolase	NA	NA	NA	NA	NA
VDY38416.1|871747_872506_-|protease	Putative metalloprotease yggG	protease	NA	NA	NA	NA
VDY38417.1|872781_874371_+	transketolase	NA	NA	NA	NA	NA
VDY38419.1|875176_875536_+	PTS system, mannitol-specific enzyme II component, cryptic	NA	NA	NA	NA	NA
VDY38420.1|875563_876226_+	PTS family membrane transport system protein	NA	NA	NA	NA	NA
VDY38421.1|876173_876944_+	PTS family membrane transport system protein	NA	NA	NA	NA	NA
VDY38422.1|876967_878242_+	oxidoreductase	NA	NA	NA	NA	NA
VDY38424.1|878238_879210_+	fructose-1,6-bisphosphatase	NA	NA	NA	NA	NA
VDY38425.1|879357_879933_+	Uncharacterized protein yggD	NA	NA	NA	NA	NA
VDY38426.1|879929_880646_+	nucleoside triphosphate hydrolase domain-containing protein	NA	NA	NA	NA	NA
VDY38427.1|880614_881304_-	ATPase component of energizing module ofqueuosine-regulated ECF transporter	NA	G3M9Y6	Bacillus_virus	29.2	7.0e-11
VDY38429.1|881297_881975_-	cobalt ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
VDY38431.1|881962_882670_-	cobalt ABC transporter permease	NA	NA	NA	NA	NA
VDY38433.1|882670_883009_-	Substrate-specific component of queuosine-regulated ECF transporter	NA	NA	NA	NA	NA
VDY38434.1|883275_883701_-	DNA-binding protein	NA	NA	NA	NA	NA
VDY38436.1|884074_885121_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
VDY38438.1|885142_886306_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
VDY38440.1|886407_887487_+	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
VDY38442.1|887676_888135_+|transposase	transposase for IS200	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
VDY38444.1|888430_889291_+	Protein involved in stability of MscS mechanosensitive channel	NA	NA	NA	NA	NA
VDY38446.1|889478_890114_+	membrane transport protein	NA	NA	NA	NA	NA
VDY38448.1|890207_890954_+	oxidative stress defense protein	NA	NA	NA	NA	NA
VDY38450.1|891219_892113_-	chromosome intitiation inhibitor	NA	NA	NA	NA	NA
VDY38452.1|892266_892926_+	ribose 5-phosphate isomerase	NA	NA	NA	NA	NA
VDY38454.1|893192_894425_+	D-3-phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.9	1.8e-102
VDY38456.1|894805_895258_-	ligase	NA	NA	NA	NA	NA
VDY38458.1|895648_895978_-	Z-ring-associated protein ZapA	NA	NA	NA	NA	NA
VDY38460.1|896229_896724_+	Uncharacterized protein conserved in bacteria	NA	NA	NA	NA	NA
VDY38462.1|896749_898066_+	proline aminopeptidase II	NA	NA	NA	NA	NA
VDY38464.1|898062_899241_+	2-octaprenyl-6-methoxyphenol hydroxylase	NA	NA	NA	NA	NA
899300:899315	attL	ATGCCGGATGGCGGCT	NA	NA	NA	NA
VDY38466.1|899365_900568_+	monooxygenase	NA	NA	NA	NA	NA
VDY38468.1|901022_902117_+	aminomethyltransferase	NA	NA	NA	NA	NA
VDY38470.1|902142_902532_+	glycine cleavage system H protein	NA	NA	NA	NA	NA
VDY38472.1|902694_903162_+	glycine cleavage complex protein P, glycine decarboxylase	NA	E3SN07	Prochlorococcus_phage	55.4	6.8e-34
VDY38474.1|903227_903782_+	glycine cleavage complex protein P, glycine decarboxylase	NA	M4QFZ1	Prochlorococcus_phage	47.1	4.1e-38
VDY38476.1|903738_904047_+	glycine cleavage complex protein P, glycine decarboxylase	NA	NA	NA	NA	NA
VDY38478.1|904009_904345_+	glycine cleavage complex protein P, glycine decarboxylase	NA	NA	NA	NA	NA
VDY38480.1|904341_904524_+	glycine cleavage complex protein P, glycine decarboxylase	NA	NA	NA	NA	NA
VDY38482.1|904555_905575_+	glycine cleavage complex protein P, glycine decarboxylase	NA	E3SN07	Prochlorococcus_phage	59.6	1.4e-111
VDY38484.1|906039_906933_+	outer membrane protein	NA	NA	NA	NA	NA
VDY38486.1|906980_908414_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.2	8.8e-32
VDY38488.1|908571_908883_+	UPF0267 protein	NA	NA	NA	NA	NA
VDY38490.1|909046_909307_+	hemolysin	NA	NA	NA	NA	NA
VDY38492.1|909392_909707_+	hemolysin	NA	NA	NA	NA	NA
VDY38494.1|909814_910795_-	Folate-dependent protein for Fe/S clustersynthesis/repair in oxidative stress	NA	NA	NA	NA	NA
VDY38496.1|911044_911242_+	YgfY	NA	NA	NA	NA	NA
VDY38498.1|911292_911637_+	membrane protein	NA	NA	NA	NA	NA
VDY38500.1|911759_912284_-	flavodoxin FldB	NA	NA	NA	NA	NA
VDY38502.1|912396_912666_+|integrase	site-specific integrase/recombinase	integrase	NA	NA	NA	NA
VDY38504.1|912634_913297_+|integrase	site-specific integrase/recombinase	integrase	A0A0K2CP59	Brevibacillus_phage	31.8	2.5e-26
VDY38506.1|913320_913629_+	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
VDY38508.1|913646_913835_+	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
VDY38510.1|913791_913917_+	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
VDY38512.1|914220_914769_+	single-stranded DNA-specific exonuclease	NA	A7KV88	Bacillus_phage	37.2	8.5e-28
VDY38514.1|914838_915774_+	single-stranded DNA-specific exonuclease	NA	NA	NA	NA	NA
VDY38516.1|916095_916977_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.5e-05
VDY38518.1|917041_917296_+|tRNA	lysyl tRNA synthetase	tRNA	NA	NA	NA	NA
VDY38520.1|917282_917519_+|tRNA	lysyl tRNA synthetase	tRNA	NA	NA	NA	NA
VDY38522.1|917580_918204_+|tRNA	lysyl tRNA synthetase	tRNA	A0A1V0SFI4	Hokovirus	30.2	5.9e-17
VDY38524.1|918208_918511_+|tRNA	lysyl tRNA synthetase	tRNA	A0A1V0SAC0	Catovirus	53.1	1.1e-21
VDY38526.1|918723_919134_-	isopentenyl-diphosphate delta-isomerase	NA	NA	NA	NA	NA
918537:918552	attR	AGCCGCCATCCGGCAT	NA	NA	NA	NA
VDY38528.1|919398_920157_+	possible lipoprotein	NA	I2E8W3	Clostridium_phage	39.5	1.2e-11
>prophage 3
LR133909	Salmonella enterica subsp. enterica serovar Daytona strain NCTC7102 genome assembly, chromosome: 1	4926237	1038370	1046048	4926237		Escherichia_phage(85.71%)	12	NA	NA
VDY38793.1|1038370_1039363_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
VDY38795.1|1039408_1039645_-	Hydroxyaromatic non-oxidative decarboxylaseprotein D	NA	NA	NA	NA	NA
VDY38797.1|1039655_1040894_-	Hydroxyaromatic non-oxidative decarboxylaseprotein B, Hydroxyaromatic non-oxidatived ecarboxylase protein C	NA	NA	NA	NA	NA
VDY38799.1|1040838_1041084_-	Hydroxyaromatic non-oxidative decarboxylaseprotein B, Hydroxyaromatic non-oxidatived ecarboxylase protein C	NA	NA	NA	NA	NA
VDY38801.1|1041083_1041677_-	decarboxylase	NA	NA	NA	NA	NA
VDY38803.1|1041847_1042252_+	Transcriptional regulator hosA	NA	NA	NA	NA	NA
VDY38805.1|1042270_1043035_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.5	1.1e-70
VDY38807.1|1043231_1044155_+	oxidoreductase	NA	A0A077SLF7	Escherichia_phage	77.4	2.2e-116
VDY38809.1|1044148_1044454_+	membrane protein	NA	A0A077SLJ7	Escherichia_phage	77.3	2.1e-36
VDY38811.1|1044568_1045033_+	membrane protein	NA	A0A077SLJ7	Escherichia_phage	52.7	1.1e-31
VDY38813.1|1045413_1045845_+	sugar aldolase	NA	A0A077SK32	Escherichia_phage	76.6	3.7e-50
VDY38815.1|1045841_1046048_+	sugar aldolase	NA	A0A077SK32	Escherichia_phage	67.5	3.1e-07
>prophage 4
LR133909	Salmonella enterica subsp. enterica serovar Daytona strain NCTC7102 genome assembly, chromosome: 1	4926237	1145185	1150245	4926237		Bacillus_virus(16.67%)	7	NA	NA
VDY39094.1|1145185_1145935_-	glycine betaine/L-proline transport ATP-binding protein	NA	G3M9Y6	Bacillus_virus	44.3	1.3e-13
VDY39096.1|1145924_1146332_-	glycine betaine/L-proline transport ATP-binding protein	NA	NA	NA	NA	NA
VDY39098.1|1146688_1147027_-	ribonucleoside-diphosphate reductase 2 subunit beta	NA	A0A0N7CCA3	Skermania_phage	73.8	2.6e-27
VDY39100.1|1147350_1147707_-	ribonucleoside-diphosphate reductase 2 subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.7	3.0e-34
VDY39102.1|1147717_1149304_-	ribonucleoside-diphosphate reductase 2 subunit alpha	NA	V9VI16	Lactococcus_phage	49.9	7.4e-149
VDY39104.1|1149439_1149835_-	ribonucleoside-diphosphate reductase 2 subunit alpha	NA	A0A2H4P8B4	Corynebacterium_phage	53.7	3.0e-27
VDY39106.1|1149834_1150245_-	ribonucleotide reductase stimulatory protein	NA	A0A142F1R4	Bacillus_phage	41.8	4.3e-16
>prophage 5
LR133909	Salmonella enterica subsp. enterica serovar Daytona strain NCTC7102 genome assembly, chromosome: 1	4926237	1190317	1258490	4926237	transposase,terminase,holin,capsid,integrase,tail,tRNA,plate,portal	Salmonella_phage(89.8%)	80	1195060:1195108	1229456:1229504
VDY39209.1|1190317_1190941_+|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.6	1.6e-06
VDY39211.1|1190931_1191117_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY39213.1|1191220_1192036_-	ABC-type sugar transport system, periplasmic component	NA	NA	NA	NA	NA
VDY39215.1|1192085_1193045_-	reverse transcriptase-like protein	NA	NA	NA	NA	NA
VDY39217.1|1193118_1193304_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY39219.1|1193672_1194326_-|transposase	transposase IS3	transposase	Q716C2	Shigella_phage	90.7	2.1e-118
VDY39221.1|1194538_1194841_-|transposase	transposase insN	transposase	Q716C1	Shigella_phage	93.0	5.7e-42
VDY39223.1|1194964_1195255_+	Uncharacterised protein	NA	NA	NA	NA	NA
1195060:1195108	attL	TATTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
VDY39225.1|1195221_1196433_-	Uncharacterised protein	NA	E5G6K9	Salmonella_phage	47.5	6.3e-108
VDY39227.1|1196429_1197455_-|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	93.3	1.2e-192
VDY39229.1|1197456_1198089_-	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	89.5	3.5e-102
VDY39231.1|1198208_1198457_+	bacteriophage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	67.9	6.4e-23
VDY39233.1|1198489_1198999_+	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	92.9	1.3e-83
VDY39235.1|1199006_1199183_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY39237.1|1199606_1199966_+	bacteriophage protein	NA	E5G6L5	Salmonella_phage	83.2	2.5e-44
VDY39238.1|1200016_1200244_+	bacteriophage protein	NA	A0A0M3UL87	Salmonella_phage	64.0	8.1e-17
VDY39240.1|1200244_1200628_+	bacteriophage protein	NA	A0A1S6L011	Salmonella_phage	94.0	7.8e-20
VDY39241.1|1200653_1200929_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	92.3	2.8e-43
VDY39242.1|1200931_1201330_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	92.1	3.3e-61
VDY39243.1|1201320_1203414_+	Bacteriophage replication gene A protein (GPA)	NA	A0A1S6L028	Salmonella_phage	97.3	0.0e+00
VDY39244.1|1203433_1203733_+	Uncharacterised protein	NA	A0A1S6L028	Salmonella_phage	87.8	2.8e-41
VDY39245.1|1203888_1204077_+	bacteriophage protein	NA	A0A1S6L006	Salmonella_phage	98.4	6.1e-26
VDY39246.1|1204088_1204322_+	bacteriophage sos operon Tum protein	NA	A0A1S6L014	Salmonella_phage	94.8	4.4e-34
VDY39248.1|1204645_1205710_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY39249.1|1205706_1206771_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY39250.1|1206790_1207486_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY39252.1|1207533_1208571_-|capsid,portal	probable capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	88.0	1.8e-172
VDY39253.1|1208570_1209056_-|terminase	terminase, ATPase subunit	terminase	E5G6M4	Salmonella_phage	98.1	4.2e-87
VDY39254.1|1209009_1210338_-|terminase	terminase, ATPase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.2	2.7e-245
VDY39255.1|1210480_1211314_+|capsid	capsid protein	capsid	E5G6M5	Salmonella_phage	99.6	1.2e-129
VDY39257.1|1211330_1212395_+|capsid	major capsid-like protein	capsid	A0A1S6KZZ3	Salmonella_phage	99.4	5.4e-196
VDY39258.1|1212398_1213049_+|terminase	terminase, endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	100.0	2.2e-115
VDY39259.1|1213142_1213607_+|capsid	putative capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	4.2e-84
VDY39261.1|1213606_1213810_+|tail	phage tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
VDY39262.1|1213813_1214029_+|holin	holin family protein	holin	E5G6N0	Salmonella_phage	100.0	5.9e-33
VDY39264.1|1214009_1214519_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	98.8	2.2e-94
VDY39266.1|1214523_1214715_+	putative membrane protein	NA	A0A1S6KZZ2	Salmonella_phage	98.4	2.5e-27
VDY39267.1|1214900_1215326_+	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	98.6	1.1e-67
VDY39269.1|1215421_1215853_+|tail	tail fiber protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	1.2e-74
VDY39270.1|1215845_1216082_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	100.0	8.7e-30
VDY39272.1|1216294_1217146_-	Uncharacterised protein	NA	E5G6N5	Salmonella_phage	58.9	4.5e-92
VDY39273.1|1217223_1217802_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	94.8	3.8e-103
VDY39275.1|1217798_1218158_+|plate	baseplate assembly protein W	plate	A0A1S6KZZ4	Salmonella_phage	94.1	8.3e-56
VDY39277.1|1218144_1219053_+|plate	phage baseplate assembly protein J	plate	E5G6N8	Salmonella_phage	98.0	9.5e-157
VDY39278.1|1219045_1219651_+|tail	putative phage tail protein	tail	A0A1S6L000	Salmonella_phage	98.0	3.2e-116
VDY39280.1|1219741_1220053_+|tail	phage tail fiber protein	tail	A0A1S6KZZ8	Salmonella_phage	100.0	2.4e-51
VDY39281.1|1220103_1220916_+|tail	phage tail-like protein	tail	A0A1B0V7G4	Salmonella_phage	73.7	4.6e-94
VDY39282.1|1221008_1221464_+	Fels-2 prophage Pin	NA	A0A1B0V7G4	Salmonella_phage	90.1	4.5e-67
VDY39283.1|1221470_1221878_+	Fels-2 prophage Tfa	NA	A0A1B0V844	Salmonella_phage	85.2	6.7e-62
VDY39285.1|1222160_1222385_+	DNA invertase-like protein	NA	E5G6P5	Salmonella_phage	97.3	6.1e-33
VDY39286.1|1222487_1223660_+|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	3.7e-222
VDY39288.1|1223669_1224185_+|tail	phage major tail tube protein FII	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
VDY39290.1|1224239_1224542_+|tail	phage tail protein E	tail	A0A1S6KZZ9	Salmonella_phage	100.0	2.5e-45
VDY39292.1|1224668_1227476_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	98.2	0.0e+00
VDY39294.1|1227472_1227958_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	99.2	8.3e-67
VDY39296.1|1227954_1229055_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	95.6	9.0e-194
VDY39298.1|1229893_1231084_-	Putative HlyD family secretion protein	NA	NA	NA	NA	NA
1229456:1229504	attR	TATTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
VDY39300.1|1231064_1233245_-	type I secretion protein, ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	5.8e-19
VDY39302.1|1234715_1235576_-	large repetitive protein	NA	NA	NA	NA	NA
VDY39304.1|1235709_1239312_-	large repetitive protein	NA	NA	NA	NA	NA
VDY39306.1|1239620_1240163_-	large repetitive protein	NA	NA	NA	NA	NA
VDY39308.1|1240406_1243892_-	large repetitive protein	NA	NA	NA	NA	NA
VDY39310.1|1243987_1245595_-	VCBS repeat-containing protein	NA	NA	NA	NA	NA
VDY39312.1|1245627_1246185_-	VCBS repeat-containing protein	NA	NA	NA	NA	NA
VDY39314.1|1246889_1247333_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	43.3	3.4e-19
VDY39316.1|1247475_1247913_+	Ribosome association toxin RatA	NA	NA	NA	NA	NA
VDY39318.1|1247902_1248193_+	UPF0125 protein yfjF	NA	NA	NA	NA	NA
VDY39320.1|1248358_1248697_-	small protein A	NA	NA	NA	NA	NA
VDY39322.1|1248845_1250507_-	DNA repair protein	NA	NA	NA	NA	NA
VDY39324.1|1250592_1251471_-	NAD kinase	NA	NA	NA	NA	NA
VDY39326.1|1251593_1252184_+	heat shock protein GrpE	NA	NA	NA	NA	NA
VDY39328.1|1252218_1252824_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY39330.1|1252943_1253741_-	Hemolysins-related protein containing CBS domains	NA	NA	NA	NA	NA
VDY39332.1|1253733_1254186_-	hemolysin	NA	NA	NA	NA	NA
VDY39334.1|1254252_1255044_-	cytochrome c-type biogenesis heme exporter protein C	NA	NA	NA	NA	NA
VDY39336.1|1255316_1256573_+	signal recognition particle protein	NA	NA	NA	NA	NA
VDY39338.1|1256825_1257074_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
VDY39340.1|1257092_1257641_+	Ribosome maturation factor rimM	NA	NA	NA	NA	NA
VDY39342.1|1257685_1258069_+|tRNA	tRNA(guanine-N1)methyltransferase	tRNA	NA	NA	NA	NA
VDY39343.1|1258121_1258490_+|tRNA	tRNA(guanine-N1)methyltransferase	tRNA	NA	NA	NA	NA
>prophage 6
LR133909	Salmonella enterica subsp. enterica serovar Daytona strain NCTC7102 genome assembly, chromosome: 1	4926237	1486672	1521599	4926237	transposase,tRNA,protease	Saccharomonospora_phage(50.0%)	42	NA	NA
VDY39867.1|1486672_1487770_+|tRNA	glutamyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VDY39869.1|1487741_1488089_+|tRNA	glutamyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VDY39871.1|1488142_1488514_-	DNA binding domain, excisionase family	NA	NA	NA	NA	NA
VDY39873.1|1488536_1488899_-	negative regulator	NA	NA	NA	NA	NA
VDY39875.1|1489504_1491694_+	protein YfeA	NA	NA	NA	NA	NA
VDY39877.1|1491746_1492469_-	nucleoside permease NupC	NA	NA	NA	NA	NA
VDY39879.1|1492536_1492950_-	nucleoside permease NupC	NA	NA	NA	NA	NA
VDY39881.1|1493293_1493629_+	manganese transport protein MntH	NA	NA	NA	NA	NA
VDY39883.1|1493609_1494536_+	manganese transport protein MntH	NA	NA	NA	NA	NA
VDY39885.1|1494596_1494923_-	Protein of uncharacterised function (DUF2502)	NA	NA	NA	NA	NA
VDY39887.1|1495036_1496035_-	ion-channel protein	NA	NA	NA	NA	NA
VDY39889.1|1496213_1496306_+	decarboxylase	NA	NA	NA	NA	NA
VDY39891.1|1496271_1497867_+	decarboxylase	NA	NA	NA	NA	NA
VDY39893.1|1497885_1499121_-	Chloride channel protein	NA	NA	NA	NA	NA
VDY39895.1|1499324_1500290_+	glucokinase	NA	NA	NA	NA	NA
VDY39897.1|1500566_1501022_+|transposase	transposase for IS200	transposase	I4AZI8	Saccharomonospora_phage	31.5	9.9e-14
VDY39899.1|1501314_1501605_+	PTS system IIB component	NA	NA	NA	NA	NA
VDY39901.1|1501625_1501892_+	PTS system IIC component	NA	NA	NA	NA	NA
VDY39903.1|1501854_1502874_+	PTS system IIC component	NA	NA	NA	NA	NA
VDY39905.1|1502890_1503274_+	aminopeptidase	NA	NA	NA	NA	NA
VDY39907.1|1503401_1503842_+	aminopeptidase	NA	NA	NA	NA	NA
VDY39909.1|1503973_1504213_+|protease	metalloprotease	protease	NA	NA	NA	NA
VDY39911.1|1504163_1504928_+|protease	metalloprotease	protease	NA	NA	NA	NA
VDY39913.1|1505037_1506930_+	phosphoenolpyruvate-protein phosphotransferase	NA	NA	NA	NA	NA
VDY39915.1|1507351_1507531_+	phosphoenolpyruvate-protein phosphotransferase	NA	NA	NA	NA	NA
VDY39917.1|1507632_1508397_-	Putative HTH-type transcriptional regulator ypdC	NA	NA	NA	NA	NA
VDY39919.1|1509128_1510313_+	aminotransferase	NA	NA	NA	NA	NA
VDY39921.1|1510835_1511756_-	Protein Ddg	NA	A0A1W6JP29	Morganella_phage	53.5	1.1e-75
VDY39923.1|1512003_1512117_+	transporter	NA	NA	NA	NA	NA
VDY39925.1|1512277_1512520_+	Protein of uncharacterised function (DUF2545)	NA	NA	NA	NA	NA
VDY39927.1|1512758_1514150_-	phosphoglycerate transporter	NA	NA	NA	NA	NA
VDY39929.1|1514485_1514698_-	phosphoglycerate transport regulatory protein PgtC precursor	NA	NA	NA	NA	NA
VDY39932.1|1515093_1515777_+	phosphoglycerate transport: protein for signal transmission	NA	NA	NA	NA	NA
VDY39934.1|1515773_1516259_+	histidine kinase	NA	NA	NA	NA	NA
VDY39936.1|1516361_1517576_+	histidine kinase	NA	NA	NA	NA	NA
VDY39938.1|1517592_1517781_+	histidine kinase	NA	NA	NA	NA	NA
VDY39941.1|1517767_1518637_+	Nitrogen assimilation regulatory protein	NA	NA	NA	NA	NA
VDY39943.1|1518633_1519020_+	Nitrogen assimilation regulatory protein	NA	NA	NA	NA	NA
VDY39945.1|1519152_1519248_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY39951.1|1519287_1519383_+|protease	outer membrane protease	protease	NA	NA	NA	NA
VDY39957.1|1519342_1520254_+|protease	outer membrane protease	protease	NA	NA	NA	NA
VDY39961.1|1521098_1521599_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
LR133909	Salmonella enterica subsp. enterica serovar Daytona strain NCTC7102 genome assembly, chromosome: 1	4926237	1765659	1774935	4926237	tRNA	Enterobacteria_phage(71.43%)	14	NA	NA
VDY40596.1|1765659_1765875_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.3	2.3e-05
VDY40597.1|1766134_1766350_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
VDY40598.1|1766346_1766613_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
VDY40600.1|1766596_1767220_+	putative permease transmembrane component	NA	NA	NA	NA	NA
VDY40601.1|1767235_1767424_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY40602.1|1767458_1768220_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.7e-101
VDY40603.1|1768512_1769127_+	putative sensor kinase	NA	Q9EYF3	Enterobacteria_phage	89.4	2.3e-82
VDY40605.1|1769155_1770130_+	putative sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.0	8.3e-167
VDY40606.1|1770126_1770846_+	two-component system response regulator	NA	NA	NA	NA	NA
VDY40607.1|1770892_1771360_+	Protein of uncharacterised function (DUF1456)	NA	Q9EYF4	Enterobacteria_phage	89.7	6.7e-74
VDY40608.1|1771516_1771948_-	lipoprotein	NA	NA	NA	NA	NA
VDY40610.1|1772119_1772578_-	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
VDY40611.1|1772852_1773632_-|tRNA	methionyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VDY40612.1|1773798_1774935_-|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	31.2	7.2e-45
>prophage 8
LR133909	Salmonella enterica subsp. enterica serovar Daytona strain NCTC7102 genome assembly, chromosome: 1	4926237	1953115	1960371	4926237		Salmonella_phage(33.33%)	7	NA	NA
VDY40995.1|1953115_1953535_+	umuDC operon protein-like protein	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
VDY40997.1|1953537_1954287_+	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	93.9	5.3e-129
VDY40999.1|1954324_1954807_+	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	89.4	2.1e-78
VDY41001.1|1955933_1957130_-	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	55.8	2.5e-109
VDY41003.1|1957780_1958092_+	membrane protein	NA	NA	NA	NA	NA
VDY41005.1|1958171_1958867_+	metal-dependent phospho hydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.2	2.8e-07
VDY41007.1|1958940_1960371_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 9
LR133909	Salmonella enterica subsp. enterica serovar Daytona strain NCTC7102 genome assembly, chromosome: 1	4926237	2049336	2117965	4926237	head,transposase,terminase,holin,integrase,tail,portal,lysis	Enterobacteria_phage(31.03%)	93	2057127:2057142	2118307:2118322
VDY41172.1|2049336_2050020_-|integrase	integrase	integrase	Q6H9S3	Enterobacteria_phage	34.5	2.6e-18
VDY41173.1|2050190_2050592_-|transposase	ISPsy11, transposase OrfA	transposase	NA	NA	NA	NA
VDY41174.1|2050727_2051303_-	pyruvate kinase A	NA	NA	NA	NA	NA
VDY41175.1|2051403_2052171_-	pyruvate kinase A	NA	NA	NA	NA	NA
VDY41176.1|2052294_2053164_-	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
VDY41177.1|2053507_2054983_+	glucose 6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	2.6e-79
VDY41178.1|2055217_2057029_+	6-phosphogluconate dehydratase	NA	NA	NA	NA	NA
VDY41179.1|2057066_2057708_+	KHG/KDPG aldolase	NA	NA	NA	NA	NA
2057127:2057142	attL	ATTGTAGTCAATAAAC	NA	NA	NA	NA
VDY41180.1|2057807_2058908_-	phosphoribosylglycinamide formyltransferase 2	NA	NA	NA	NA	NA
VDY41181.1|2059115_2059406_+	DNA damage-inducible gene in SOS regulon-dependent on cyclic AMP and H-NS	NA	NA	NA	NA	NA
VDY41182.1|2059473_2059677_+	protein YebF	NA	NA	NA	NA	NA
VDY41183.1|2059918_2060578_+	inner membrane protein YebE	NA	NA	NA	NA	NA
VDY41184.1|2060791_2061061_+	oligopeptidase	NA	NA	NA	NA	NA
VDY41185.1|2061026_2062274_+	oligopeptidase	NA	NA	NA	NA	NA
VDY41186.1|2062215_2062581_+	oligopeptidase	NA	NA	NA	NA	NA
VDY41187.1|2062624_2062846_+	oligopeptidase	NA	NA	NA	NA	NA
VDY41188.1|2062982_2063582_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	40.4	2.4e-07
VDY41189.1|2063605_2063800_-	Putative amido hydrolase	NA	NA	NA	NA	NA
VDY41190.1|2063762_2064263_-	Putative amido hydrolase	NA	NA	NA	NA	NA
VDY41191.1|2064370_2064601_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
VDY41192.1|2064738_2065113_+	Copper resistance protein CopC	NA	NA	NA	NA	NA
VDY41193.1|2065339_2065945_+	membrane protein	NA	NA	NA	NA	NA
VDY41194.1|2066005_2066359_+	Protein of uncharacterised function (DUF2511)	NA	NA	NA	NA	NA
VDY41195.1|2066731_2067811_-|integrase	phage integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.4	3.3e-100
VDY41196.1|2067791_2068058_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	39.7	1.7e-10
VDY41197.1|2068124_2068553_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY41198.1|2068651_2068837_-	Protein of uncharacterised function (DUF1187)	NA	A0A0U2QL97	Escherichia_phage	59.6	2.9e-12
VDY41199.1|2068883_2069714_-	recombination and repair protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.0e-104
VDY41200.1|2069706_2069853_-	exonuclease VIII	NA	NA	NA	NA	NA
VDY41201.1|2069923_2070223_-	exonuclease VIII	NA	Q9QF34	Lambdoid_phage	93.5	6.9e-48
VDY41202.1|2070171_2071932_-	exonuclease VIII	NA	H6WRX1	Salmonella_phage	32.4	3.0e-50
VDY41203.1|2072196_2072355_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY41204.1|2072541_2072877_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY41205.1|2072951_2073236_-	DNA breaking-rejoining protein	NA	K7PGY4	Enterobacteria_phage	53.2	1.7e-08
VDY41206.1|2073617_2073773_-	Protein of uncharacterised function (DUF1391)	NA	M4QQ57	Salicola_phage	55.3	4.7e-08
VDY41207.1|2074085_2074511_-	transcriptional regulator	NA	K7PH71	Enterobacterial_phage	56.3	9.3e-14
VDY41208.1|2074607_2074862_+	CRO	NA	K7PKH4	Enterobacteria_phage	59.4	1.2e-16
VDY41209.1|2074848_2075343_+	Protein of uncharacterised function (DUF1019)	NA	NA	NA	NA	NA
VDY41210.1|2075387_2076257_+	DNA-binding protein	NA	A0A088CD36	Shigella_phage	58.5	6.9e-32
VDY41211.1|2076263_2077016_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	76.5	5.9e-104
VDY41212.1|2077033_2077429_+	DNA-binding protein	NA	A0A088CBK9	Shigella_phage	37.0	5.4e-16
VDY41213.1|2077425_2077698_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY41214.1|2078211_2078556_+	putative bacteriophage cohesive ends	NA	NA	NA	NA	NA
VDY41215.1|2078619_2079219_+	IrsA	NA	A0A0U2RT94	Escherichia_phage	83.9	2.9e-98
VDY41216.1|2079215_2079410_+	Phage protein	NA	S4TNP0	Salmonella_phage	61.5	7.9e-13
VDY41217.1|2079391_2079700_+	Protein of uncharacterised function (DUF1364)	NA	G8C7V5	Escherichia_phage	76.7	6.5e-33
VDY41218.1|2079709_2080072_+	phage antiterminator	NA	Q777W5	Enterobacteria_phage	80.8	1.3e-53
VDY41219.1|2080184_2082452_-	phage-like protein	NA	NA	NA	NA	NA
VDY41220.1|2083288_2083747_+|transposase	transposase for IS200	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
VDY41221.1|2083906_2084215_+|holin	phage-holin analog protein	holin	NA	NA	NA	NA
VDY41222.1|2084192_2084732_+	Phage endolysin R	NA	S5MQK2	Escherichia_phage	73.0	2.8e-76
VDY41223.1|2084901_2085039_+	Phage protein	NA	A0A0M4S639	Salmonella_phage	62.2	1.1e-08
VDY41224.1|2085040_2085220_+|lysis	bacteriophage lysis protein	lysis	H6WRZ5	Salmonella_phage	79.6	1.1e-16
VDY41225.1|2085284_2085506_+|lysis	bacteriophage lysis protein	lysis	A0A0M4RD57	Salmonella_phage	88.7	3.2e-26
VDY41226.1|2085568_2085934_-	Inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
VDY41227.1|2086423_2086657_+|terminase	terminase	terminase	A0A0U2S671	Escherichia_phage	73.7	3.7e-25
VDY41228.1|2086622_2086973_+|terminase	terminase	terminase	A0A0U2S671	Escherichia_phage	89.1	9.0e-15
VDY41229.1|2086944_2087361_+|terminase	terminase	terminase	O64317	Escherichia_phage	65.7	4.9e-44
VDY41230.1|2087317_2087542_+|terminase	terminase	terminase	O64317	Escherichia_phage	74.6	2.1e-25
VDY41231.1|2087501_2088374_+|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	68.3	3.1e-112
VDY41232.1|2088355_2088880_+|terminase	terminase	terminase	A0A2I6TC92	Escherichia_phage	52.0	1.0e-33
VDY41233.1|2089023_2090439_+|portal	phage portal protein, lambda family	portal	K7P6U7	Enterobacteria_phage	62.7	3.4e-153
VDY41234.1|2090438_2090642_+	Portal protein Head protein Gp4	NA	A0A2I6TC89	Escherichia_phage	60.9	2.0e-11
VDY41235.1|2090631_2092128_+	scaffold protein	NA	A0A0K2FI53	Enterobacteria_phage	52.7	7.4e-98
VDY41236.1|2092140_2092488_+	Head decoration protein	NA	A0A2R9YJN3	Escherichia_phage	53.8	4.1e-20
VDY41237.1|2092542_2093571_+|head	head protein	head	C6ZCY2	Enterobacteria_phage	60.5	1.5e-113
VDY41238.1|2093628_2093988_+	DNA packaging protein	NA	NA	NA	NA	NA
VDY41239.1|2093998_2094376_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	1.5e-28
VDY41240.1|2094362_2094941_+	Gifsy-1 prophagei VmtZ	NA	A5LH33	Enterobacteria_phage	80.7	1.7e-82
VDY41241.1|2094937_2095339_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
VDY41242.1|2095349_2096096_+|tail	putative tail component of prophage	tail	A0A291AWU6	Escherichia_phage	76.5	2.1e-98
VDY41243.1|2096146_2096542_+|tail	minor tail protein	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
VDY41244.1|2096562_2096877_+|tail	minor tail-like protein	tail	A5LH37	Enterobacteria_phage	64.2	8.0e-31
VDY41245.1|2096848_2097283_+|tail	tail protein	tail	A0A291AWX1	Escherichia_phage	72.9	1.8e-20
VDY41246.1|2097343_2099887_+|tail	tail protein	tail	A0A291AWX1	Escherichia_phage	64.5	2.2e-259
VDY41247.1|2099892_2100222_+|tail	tail protein	tail	A5LH39	Enterobacteria_phage	71.3	7.3e-43
VDY41248.1|2100231_2100555_+|tail	Minor tail protein L	tail	B6DZB1	Enterobacteria_phage	73.8	4.4e-40
VDY41249.1|2100554_2100932_+|tail	Minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	79.2	1.6e-54
VDY41250.1|2101578_2102226_+|tail	tail protein	tail	A5LH42	Enterobacteria_phage	79.1	4.2e-90
VDY41251.1|2102288_2104280_+|tail	Phage tail fiber protein	tail	A5LH43	Enterobacteria_phage	81.4	0.0e+00
VDY41252.1|2104257_2105652_+|tail	Phage tail fiber protein	tail	K7PKJ2	Enterobacteria_phage	78.4	1.4e-130
VDY41253.1|2105690_2105933_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY41255.1|2106036_2106438_+|transposase	ISPsy11, transposase OrfA	transposase	NA	NA	NA	NA
VDY41257.1|2106608_2107292_+|integrase	integrase	integrase	Q6H9S3	Enterobacteria_phage	34.5	2.6e-18
VDY41259.1|2109999_2110212_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	70.6	9.6e-20
VDY41261.1|2110171_2110516_+|tail	Caudovirales tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	86.5	3.3e-38
VDY41264.1|2111120_2111360_+	Phage DNA invertase	NA	S4TTF2	Salmonella_phage	88.5	3.6e-23
VDY41266.1|2111658_2111967_+	Uncharacterised protein	NA	K7PGV5	Enterobacterial_phage	56.1	3.8e-25
VDY41268.1|2113029_2114718_-	periplasmic murein peptide-binding protein precurs	NA	NA	NA	NA	NA
VDY41270.1|2114936_2116004_-	Murein tetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
VDY41272.1|2116650_2117004_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY41274.1|2117143_2117311_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	88.9	5.8e-20
VDY41276.1|2117506_2117965_+|transposase	transposase for IS200	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
2118307:2118322	attR	GTTTATTGACTACAAT	NA	NA	NA	NA
>prophage 10
LR133909	Salmonella enterica subsp. enterica serovar Daytona strain NCTC7102 genome assembly, chromosome: 1	4926237	2373826	2380945	4926237		Escherichia_phage(100.0%)	9	NA	NA
VDY41930.1|2373826_2374441_-	Anaerobic dimethyl sulfoxide reductasechaperone DmsD	NA	A0A077SLS7	Escherichia_phage	37.3	7.3e-28
VDY41932.1|2374483_2375341_-	dimethyl sulfoxide reductase subunit H	NA	NA	NA	NA	NA
VDY41934.1|2375342_2375960_-	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.1	1.1e-76
VDY41936.1|2375970_2376417_-	dimethyl sulfoxide reductase subunit	NA	A0A077SK27	Escherichia_phage	57.0	2.8e-37
VDY41938.1|2376373_2377222_-	dimethyl sulfoxide reductase subunit	NA	NA	NA	NA	NA
VDY41940.1|2377250_2378381_-	dimethyl sulfoxide reductase subunit	NA	A0A077SK27	Escherichia_phage	49.6	4.4e-79
VDY41942.1|2378388_2379939_-	dimethyl sulfoxide reductase, subunit A1	NA	A0A077SK27	Escherichia_phage	49.2	2.6e-130
VDY41944.1|2380044_2380323_-	dimethyl sulfoxide reductase, subunit A1	NA	A0A077SK27	Escherichia_phage	53.8	3.8e-08
VDY41946.1|2380279_2380945_-	dimethyl sulfoxide reductase, subunit A1	NA	A0A077SK27	Escherichia_phage	48.8	1.8e-35
>prophage 11
LR133909	Salmonella enterica subsp. enterica serovar Daytona strain NCTC7102 genome assembly, chromosome: 1	4926237	2412256	2449232	4926237	head,holin,tail,tRNA,protease	Salmonella_phage(22.22%)	49	NA	NA
VDY42029.1|2412256_2412865_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
VDY42031.1|2412870_2413545_-	Ni/Fe-hydrogenase, B-type cytochrome subunit	NA	NA	NA	NA	NA
VDY42033.1|2413564_2415367_-	uptake hydrogenase large subunit	NA	NA	NA	NA	NA
VDY42035.1|2415369_2415978_-	uptake hydrogenase small subunit	NA	NA	NA	NA	NA
VDY42037.1|2415949_2416474_-	uptake hydrogenase small subunit	NA	NA	NA	NA	NA
VDY42039.1|2416905_2417994_+	hydrolase	NA	NA	NA	NA	NA
VDY42041.1|2418159_2418831_+	regulatory protein	NA	NA	NA	NA	NA
VDY42043.1|2418889_2419915_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
VDY42045.1|2419911_2420544_-	membrane transport protein	NA	NA	NA	NA	NA
VDY42047.1|2420579_2421116_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY42049.1|2421354_2422737_-	PhoPQ-regulated protein	NA	NA	NA	NA	NA
VDY42051.1|2422685_2422895_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY42053.1|2422976_2424056_-	multidrug transporter	NA	NA	NA	NA	NA
VDY42055.1|2424214_2424772_-	monooxygenase	NA	NA	NA	NA	NA
VDY42057.1|2424785_2425406_-	monooxygenase	NA	NA	NA	NA	NA
VDY42059.1|2425465_2425726_-	monooxygenase	NA	NA	NA	NA	NA
VDY42060.1|2425770_2425941_+	transcriptional regulator, MarR family	NA	NA	NA	NA	NA
VDY42062.1|2425888_2426260_+	transcriptional regulator, MarR family	NA	NA	NA	NA	NA
VDY42063.1|2426666_2427272_+|tRNA	S-adenosylmethionine tRNA ribosyltransferase	tRNA	NA	NA	NA	NA
VDY42064.1|2427547_2427874_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY42065.1|2428060_2428588_-	Phage endolysin R	NA	H9C184	Pectobacterium_phage	77.9	2.8e-76
VDY42067.1|2428580_2428856_-|holin	gp13 holin, class II	holin	I6R0S9	Salmonella_phage	50.0	6.4e-08
VDY42069.1|2428856_2429195_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY42071.1|2429194_2429545_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY42073.1|2429893_2430139_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY42074.1|2430419_2430575_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY42075.1|2430574_2431324_-|tail	Phage-related minor tail protein	tail	I6NKY8	Burkholderia_phage	23.2	2.1e-08
VDY42077.1|2431790_2432303_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY42079.1|2432299_2432785_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY42081.1|2432777_2433206_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY42083.1|2433207_2433741_-	Protein of uncharacterised function (DUF3383)	NA	NA	NA	NA	NA
VDY42085.1|2433698_2434259_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY42087.1|2434309_2434486_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY42089.1|2434409_2434568_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY42091.1|2434568_2435309_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY42093.1|2435351_2435705_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY42095.1|2435701_2436175_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY42097.1|2436515_2436656_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY42099.1|2436665_2436920_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY42101.1|2436923_2437862_-	Uncharacterized protein conserved in bacteria	NA	E5AGA8	Erwinia_phage	31.1	1.0e-28
VDY42103.1|2437904_2438672_-	Bacterial Ig-like domain (group 2)	NA	G0ZNE6	Cronobacter_phage	45.6	3.4e-06
VDY42105.1|2438671_2439682_-|head,protease	head protein/prohead protease	head,protease	A0A291LCH5	Klebsiella_phage	34.8	3.4e-14
VDY42107.1|2439659_2441015_-|head	phage head morphogenesis protein, SPP1 gp7 family	head	NA	NA	NA	NA
VDY42109.1|2441001_2442330_-	Protein of uncharacterised function (DUF1073)	NA	NA	NA	NA	NA
VDY42111.1|2442326_2443736_-	Terminase large subunit	NA	A0A2I7RTP3	Vibrio_phage	34.5	1.8e-58
VDY42113.1|2443722_2444268_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY42115.1|2445576_2447109_+	ERF superfamily	NA	NA	NA	NA	NA
VDY42117.1|2447175_2447409_+	Uncharacterised protein	NA	Q5QBN4	Enterobacteria_phage	41.0	9.6e-05
VDY42119.1|2447756_2449232_+|tail	tail protein	tail	Q8HAB4	Salmonella_phage	72.3	1.5e-175
>prophage 12
LR133909	Salmonella enterica subsp. enterica serovar Daytona strain NCTC7102 genome assembly, chromosome: 1	4926237	2781622	2827665	4926237	transposase,terminase,integrase,tail,tRNA,protease	Enterobacteria_phage(31.82%)	55	2787295:2787310	2829603:2829618
VDY42907.1|2781622_2782081_-|transposase	transposase for IS200	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
VDY42909.1|2782273_2783155_-	heat shock protein	NA	NA	NA	NA	NA
VDY42911.1|2783348_2785397_-|protease	Tail-specific protease precursor	protease	A0A0R6PIZ1	Moraxella_phage	33.4	1.8e-86
VDY42913.1|2785416_2786103_-	ProP effector	NA	NA	NA	NA	NA
VDY42915.1|2786200_2786770_-	GAF domain-containing protein	NA	NA	NA	NA	NA
VDY42917.1|2786826_2788110_+	Paraquat-inducible protein A	NA	NA	NA	NA	NA
2787295:2787310	attL	GAAAAACTGAAAGAGT	NA	NA	NA	NA
VDY42919.1|2788078_2789311_+	mce-related protein	NA	NA	NA	NA	NA
VDY42921.1|2789367_2790711_+	mce-related protein	NA	NA	NA	NA	NA
VDY42923.1|2790686_2792228_+	rRNA (cytosine-C(5)-)-methyltransferase RsmF	NA	NA	NA	NA	NA
VDY42925.1|2792342_2792582_+	conserved domain protein	NA	NA	NA	NA	NA
VDY42927.1|2792692_2792884_+	putative secreted protein	NA	NA	NA	NA	NA
VDY42929.1|2793146_2793554_-	Serine/threonine-protein phosphatase 1	NA	Q71TJ1	Escherichia_phage	50.4	5.2e-30
VDY42931.1|2793571_2793805_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY42933.1|2793777_2793942_-	membrane protein	NA	NA	NA	NA	NA
VDY42935.1|2794226_2794334_-	Guanine nucleotide exchange factor sopE	NA	NA	NA	NA	NA
VDY42937.1|2794381_2794693_-	guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
VDY42939.1|2795635_2796031_+	protein ycgX	NA	C6ZCX4	Enterobacteria_phage	32.8	7.0e-16
VDY42941.1|2796359_2796929_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY42943.1|2797253_2797631_-	acetyltransferase	NA	NA	NA	NA	NA
VDY42945.1|2798914_2799061_-|transposase	transposase	transposase	NA	NA	NA	NA
VDY42947.1|2799060_2799918_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	28.6	2.1e-20
VDY42949.1|2800041_2800410_+	putative cytoplasmic protein	NA	K7PHK0	Enterobacteria_phage	39.8	5.4e-18
VDY42951.1|2800433_2800544_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY42953.1|2800675_2801014_-	putative product	NA	I6RSM4	Salmonella_phage	83.1	1.8e-20
VDY42955.1|2801030_2801555_+	fimbriae usher protein	NA	NA	NA	NA	NA
VDY42957.1|2802346_2803261_+	drug/metabolite transporter DMT permease	NA	NA	NA	NA	NA
VDY42959.1|2803393_2803552_+	membrane protein	NA	NA	NA	NA	NA
VDY42961.1|2803561_2804176_+	disulfide bond formation protein	NA	NA	NA	NA	NA
VDY42963.1|2804624_2804747_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY42965.1|2805335_2805494_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY42968.1|2806752_2807844_-	DNA recombinase-like protein	NA	A0A0M4QWS3	Salmonella_phage	91.2	1.7e-59
VDY42970.1|2808111_2808357_-|tail	side tail fiber protein	tail	A0A0U2SH60	Escherichia_phage	70.5	1.7e-20
VDY42972.1|2808349_2808724_-|terminase	phage terminase large subunit	terminase	Q8VNN7	Enterobacteria_phage	82.1	1.4e-58
VDY42974.1|2808743_2808923_-|terminase	phage terminase large subunit	terminase	NA	NA	NA	NA
VDY42976.1|2808909_2809401_-|terminase	terminase	terminase	Q9EYD0	Enterobacteria_phage	57.5	5.8e-44
VDY42978.1|2809709_2809877_+	lytic enzyme	NA	NA	NA	NA	NA
VDY42980.1|2810134_2810446_-	Protein gp55	NA	NA	NA	NA	NA
VDY42982.1|2810722_2811367_-	lytic enzyme	NA	Q8HA86	Salmonella_phage	93.7	2.2e-27
VDY42984.1|2811476_2812091_+	exodeoxyribonuclease 8	NA	Q9QF34	Lambdoid_phage	66.1	1.9e-55
VDY42986.1|2812087_2812609_+|integrase	phage integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	54.7	7.3e-45
VDY42988.1|2812905_2813169_+|integrase	phage integrase	integrase	K7PHK0	Enterobacteria_phage	50.7	4.8e-13
VDY42990.1|2814166_2814868_+	Protein of uncharacterised function (DUF1076)	NA	B6DZC0	Enterobacteria_phage	29.2	1.3e-15
VDY42992.1|2816098_2816311_+	Uncharacterised protein	NA	A0A192Y5V6	Salmonella_phage	92.9	1.6e-27
VDY42994.1|2816307_2816529_+	Uncharacterised protein	NA	A0A192Y6F0	Salmonella_phage	83.8	6.0e-25
VDY42996.1|2816957_2817191_+	Uncharacterised protein	NA	A0A192Y6D5	Salmonella_phage	97.4	1.8e-35
VDY42998.1|2817465_2818107_+	glutathione S-transferase	NA	NA	NA	NA	NA
VDY43000.1|2818277_2818796_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	53.2	2.3e-46
VDY43002.1|2821392_2822076_-|integrase	integrase	integrase	Q6H9S3	Enterobacteria_phage	34.5	2.6e-18
VDY43004.1|2822246_2822648_-|transposase	ISPsy11, transposase OrfA	transposase	NA	NA	NA	NA
VDY43006.1|2823618_2823786_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.5e-20
VDY43008.1|2823782_2824868_-	isocitrate dehydrogenase	NA	NA	NA	NA	NA
VDY43010.1|2824967_2825705_+	putative ribosomal large subunit pseudouridine synthase	NA	NA	NA	NA	NA
VDY43012.1|2825701_2826031_+	putative secreted protein	NA	NA	NA	NA	NA
VDY43014.1|2826042_2826504_+	mutT family protein	NA	NA	NA	NA	NA
VDY43016.1|2826687_2827665_+|tRNA	tRNA-specific 2-thiouridylase MnmA	tRNA	NA	NA	NA	NA
2829603:2829618	attR	GAAAAACTGAAAGAGT	NA	NA	NA	NA
>prophage 13
LR133909	Salmonella enterica subsp. enterica serovar Daytona strain NCTC7102 genome assembly, chromosome: 1	4926237	3436942	3488473	4926237	transposase,terminase,holin,integrase,tail	Salmonella_phage(48.44%)	79	3432073:3432090	3494133:3494150
3432073:3432090	attL	CCGCATAGCCCCGCCAGT	NA	NA	NA	NA
VDY44544.1|3436942_3437233_-|transposase	transposase	transposase	NA	NA	NA	NA
VDY44546.1|3437201_3437453_-|transposase	IS285 transposase	transposase	A0A218MNI5	uncultured_virus	54.5	4.8e-18
VDY44548.1|3437627_3437786_-|transposase	transposase	transposase	NA	NA	NA	NA
VDY44550.1|3437857_3438091_-|transposase	transposase	transposase	F6MIM4	Haemophilus_phage	62.7	7.1e-08
VDY44552.1|3438178_3439765_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY44554.1|3439761_3440688_-	bactoprenol glucosyl transferase	NA	I1TED8	Salmonella_phage	93.4	5.3e-163
VDY44556.1|3440684_3441047_-	translocase	NA	I1TED9	Salmonella_phage	100.0	3.9e-61
VDY44558.1|3442494_3442758_+|integrase	integrase	integrase	A0A0M4R586	Salmonella_phage	78.0	2.7e-16
VDY44560.1|3442906_3444127_+|integrase	putative phage integrase (pseudogene)	integrase	A0A248SL35	Klebsiella_phage	30.6	6.5e-36
VDY44562.1|3444889_3445612_+	phage protein	NA	Q8HAB2	Salmonella_phage	94.1	1.1e-128
VDY44564.1|3445612_3445762_-|tail	major tail sheath domain protein	tail	S4TRX2	Salmonella_phage	61.0	4.7e-05
VDY44574.1|3446454_3447279_-	UPF0189 protein LA_4133	NA	A0A0M4QWS3	Salmonella_phage	93.4	4.3e-148
VDY44576.1|3447275_3448727_-|tail	Gifsy-2 prophage tail fiber protein	tail	E5G6P0	Salmonella_phage	84.6	1.7e-59
VDY44578.1|3448716_3449319_-	Protein of uncharacterised function (DUF2612)	NA	A0A2R3UAM9	Myoviridae_environmental_samples	38.9	3.3e-33
VDY44580.1|3449320_3450562_-	bacteriophage protein	NA	A0A077KGW9	Edwardsiella_phage	49.9	1.2e-101
VDY44582.1|3450558_3450915_-	Uncharacterised protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	1.6e-19
VDY44584.1|3450927_3451605_-	bacteriophage protein	NA	A0A077KAY0	Edwardsiella_phage	36.4	5.4e-32
VDY44586.1|3451585_3452455_-	Uncharacterised protein	NA	A0A077KC17	Edwardsiella_phage	32.6	3.4e-31
VDY44588.1|3452451_3452754_-	Uncharacterised protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
VDY44590.1|3452753_3453464_-	Uncharacterised protein	NA	A0A077KGW3	Edwardsiella_phage	34.4	8.5e-28
VDY44592.1|3453524_3454244_-	lytic transglycosylase	NA	A0A0M4REK7	Salmonella_phage	70.0	2.3e-49
VDY44594.1|3454432_3455635_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY44596.1|3455618_3455801_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY44598.1|3455842_3456247_-	Uncharacterised protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
VDY44600.1|3456246_3456693_-	Uncharacterised protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
VDY44602.1|3456693_3458136_-	Protein of uncharacterised function (DUF3383)	NA	A0A077KGV4	Edwardsiella_phage	40.3	2.2e-91
VDY44604.1|3458144_3458495_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY44606.1|3458442_3458652_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY44608.1|3458691_3459057_-	Uncharacterised protein	NA	A0A077KAW7	Edwardsiella_phage	40.5	3.0e-21
VDY44610.1|3459053_3459638_-	Mu-like prophage protein gpG	NA	H9C0W2	Aeromonas_phage	30.3	2.1e-16
VDY44612.1|3459631_3460078_-	Uncharacterised protein	NA	A0A068CGG9	Acinetobacter_phage	40.6	2.3e-15
VDY44614.1|3460084_3460432_-	Uncharacterised protein	NA	H9C0V9	Aeromonas_phage	40.2	3.9e-10
VDY44616.1|3460435_3461464_-	Uncharacterised protein	NA	A0A219YBB0	Aeromonas_phage	48.7	2.3e-82
VDY44618.1|3461463_3461718_-	Uncharacterised protein	NA	K4HYQ5	Acinetobacter_phage	45.6	4.5e-08
VDY44620.1|3461660_3461948_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY44622.1|3461949_3463296_-	Uncharacterized protein conserved in bacteria	NA	A0A219YCD3	Aeromonas_phage	36.5	5.5e-68
VDY44624.1|3463292_3463982_-	putative bacteriophage protein	NA	H9C0V1	Aeromonas_phage	48.7	4.9e-57
VDY44626.1|3464022_3464397_-	phage-associated protein, HI1409 family	NA	Q2NPC0	Xanthomonas_phage	39.0	1.7e-11
VDY44628.1|3464404_3464920_-	Protein of uncharacterised function (DUF1073)	NA	Q6UJ14	Burkholderia_virus	61.2	1.8e-56
VDY44630.1|3464942_3465545_-	Protein of uncharacterised function (DUF1073)	NA	H9C0V0	Aeromonas_phage	31.5	2.7e-11
VDY44632.1|3465544_3466858_-	gp33 TerL	NA	A0A0M5M1R6	Salmonella_phage	80.4	1.8e-204
VDY44634.1|3466805_3467102_-	gp33 TerL	NA	A0A0M5M1R6	Salmonella_phage	79.8	3.3e-34
VDY44636.1|3467217_3467796_-|terminase	putative prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	97.8	1.8e-92
VDY44638.1|3467900_3468107_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY44640.1|3468215_3468398_-	Protein of uncharacterised function (DUF826)	NA	NA	NA	NA	NA
VDY44642.1|3468622_3469090_-	putative endopeptidase	NA	A0A0M4RD57	Salmonella_phage	94.2	5.7e-73
VDY44644.1|3469086_3469539_-	Lysozyme	NA	A0A0M4R365	Salmonella_phage	98.7	4.6e-80
VDY44646.1|3469522_3469858_-|holin	bacteriophage holin	holin	A0A0M3ULK9	Salmonella_phage	100.0	4.1e-57
VDY44648.1|3470340_3470814_+	GogA	NA	Q9MBM2	Phage_Gifsy-1	100.0	2.4e-87
VDY44650.1|3471723_3472287_-	antirepressor	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
VDY44652.1|3472559_3472871_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	52.4	2.1e-15
VDY44654.1|3472816_3473239_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.7	1.6e-37
VDY44656.1|3473207_3473987_-	bacteriophage Lambda NinG protein	NA	A0A0M4RU10	Salmonella_phage	97.0	1.1e-89
VDY44658.1|3473989_3474196_-	Phage protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
VDY44660.1|3474195_3474798_-	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
VDY44662.1|3475197_3475431_-	Gifsy-1 prophage DinI	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
VDY44664.1|3475672_3476305_-	putative prophage protein	NA	NA	NA	NA	NA
VDY44666.1|3476412_3476712_-	hypothetical bacteriophage protein	NA	A0A220NQU1	Salmonella_phage	66.0	1.1e-24
VDY44668.1|3476925_3477144_-	prophage protein	NA	S4TSR6	Salmonella_phage	92.4	6.4e-27
VDY44670.1|3477174_3477594_-	prophage protein	NA	S4TNP2	Salmonella_phage	92.2	9.7e-56
VDY44672.1|3477798_3477993_-	Uncharacterised protein	NA	T1SA27	Salmonella_phage	96.6	8.2e-26
VDY44674.1|3477989_3478337_-	DNA-binding protein	NA	H6WRX9	Salmonella_phage	98.3	1.5e-57
VDY44676.1|3478347_3478620_-	DNA replication protein DnaC	NA	H6WRX8	Salmonella_phage	100.0	4.7e-35
VDY44678.1|3478801_3480019_-	regulatory protein	NA	H6WRX7	Salmonella_phage	99.6	7.0e-147
VDY44680.1|3480173_3480494_-	Gifsy-1 prophage cI protein	NA	H6WRX6	Salmonella_phage	100.0	1.3e-52
VDY44682.1|3480513_3480741_-	phage regulatory protein	NA	K7PKS2	Enterobacteria_phage	95.9	1.5e-34
VDY44684.1|3480754_3481222_+	DNA-binding protein	NA	K7PHG0	Enterobacteria_phage	86.5	2.5e-68
VDY44686.1|3481250_3481481_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY44688.1|3481477_3481759_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY44690.1|3482010_3482217_-	bacteriophage protein	NA	K7P7I0	Enterobacteria_phage	67.6	1.6e-16
VDY44692.1|3482618_3482777_+	DNA breaking-rejoining protein	NA	H6WRX3	Salmonella_phage	96.2	2.6e-22
VDY44694.1|3482861_3483149_+	Gifsy-1 prophage protein	NA	H6WRX2	Salmonella_phage	97.9	1.5e-47
VDY44696.1|3483275_3484361_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	98.5	1.2e-182
VDY44698.1|3484407_3484662_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY44700.1|3484703_3486206_+	exodeoxyribonuclease VIII	NA	H6WRX1	Salmonella_phage	98.6	3.1e-229
VDY44702.1|3486217_3487327_+	Gifsy-2 prophage RecT	NA	H6WRX0	Salmonella_phage	100.0	7.1e-207
VDY44704.1|3487650_3488115_+	ATPase involved in DNA repair	NA	A0A1B5FPC7	Escherichia_phage	51.7	1.7e-40
VDY44706.1|3488114_3488330_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY44708.1|3488326_3488473_+	Putative bacteriophage protein	NA	A0A1B5FPC2	Escherichia_phage	80.9	2.3e-17
3494133:3494150	attR	CCGCATAGCCCCGCCAGT	NA	NA	NA	NA
>prophage 14
LR133909	Salmonella enterica subsp. enterica serovar Daytona strain NCTC7102 genome assembly, chromosome: 1	4926237	3540297	3597037	4926237	transposase,tRNA,protease	Bacillus_phage(21.43%)	58	NA	NA
VDY44845.1|3540297_3540612_+|protease	Putative stomatin/prohibitin-family membraneprotease subunit YbbK	protease	NA	NA	NA	NA
VDY44847.1|3540760_3540967_+|protease	Putative stomatin/prohibitin-family membraneprotease subunit YbbK	protease	NA	NA	NA	NA
VDY44849.1|3540963_3541233_+|protease	Putative activity regulator of membraneprotease YbbK	protease	NA	NA	NA	NA
VDY44851.1|3541267_3541417_+|protease	Putative activity regulator of membraneprotease YbbK	protease	NA	NA	NA	NA
VDY44853.1|3541417_3541834_-	copper efflux regulator	NA	NA	NA	NA	NA
VDY44855.1|3541943_3543854_+	Lead cadmium zinc and mercury transporting ATPase	NA	A0A218MNH6	uncultured_virus	35.2	3.0e-72
VDY44857.1|3543891_3544179_+	Lead cadmium zinc and mercury transporting ATPase	NA	E4ZFI9	Streptococcus_phage	50.0	4.6e-17
VDY44859.1|3544168_3544435_+	Lead cadmium zinc and mercury transporting ATPase	NA	A0A218MNH6	uncultured_virus	56.6	4.3e-09
VDY44861.1|3544602_3545430_+	Secreted protein	NA	NA	NA	NA	NA
VDY44863.1|3546511_3546991_+|tRNA	Cys-tRNA(Pro) deacylase YbaK	tRNA	NA	NA	NA	NA
VDY44865.1|3547107_3548760_-	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
VDY44867.1|3548932_3550153_+	fosmidomycin resistance protein	NA	NA	NA	NA	NA
VDY44869.1|3550611_3551859_+	transport protein	NA	NA	NA	NA	NA
VDY44871.1|3552094_3553444_-	inosine/guanosine kinase	NA	NA	NA	NA	NA
VDY44873.1|3553723_3554524_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	27.4	7.1e-15
VDY44875.1|3554520_3555483_-	ferrochelatase	NA	NA	NA	NA	NA
VDY44877.1|3555711_3556356_-	adenylate kinase	NA	NA	NA	NA	NA
VDY44879.1|3556772_3557450_-	chaperone protein HtpG	NA	NA	NA	NA	NA
VDY44881.1|3557608_3557848_-	chaperone protein HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	51.3	3.3e-16
VDY44883.1|3557924_3558197_-	chaperone protein HtpG	NA	NA	NA	NA	NA
VDY44885.1|3558244_3558652_-	chaperone protein HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	51.3	1.0e-25
VDY44887.1|3558762_3559368_-	recombination protein RecR	NA	NA	NA	NA	NA
VDY44889.1|3559367_3559697_-	DNA-binding protein, YbaB/EbfC family	NA	NA	NA	NA	NA
VDY44891.1|3561006_3561285_-	DNA polymerase III subunits gamma and tau	NA	E7DN81	Pneumococcus_phage	45.7	6.7e-13
VDY44893.1|3561786_3562338_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.2	1.0e-28
VDY44895.1|3562490_3562868_-	Inner membrane protein YbaN	NA	NA	NA	NA	NA
VDY44897.1|3562948_3563464_+	Primosomal replication protein N prime prime	NA	NA	NA	NA	NA
VDY44899.1|3563409_3563646_+	Putative inner membrane protein	NA	NA	NA	NA	NA
VDY44901.1|3563715_3564639_+|transposase	ISNCY transposase	transposase	Q2A0A7	Sodalis_phage	52.1	5.6e-64
VDY44903.1|3564680_3565349_-	integral membrane protein AefA	NA	NA	NA	NA	NA
VDY44905.1|3565311_3568044_-	integral membrane protein AefA	NA	NA	NA	NA	NA
VDY44907.1|3568162_3568816_-	potential acrAB operon repressor	NA	NA	NA	NA	NA
VDY44909.1|3569000_3570152_+	acriflavin resistance protein A	NA	NA	NA	NA	NA
VDY44911.1|3570174_3573324_+	acriflavin resistance protein B	NA	NA	NA	NA	NA
VDY44913.1|3573819_3574194_+	Hha toxicity attenuator	NA	NA	NA	NA	NA
VDY44915.1|3574221_3574440_+	hemolysin expression modulating protein	NA	NA	NA	NA	NA
VDY44917.1|3574618_3575170_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
VDY44919.1|3575287_3575818_+	Putative inner membrane protein	NA	NA	NA	NA	NA
VDY44921.1|3575814_3575955_-	LSU ribosomal protein L36p	NA	NA	NA	NA	NA
VDY44923.1|3575960_3576221_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
VDY44925.1|3578307_3578619_+	methylated-DNA-[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
VDY44927.1|3578651_3579221_-	lipoprotein	NA	NA	NA	NA	NA
VDY44929.1|3579435_3579783_+	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
VDY44931.1|3579745_3580297_+	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
VDY44933.1|3580396_3581683_-	ammonium transporter	NA	NA	NA	NA	NA
VDY44935.1|3581730_3582054_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
VDY44937.1|3582266_3584048_-	Multidrug resistance-like ATP-binding protein mdlB	NA	W8CYL7	Bacillus_phage	26.7	5.4e-39
VDY44939.1|3584040_3585813_-	ABC transporter ATP-binding membrane protein	NA	W8CYL7	Bacillus_phage	29.8	4.7e-51
VDY44941.1|3585853_3586312_-	transcriptional regulator	NA	NA	NA	NA	NA
VDY44943.1|3586424_3587480_+	lyase	NA	NA	NA	NA	NA
VDY44945.1|3587528_3588347_-	HMP-PP phosphatase	NA	NA	NA	NA	NA
VDY44947.1|3588447_3590148_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDY44949.1|3590212_3590908_+	queuosine biosynthesis protein QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.4	1.2e-87
VDY44951.1|3591013_3591412_-	4-hydroxybenzoyl-CoA thio esterase family activesite	NA	NA	NA	NA	NA
VDY44953.1|3591515_3591890_-	competence protein ComEA	NA	NA	NA	NA	NA
VDY44955.1|3592039_3593911_-	peptidyl-prolyl cis-trans isomerase D	NA	NA	NA	NA	NA
VDY44957.1|3594201_3594474_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.9e-20
VDY44959.1|3594682_3597037_-|protease	Lon protease	protease	A0A0R6PGP8	Moraxella_phage	52.5	2.7e-224
>prophage 15
LR133909	Salmonella enterica subsp. enterica serovar Daytona strain NCTC7102 genome assembly, chromosome: 1	4926237	4351393	4403912	4926237	transposase,tRNA,protease	Vibrio_phage(20.0%)	53	NA	NA
VDY46392.1|4351393_4352125_-|tRNA	putative tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
VDY46393.1|4352214_4354653_-	ribonuclease R (RNase R)	NA	Q0GXV6	Lactococcus_phage	33.1	9.9e-68
VDY46394.1|4354690_4355116_-	transcriptional regulator	NA	NA	NA	NA	NA
VDY46395.1|4355322_4356621_-	adenylosuccinate synthetase	NA	W5S5V7	Pithovirus	35.9	3.8e-66
VDY46396.1|4356723_4356921_-	membrane protein	NA	NA	NA	NA	NA
VDY46397.1|4356999_4358004_-|protease	FtsH protease regulator HflC	protease	NA	NA	NA	NA
VDY46398.1|4358006_4359266_-|protease	protease	protease	NA	NA	NA	NA
VDY46399.1|4359480_4360761_-|protease	GTP-binding subunit of protease	protease	NA	NA	NA	NA
VDY46400.1|4360831_4361140_-	host factor-I protein(HF-I)	NA	NA	NA	NA	NA
VDY46401.1|4361222_4362173_-|tRNA	tRNA delta-2-isopentenylpyrophosphate (IPP) transferase	tRNA	NA	NA	NA	NA
VDY46402.1|4362165_4364022_-	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.8	5.8e-60
VDY46403.1|4364031_4364667_-	N-acetylmuramoyl-l-alanine amidase II	NA	NA	NA	NA	NA
VDY46404.1|4364744_4365350_-	N-acetylmuramoyl-l-alanine amidase II	NA	NA	NA	NA	NA
VDY46405.1|4365366_4365552_-	ATPase YjeE predicted to have essential rolein cell wall biosynthesis	NA	NA	NA	NA	NA
VDY46406.1|4365800_4366301_-	carbohydrate kinase	NA	NA	NA	NA	NA
VDY46407.1|4366318_4367344_-	carbohydrate kinase	NA	NA	NA	NA	NA
VDY46408.1|4367345_4368485_+	Fe-S protein	NA	NA	NA	NA	NA
VDY46409.1|4369592_4370312_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDY46410.1|4370373_4370919_-	Oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.6	4.5e-29
VDY46411.1|4371025_4372078_+	ribosome-associated GTPase	NA	NA	NA	NA	NA
VDY46412.1|4372169_4373138_+	phosphatidylserine decarboxylase proenzyme	NA	NA	NA	NA	NA
VDY46413.1|4373188_4376482_+	Potassium efflux system KefA protein	NA	NA	NA	NA	NA
VDY46414.1|4376618_4376939_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY46415.1|4377003_4378506_-	amino acid permease	NA	NA	NA	NA	NA
VDY46416.1|4378731_4379643_-|tRNA	lysyl-tRNA synthetase	tRNA	A0A2K9KZX5	Tupanvirus	28.6	2.3e-25
VDY46417.1|4380032_4381823_+	fumarate reductase flavoprotein subunit	NA	NA	NA	NA	NA
VDY46418.1|4381815_4382550_+	fumarate reductase, iron-sulfur protein	NA	NA	NA	NA	NA
VDY46419.1|4382560_4382956_+	fumarate reductase complex subunit C; membrane anchor polypeptide	NA	NA	NA	NA	NA
VDY46420.1|4382966_4383326_+	fumarate reductase complex subunit D; membrane anchor polypeptide	NA	NA	NA	NA	NA
VDY46421.1|4383437_4383971_+	lipoprotein	NA	A0A1W6JNX6	Morganella_phage	54.8	1.2e-47
VDY46422.1|4383987_4384305_-	SugE protein	NA	NA	NA	NA	NA
VDY46423.1|4384503_4385148_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
VDY46424.1|4385432_4385609_-	entericidin A	NA	NA	NA	NA	NA
VDY46425.1|4385627_4386194_-	Elongation factor P EF-P	NA	NA	NA	NA	NA
VDY46426.1|4386234_4387263_+	Lysyl-lysine 23-aminomutase	NA	NA	NA	NA	NA
VDY46427.1|4387544_4388402_+	inner membrane protein	NA	NA	NA	NA	NA
VDY46428.1|4388462_4388804_-	membrane protein	NA	NA	NA	NA	NA
VDY46429.1|4389483_4390380_-	GroEL protein	NA	A0A2I7SAK5	Vibrio_phage	61.9	1.1e-85
VDY46430.1|4390324_4390711_-	GroEL protein	NA	A0A2I7SAK5	Vibrio_phage	74.8	3.5e-36
VDY46431.1|4390754_4391048_-	GroES protein	NA	K4F9I2	Cronobacter_phage	43.3	1.2e-12
VDY46432.1|4391302_4392565_+	transporter	NA	NA	NA	NA	NA
VDY46433.1|4392720_4393101_-	suppresses F exclusion of bacteriophage T7	NA	NA	NA	NA	NA
VDY46434.1|4393477_4394881_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
VDY46435.1|4394995_4396297_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
VDY46436.1|4396417_4396765_+	Divalent cation tolerance protein	NA	NA	NA	NA	NA
VDY46437.1|4396740_4397589_+	thiol:disulfide interchange protein DsbD	NA	NA	NA	NA	NA
VDY46438.1|4397581_4398445_+	thiol:disulfide interchange protein DsbD	NA	NA	NA	NA	NA
VDY46439.1|4398481_4399057_+	transcriptional regulator	NA	NA	NA	NA	NA
VDY46440.1|4399958_4400678_+	acid phosphatase	NA	NA	NA	NA	NA
VDY46441.1|4400852_4401737_+|transposase	transposase IS1113	transposase	A0A218MNI5	uncultured_virus	34.4	9.0e-11
VDY46442.1|4401985_4402987_-	putative periplasmic protein	NA	NA	NA	NA	NA
VDY46443.1|4403324_4403540_-|transposase	transposase	transposase	NA	NA	NA	NA
VDY46444.1|4403705_4403912_-|transposase	transposase insF	transposase	NA	NA	NA	NA
>prophage 16
LR133909	Salmonella enterica subsp. enterica serovar Daytona strain NCTC7102 genome assembly, chromosome: 1	4926237	4501140	4548123	4926237	tail,tRNA,plate	Burkholderia_phage(38.46%)	64	NA	NA
VDY46530.1|4501140_4501635_-|tRNA	tRNA dihydrouridine synthase A	tRNA	NA	NA	NA	NA
VDY46531.1|4501573_4502140_-|tRNA	tRNA dihydrouridine synthase A	tRNA	NA	NA	NA	NA
VDY46532.1|4502227_4503538_-	conjugative transfer protein	NA	NA	NA	NA	NA
VDY46533.1|4503784_4504300_+	zinc uptake regulation protein	NA	NA	NA	NA	NA
VDY46534.1|4504398_4504611_-	stress-response protein	NA	NA	NA	NA	NA
VDY46535.1|4504629_4504758_-	putative cytoplasmic protein	NA	NA	NA	NA	NA
VDY46536.1|4504739_4506065_-	DNA-damage-inducible membrane protein	NA	NA	NA	NA	NA
VDY46537.1|4506243_4506852_-	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
VDY46538.1|4506960_4507329_-	diacylglycerol kinase	NA	NA	NA	NA	NA
VDY46539.1|4507499_4509551_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
VDY46540.1|4509648_4509912_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
VDY46541.1|4510019_4510700_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
VDY46542.1|4510718_4510892_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
VDY46543.1|4510961_4511402_-	chorismate lyase	NA	NA	NA	NA	NA
VDY46544.1|4511582_4512500_-	maltose operon periplasmic protein	NA	NA	NA	NA	NA
VDY46545.1|4512663_4514022_-	maltoporin	NA	NA	NA	NA	NA
VDY46546.1|4514110_4515220_-	maltose/maltodextrin transport ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	30.6	3.6e-17
VDY46547.1|4515580_4516234_+	maltose ABC transporter periplasmic protein	NA	NA	NA	NA	NA
VDY46548.1|4516248_4516770_+	maltose ABC transporter periplasmic protein	NA	NA	NA	NA	NA
VDY46549.1|4516901_4517426_+	maltose transport inner membrane protein	NA	NA	NA	NA	NA
VDY46550.1|4517642_4518095_+	maltose transport inner membrane protein	NA	NA	NA	NA	NA
VDY46551.1|4518066_4518444_+	maltose transport inner membrane protein	NA	NA	NA	NA	NA
VDY46552.1|4518462_4519347_+	maltose transport inner membrane protein	NA	NA	NA	NA	NA
VDY46553.1|4519520_4519868_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
VDY46554.1|4520074_4522171_-	lipoprotein	NA	NA	NA	NA	NA
VDY46555.1|4522214_4522727_-	putative lipoprotein	NA	NA	NA	NA	NA
VDY46556.1|4522723_4522906_-	putative lipoprotein	NA	NA	NA	NA	NA
VDY46557.1|4522902_4523541_-	outer membrane lipoprotein	NA	NA	NA	NA	NA
VDY46558.1|4523604_4523832_-	Exopolysaccharide production protein YjbE	NA	NA	NA	NA	NA
VDY46559.1|4524256_4524988_-	Glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
VDY46560.1|4524984_4525947_-	Glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
VDY46561.1|4526291_4527641_+	lysine-sensitive aspartokinase III	NA	NA	NA	NA	NA
VDY46562.1|4527771_4528119_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
VDY46563.1|4528695_4528983_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
VDY46564.1|4529018_4529591_+	lytic murein transglycosylase	NA	Q5ZQZ1	Pseudomonas_phage	60.4	8.0e-61
VDY46565.1|4529603_4529918_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	47.3	2.4e-19
VDY46566.1|4530077_4530515_+	putative cytoplasmic protein	NA	NA	NA	NA	NA
VDY46567.1|4530530_4530728_+	gp12	NA	Q6QIB1	Burkholderia_phage	52.9	6.6e-07
VDY46568.1|4530717_4531170_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	55.8	3.5e-35
VDY46569.1|4531129_4532011_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	77.8	1.1e-122
VDY46570.1|4532248_4532668_+|tail	tail protein	tail	Q6QIA9	Burkholderia_phage	69.6	2.2e-52
VDY46571.1|4532719_4532860_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY46572.1|4532859_4533030_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY46573.1|4533214_4535581_+|tail	tail protein	tail	A4JWL0	Burkholderia_virus	32.1	2.3e-69
VDY46574.1|4535580_4536534_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.0	6.7e-36
VDY46575.1|4536533_4536743_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
VDY46576.1|4536730_4537774_+	gp21	NA	Q6QIA2	Burkholderia_phage	45.3	1.9e-76
VDY46577.1|4537783_4538506_+|plate	baseplate protein	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
VDY46578.1|4538829_4539192_+	phage glucose translocase	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
VDY46579.1|4539188_4539584_+	bactoprenol glucosyl transferase	NA	U5P087	Shigella_phage	84.6	1.1e-58
VDY46580.1|4539564_4539939_+	bactoprenol glucosyl transferase	NA	M1FQW5	Enterobacteria_phage	88.7	1.5e-55
VDY46581.1|4539922_4540120_+	bactoprenol glucosyl transferase	NA	B9UDL7	Salmonella_phage	74.6	1.6e-21
VDY46582.1|4540273_4541437_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.5	1.3e-38
VDY46583.1|4541647_4541770_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY46584.1|4541830_4542190_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
VDY46585.1|4542180_4542756_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	62.7	1.4e-52
VDY46586.1|4542850_4543297_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	42.9	3.9e-23
VDY46587.1|4543289_4543502_+|tail	tail fiber protein	tail	Q6QI98	Burkholderia_phage	55.7	2.8e-11
VDY46588.1|4543677_4543923_+|tail	tail fiber protein	tail	NA	NA	NA	NA
VDY46589.1|4543925_4545584_+|tail	phage tail fiber protein H	tail	A0A0M3ULH6	Salmonella_phage	40.5	1.0e-52
VDY46590.1|4545590_4546205_+|tail	Phage tail fiber assembly	tail	NA	NA	NA	NA
VDY46591.1|4546201_4546657_+	cytoplasmic protein	NA	NA	NA	NA	NA
VDY46592.1|4546907_4547198_+	putative inner membrane protein	NA	NA	NA	NA	NA
VDY46593.1|4547394_4548123_+	cytoplasmic protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 17
LR133909	Salmonella enterica subsp. enterica serovar Daytona strain NCTC7102 genome assembly, chromosome: 1	4926237	4839893	4845806	4926237		Enterobacteria_phage(33.33%)	8	NA	NA
VDY46903.1|4839893_4840532_-	UDP-4-amino-4-deoxy-L-arabinose- oxoglutarateaminotransferase UDP-(beta-L-threo-pentapyranosyl-4''-ulose diphosphate) aminotransferase; UDP-Ara4O aminotransferase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	1.1e-13
VDY46904.1|4840494_4840818_-	UDP-4-amino-4-deoxy-L-arabinose- oxoglutarateaminotransferase UDP-(beta-L-threo-pentapyranosyl-4''-ulose diphosphate) aminotransferase; UDP-Ara4O aminotransferase	NA	NA	NA	NA	NA
VDY46905.1|4840822_4841500_-	TDP-D-fucosamine acetyltransferase	NA	NA	NA	NA	NA
VDY46906.1|4841477_4842359_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.3	7.9e-108
VDY46907.1|4842391_4842679_-	UDP-N-acetylglucosamine epimerase	NA	A0A1D7XFE8	Escherichia_phage	58.5	6.9e-13
VDY46908.1|4842825_4843461_-	UDP-N-acetylglucosamine epimerase	NA	I7HTA3	Enterobacteria_phage	52.5	1.7e-48
VDY46909.1|4843524_4844724_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HFY9	Paramecium_bursaria_Chlorella_virus	26.8	7.6e-21
VDY46910.1|4844720_4845806_-	UDP-N-acetyl-D-glucosamine 2-epimerase	NA	A0A1V0SAG5	Catovirus	31.9	4.2e-26
