The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134075	Escherichia coli strain NCTC9084 genome assembly, chromosome: 1	4601921	994315	1007498	4601921	tRNA	Escherichia_phage(50.0%)	12	NA	NA
VDY78570.1|994315_995077_+	stationary phase survival protein SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
VDY78571.1|995070_995697_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
VDY78572.1|995836_996976_+	lipoprotein NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
VDY78573.1|997002_998031_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.3e-32
VDY78574.1|998124_999489_-	inner membrane permease YgbN	NA	NA	NA	NA	NA
VDY78575.1|999577_1000354_-	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
VDY78576.1|1000358_1000997_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
VDY78577.1|1000993_1002256_-|tRNA	paral putative tRNA synthase	tRNA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
VDY78578.1|1002252_1003161_-	oxidoreductase YgbJ	NA	A0A077SLF7	Escherichia_phage	76.5	3.0e-118
VDY78579.1|1003356_1004124_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
VDY78580.1|1004174_1004831_-	serine/threonine-specific protein phosphatase 2	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
VDY78581.1|1004936_1007498_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 2
LR134075	Escherichia coli strain NCTC9084 genome assembly, chromosome: 1	4601921	1624031	1633476	4601921		Enterobacteria_phage(85.71%)	10	NA	NA
VDY79141.1|1624031_1624958_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
VDY79142.1|1624962_1625694_+	ABC transporter permease	NA	NA	NA	NA	NA
VDY79143.1|1625674_1625782_-	putative inner membrane protein	NA	NA	NA	NA	NA
VDY79144.1|1625841_1626573_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
VDY79145.1|1626794_1628480_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
VDY79146.1|1628476_1629196_+	two-component response-regulatory protein YehT	NA	NA	NA	NA	NA
VDY79147.1|1629242_1629713_+	conserved protein, DUF1456 family	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
VDY79148.1|1629753_1630215_-	lipoprotein yehR	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
VDY79149.1|1630339_1632343_-	zinc finger SWIM domain-containing protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
VDY79150.1|1632339_1633476_-	von Willebrand factor type A domain protein YehP	NA	Q9EYF7	Enterobacteria_phage	97.7	8.5e-163
>prophage 3
LR134075	Escherichia coli strain NCTC9084 genome assembly, chromosome: 1	4601921	1670565	1677860	4601921	integrase	Escherichia_phage(40.0%)	11	1672347:1672373	1684442:1684468
VDY79183.1|1670565_1671465_-	lipid kinase	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
VDY79184.1|1671809_1672187_+	protein	NA	NA	NA	NA	NA
1672347:1672373	attL	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
VDY79185.1|1672452_1673466_-|integrase	phage integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
VDY79186.1|1673581_1673881_-	bacteriophage P2 C-like protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
VDY79187.1|1674002_1674278_+	bacteriophage P2 Cox-like protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
VDY79188.1|1674288_1674459_+	Uncharacterised protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
VDY79189.1|1674455_1674956_+	Phage protein B	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
VDY79190.1|1675019_1675244_+	Protein of uncharacterised function (DUF2732)	NA	S4TP68	Salmonella_phage	98.6	1.4e-32
VDY79191.1|1675243_1675546_+	Uncharacterised protein	NA	A0A0F7LCL4	Escherichia_phage	98.0	8.5e-46
VDY79192.1|1675545_1675770_+	C4-type zinc finger protein, DksA/TraR family	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
VDY79193.1|1675766_1677860_+	Replication gene A protein (GpA)	NA	A0A0F7LBQ2	Escherichia_phage	98.5	0.0e+00
1684442:1684468	attR	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
>prophage 4
LR134075	Escherichia coli strain NCTC9084 genome assembly, chromosome: 1	4601921	1681393	1688766	4601921	protease,capsid	Escherichia_phage(50.0%)	7	NA	NA
VDY79196.1|1681393_1682428_-|capsid	phage capsid protein	capsid	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
VDY79197.1|1682427_1683267_-	Terminase, ATPase subunit (GpP)	NA	A0A0F7LCM8	Escherichia_phage	99.3	6.5e-160
VDY79198.1|1683401_1684040_+	phage protein D	NA	A0A0F7LDZ2	Escherichia_phage	97.6	7.5e-100
VDY79199.1|1684612_1685974_-|protease	putative protease	protease	Q6DW11	Phage_TP	99.7	1.9e-217
VDY79200.1|1686120_1686453_-	protein	NA	NA	NA	NA	NA
VDY79201.1|1686643_1687366_-	two-component response regulator	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
VDY79202.1|1687362_1688766_-	two-component sensor kinase	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 5
LR134075	Escherichia coli strain NCTC9084 genome assembly, chromosome: 1	4601921	1778078	1837067	4601921	transposase	Escherichia_phage(23.08%)	60	NA	NA
VDY79282.1|1778078_1778444_-|transposase	transposase	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
VDY79283.1|1778595_1779354_-	cytoplasmic protein	NA	NA	NA	NA	NA
VDY79284.1|1779367_1780582_-	carbohydrate kinase	NA	NA	NA	NA	NA
VDY79285.1|1780777_1780894_-|transposase	putative transposase, ISEc23	transposase	A0A0P0ZBS5	Stx2-converting_phage	71.4	1.2e-08
VDY79286.1|1782635_1783178_+	bifunctional adenosylcobalamin biosynthesis protein [includes adenosylcobinamide kinase; adenosylcobinamide-phosphate guanylyltransferase]	NA	NA	NA	NA	NA
VDY79287.1|1783174_1783918_+	cobalamin synthase	NA	NA	NA	NA	NA
VDY79288.1|1783929_1785009_+	Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
VDY79289.1|1785070_1786006_+	ErfK/YbiS/YcfS/YnhG family protein	NA	NA	NA	NA	NA
VDY79290.1|1786463_1787381_+	Nitrogen assimilation regulatory protein nac	NA	NA	NA	NA	NA
VDY79291.1|1787482_1788433_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDY79292.1|1788739_1790194_+	multidrug efflux system	NA	NA	NA	NA	NA
VDY79293.1|1790826_1791543_-	putative cytoplasmic protein	NA	NA	NA	NA	NA
VDY79294.1|1791885_1793340_-	AMP nucleosidase	NA	NA	NA	NA	NA
VDY79295.1|1793441_1794758_-	shikimate transporter	NA	NA	NA	NA	NA
VDY79296.1|1795072_1796125_+	ADP-heptose--LPS heptosyltransferase-like protein	NA	NA	NA	NA	NA
VDY79297.1|1796387_1799798_-	putative adhesin	NA	NA	NA	NA	NA
VDY79298.1|1800257_1801055_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
VDY79299.1|1801807_1802338_-	cytochrome	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
VDY79300.1|1802680_1803331_-	metal ABC transporter substrate binding protein	NA	NA	NA	NA	NA
VDY79301.1|1803587_1804223_-	sulfite oxidase subunit YedZ	NA	NA	NA	NA	NA
VDY79302.1|1804223_1805228_-	putative oxidoreductase	NA	NA	NA	NA	NA
VDY79303.1|1805336_1805750_-	transthyretin-like protein	NA	NA	NA	NA	NA
VDY79304.1|1805771_1806554_+	transcriptional regulatory protein YedW	NA	W8CYM9	Bacillus_phage	35.2	3.7e-32
VDY79305.1|1806553_1807912_+	two-component sensor kinase	NA	NA	NA	NA	NA
VDY79306.1|1808019_1808871_-	chaperone protein	NA	NA	NA	NA	NA
VDY79307.1|1809462_1810644_-	Porin OmpN	NA	Q1MVN1	Enterobacteria_phage	54.2	2.3e-102
VDY79308.1|1811192_1811576_+	inner membrane protein YedR	NA	NA	NA	NA	NA
VDY79309.1|1811615_1812311_+	putative phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.4	3.6e-07
VDY79310.1|1812377_1813796_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
VDY79311.1|1813776_1814247_+	patch repair protein	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
VDY79312.1|1814235_1815156_-	putative DMT superfamily transporter inner membrane protein	NA	NA	NA	NA	NA
VDY79313.1|1815328_1816246_+	putative methyl-independent mismatch repair protein	NA	NA	NA	NA	NA
VDY79314.1|1816324_1816507_+	putative small protein	NA	NA	NA	NA	NA
VDY79315.1|1816744_1818439_+	cellulose synthesis regulatory protein (signal transduction protein)	NA	A0A127AWB9	Bacillus_phage	35.6	7.7e-19
VDY79316.1|1818435_1819251_-	mannosyl-3-phosphoglycerate phosphatase	NA	NA	NA	NA	NA
VDY79317.1|1819548_1819776_-	Protein of uncharacterised function (DUF2525)	NA	NA	NA	NA	NA
VDY79318.1|1819938_1820127_+	DsrB protein	NA	NA	NA	NA	NA
VDY79319.1|1820170_1820794_-	colanic acid capsullar biosynthesis activation protein A	NA	NA	NA	NA	NA
VDY79320.1|1821083_1821869_-	flagellar biosynthesis protein FliR	NA	NA	NA	NA	NA
VDY79321.1|1821876_1822146_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
VDY79322.1|1822155_1822893_-	flagellar biosynthetic protein FliP	NA	NA	NA	NA	NA
VDY79323.1|1822892_1823258_-	flagellar biosynthesis protein FliO	NA	NA	NA	NA	NA
VDY79324.1|1823260_1823674_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
VDY79325.1|1823670_1824675_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
VDY79326.1|1824679_1825144_-	flagellar protein FliL	NA	NA	NA	NA	NA
VDY79327.1|1825248_1826376_-	flagellar hook-length control protein	NA	NA	NA	NA	NA
VDY79328.1|1826372_1826816_-	flagellar protein FliJ	NA	NA	NA	NA	NA
VDY79329.1|1826834_1827587_-	flagellum-specific ATP synthase	NA	NA	NA	NA	NA
VDY79330.1|1827583_1828207_-	flagellum-specific ATP synthase	NA	NA	NA	NA	NA
VDY79331.1|1828206_1828893_-	flagellar assembly protein H	NA	NA	NA	NA	NA
VDY79332.1|1828885_1829881_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
VDY79333.1|1829873_1831532_-	flagellar M-ring protein	NA	NA	NA	NA	NA
VDY79334.1|1831747_1832062_+	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
VDY79335.1|1832395_1832728_+	Multidrug transporter emrE	NA	NA	NA	NA	NA
VDY79336.1|1832896_1833448_+	kinase inhibitor	NA	NA	NA	NA	NA
VDY79337.1|1833457_1833799_+	DNA-binding transcriptional regulator; DLP12 prophage	NA	NA	NA	NA	NA
VDY79338.1|1833809_1834187_-|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	100.0	1.3e-67
VDY79339.1|1834231_1834507_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	2.0e-46
VDY79340.1|1835917_1836658_+|transposase	transposase	transposase	A0A1W6JP07	Morganella_phage	96.2	2.6e-128
VDY79341.1|1836677_1837067_+|transposase	putative transposase B, IS609	transposase	A0A077SL42	Escherichia_phage	97.7	9.2e-61
>prophage 6
LR134075	Escherichia coli strain NCTC9084 genome assembly, chromosome: 1	4601921	2198589	2244929	4601921	tail,protease,lysis,integrase,transposase	Enterobacteria_phage(25.93%)	50	2226945:2226959	2230234:2230248
VDY79699.1|2198589_2199411_-|protease	putative protease	protease	NA	NA	NA	NA
VDY79700.1|2199686_2199995_-	acid shock protein	NA	NA	NA	NA	NA
VDY79701.1|2200418_2201672_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VDY79702.1|2201778_2202672_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDY79703.1|2202806_2204027_+	protein Mlc (making large colonies protein)	NA	NA	NA	NA	NA
VDY79704.1|2204151_2204847_+	dithiobiotin synthetase	NA	NA	NA	NA	NA
VDY79705.1|2204799_2206056_-	voltage-gated ClC-type chloride channel	NA	NA	NA	NA	NA
VDY79706.1|2206250_2206865_-	anaerobic dimethyl sulfoxide reductase maturation protein (twin-arginine leader-binding protein)	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
VDY79707.1|2206907_2207762_-	putative dimethyl sulfoxide reductase, anchor subunit	NA	NA	NA	NA	NA
VDY79708.1|2207763_2208381_-	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
VDY79709.1|2208391_2210788_-	putative dimethyl sulfoxide reductase, olydopterin dinucleotide binding subunit	NA	A0A077SK27	Escherichia_phage	48.6	1.4e-207
VDY79710.1|2210875_2213302_-	putative dimethyl sulfoxide reductase, oxidoreductase subunit	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
VDY79711.1|2213500_2213806_-	protein	NA	NA	NA	NA	NA
VDY79712.1|2213877_2214624_+	lipoprotein	NA	NA	NA	NA	NA
VDY79713.1|2214626_2215187_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
VDY79714.1|2215221_2215563_-	protein	NA	NA	NA	NA	NA
VDY79715.1|2215697_2216024_+	inner membrane protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
VDY79716.1|2216229_2217444_+	starvation sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
VDY79717.1|2217455_2218475_+	dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
VDY79718.1|2218662_2219943_-|integrase	defective integrase; Qin prophage	integrase	B6DZ48	Enterobacteria_phage	62.1	3.3e-155
VDY79719.1|2219977_2220214_-	putative excisionase	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
VDY79720.1|2220301_2221933_-	Exonuclease RNase T and DNA polymerase III	NA	A0A192Y6E0	Salmonella_phage	56.7	5.6e-59
VDY79721.1|2221971_2222238_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
VDY79722.1|2222295_2223447_+|transposase	IS30 transposase encoded within prophage CP-933T	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
VDY79723.1|2223531_2224350_+|transposase	IS600 orfAB' transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
VDY79724.1|2224374_2224689_-	Exonuclease RNase T and DNA polymerase III	NA	NA	NA	NA	NA
VDY79725.1|2225010_2225367_+	putative methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
VDY79726.1|2226519_2226699_+	membrane protein	NA	NA	NA	NA	NA
2226945:2226959	attL	GGAGAAGCAGGCTAT	NA	NA	NA	NA
VDY79727.1|2227033_2228347_+|integrase,transposase	putative integrase/transposase	integrase,transposase	NA	NA	NA	NA
VDY79728.1|2228783_2229116_-	Qin prophage protein	NA	NA	NA	NA	NA
VDY79729.1|2229648_2229888_+	antitoxin of the RelE-RelB toxin-antitoxin system and transcriptional repressor of relBEF	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
VDY79730.1|2229887_2230175_+	toxin of the RelE-RelB toxin-antitoxin system	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
VDY79731.1|2230246_2230402_+	putative host cell-killing modulation protein	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
2230234:2230248	attR	GGAGAAGCAGGCTAT	NA	NA	NA	NA
VDY79732.1|2230618_2230870_+	putative prophage protein	NA	NA	NA	NA	NA
VDY79733.1|2231216_2232269_+	putative prophage protein	NA	S5FV02	Shigella_phage	54.1	5.7e-97
VDY79734.1|2232690_2232903_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
VDY79735.1|2234020_2234140_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY79736.1|2234181_2234388_+|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	94.1	4.5e-30
VDY79737.1|2234392_2234704_+	Qin prophage protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
VDY79738.1|2234700_2235234_+	prophage lysozyme (endolysin)	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
VDY79739.1|2235230_2235728_+	Qin prophage protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
VDY79740.1|2236977_2237151_+	GnsA/GnsB family transcriptional regulator	NA	NA	NA	NA	NA
VDY79741.1|2237302_2237713_-	Qin prophage	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
VDY79742.1|2238392_2238938_+	DNA packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.2	9.5e-88
VDY79743.1|2238934_2239222_+|tail	Putative tail component of prophage	tail	A0A291AWT4	Escherichia_phage	98.9	1.4e-42
VDY79744.1|2239218_2239497_+|tail	Prophage tail fiber domain protein	tail	NA	NA	NA	NA
VDY79745.1|2240169_2240760_-	putative DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
VDY79746.1|2241076_2241310_-	Qin prophage DNA-binding transcriptional regulator	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
VDY79747.1|2242096_2243380_+	metabolite transport protein YdfJ	NA	NA	NA	NA	NA
VDY79748.1|2243468_2244929_+	putative sugar dehydrogenase	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
>prophage 7
LR134075	Escherichia coli strain NCTC9084 genome assembly, chromosome: 1	4601921	2438275	2445550	4601921	tRNA	Enterobacteria_phage(33.33%)	9	NA	NA
VDY79912.1|2438275_2438620_+	putative outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	63.9	7.2e-25
VDY79913.1|2438630_2439410_+	outer membrane protein N (porin)	NA	Q1MVN1	Enterobacteria_phage	56.0	1.2e-72
VDY79914.1|2439550_2439985_+	putative universal stress protein	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
VDY79915.1|2440161_2441097_+|tRNA	C32 tRNA thiolase	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
VDY79916.1|2441225_2442599_-	ATP-independent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
VDY79917.1|2442628_2442802_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY79918.1|2443077_2443311_-	zinc transport protein	NA	NA	NA	NA	NA
VDY79919.1|2443300_2444062_-	zinc transport protein	NA	NA	NA	NA	NA
VDY79920.1|2444317_2445550_+	putative signaling protein	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 8
LR134075	Escherichia coli strain NCTC9084 genome assembly, chromosome: 1	4601921	2939910	2947687	4601921	integrase	Salmonella_phage(83.33%)	13	2940654:2940668	2951625:2951639
VDY80386.1|2939910_2940144_-	Prophage protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
VDY80387.1|2940154_2940343_-	Uncharacterised protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
VDY80388.1|2940495_2942910_-	putative replication protein for prophage	NA	E5G6L9	Salmonella_phage	96.1	0.0e+00
2940654:2940668	attL	GCTGTCGCTGATGGT	NA	NA	NA	NA
VDY80389.1|2942906_2943764_-	site-specific DNA-methyltransferase	NA	E5G6L8	Salmonella_phage	97.9	1.2e-161
VDY80390.1|2943760_2943988_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
VDY80391.1|2943987_2944221_-	Protein of uncharacterised function (DUF2732)	NA	E5G6L6	Salmonella_phage	94.8	3.5e-31
VDY80392.1|2944288_2944630_-	Uncharacterised protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
VDY80393.1|2944593_2944794_-	Protein of uncharacterised function (DUF2724)	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
VDY80394.1|2944801_2945311_-	phage regulatory protein CII	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
VDY80395.1|2945343_2945565_-	ybl30	NA	NA	NA	NA	NA
VDY80396.1|2945690_2946260_+	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.9	2.9e-39
VDY80397.1|2946275_2946467_+	Uncharacterised protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
VDY80398.1|2946655_2947687_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	56.4	1.2e-104
2951625:2951639	attR	ACCATCAGCGACAGC	NA	NA	NA	NA
>prophage 9
LR134075	Escherichia coli strain NCTC9084 genome assembly, chromosome: 1	4601921	3029761	3049349	4601921	terminase,lysis,integrase	Enterobacteria_phage(73.91%)	29	3022866:3022880	3057835:3057849
3022866:3022880	attL	CAGGCCATCTTCCAG	NA	NA	NA	NA
VDY80476.1|3029761_3030115_+	IS2 ORF2	NA	Q9ZXG3	Shigella_phage	69.0	2.4e-39
VDY80477.1|3030156_3030900_-	putative AraC-type regulatory protein encoded in prophage CP-933H	NA	NA	NA	NA	NA
VDY80478.1|3032985_3034170_-	Phage protein	NA	K7PHC9	Enterobacteria_phage	71.4	2.3e-38
VDY80479.1|3034171_3035233_-|terminase	terminase GpA	terminase	A0A0K2FJ14	Enterobacteria_phage	98.9	1.7e-213
VDY80480.1|3035207_3035753_-	prophage qsr' DNA packaging protein NU1-like protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
VDY80481.1|3036500_3036707_-	DLP12 prophage; predicted protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
VDY80482.1|3036992_3037403_+	putative envelope protein	NA	C6ZCX4	Enterobacteria_phage	99.3	9.4e-72
VDY80483.1|3037693_3037987_+	lambdoid prophage DLP12 Bor-like protein	NA	K7PL54	Enterobacteria_phage	100.0	4.0e-48
VDY80484.1|3038018_3038321_-	endopeptidase of prophage CP-933X	NA	A0A0K2FJD0	Enterobacteria_phage	100.0	2.6e-47
VDY80485.1|3038322_3038481_-|lysis	phage endopeptidase/lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	88.1	3.2e-12
VDY80486.1|3038477_3038975_-	phage lysozome	NA	M1FJA0	Enterobacteria_phage	97.6	1.9e-90
VDY80487.1|3038974_3039190_-|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
VDY80488.1|3039824_3040859_+	outer membrane porin protein NmpC	NA	Q1MVN1	Enterobacteria_phage	75.8	9.1e-148
VDY80489.1|3041047_3041431_-	lambdoid prophage DLP12 antitermination protein Q	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
VDY80490.1|3041653_3042016_-	endodeoxyribonuclease RUS	NA	K7PM48	Enterobacteria_phage	96.5	7.3e-60
VDY80491.1|3042012_3042303_-	DLP12 prophage	NA	K7PGZ6	Enterobacteria_phage	93.8	4.3e-47
VDY80492.1|3042295_3042466_-	prophage protein NinE	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
VDY80493.1|3042465_3042921_-	DLP12 prophage; DNA base-flipping protein	NA	I6PD71	Cronobacter_phage	67.5	1.4e-60
VDY80494.1|3043111_3043564_-	17 kDa surface antigen	NA	NA	NA	NA	NA
VDY80495.1|3043560_3044121_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY80496.1|3044377_3044569_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY80497.1|3044755_3045175_+	Bet protein	NA	A0A1I9LJN0	Stx_converting_phage	100.0	3.9e-73
VDY80498.1|3045321_3045543_+	putative C4-type zinc finger protein	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
VDY80499.1|3045539_3045791_+	putative bacteriophage protein	NA	A0A0K2FJF6	Enterobacteria_phage	92.3	1.3e-31
VDY80500.1|3046089_3046704_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY80501.1|3046997_3047117_+	phage protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	79.5	8.0e-08
VDY80502.1|3047364_3047793_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY80503.1|3047875_3048043_+	Uncharacterised protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
VDY80504.1|3048278_3049349_+|integrase	putative integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	3.3e-201
3057835:3057849	attR	CAGGCCATCTTCCAG	NA	NA	NA	NA
>prophage 10
LR134075	Escherichia coli strain NCTC9084 genome assembly, chromosome: 1	4601921	3500104	3553789	4601921	holin,tail,plate,integrase	Shigella_phage(37.5%)	53	3519039:3519055	3551235:3551251
VDY80906.1|3500104_3502138_-|holin	high-affinity choline transport protein (BCCT-family transporter)	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
VDY80907.1|3502266_3502854_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
VDY80908.1|3502867_3504340_+	betaine aldehyde dehydrogenase	NA	NA	NA	NA	NA
VDY80909.1|3504353_3506024_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
VDY80910.1|3506236_3506905_+	inner membrane protein	NA	NA	NA	NA	NA
VDY80911.1|3507147_3507843_-	transporter	NA	NA	NA	NA	NA
VDY80912.1|3507835_3509263_-	putative electron transport protein YkgF	NA	NA	NA	NA	NA
VDY80913.1|3509273_3509993_-	hydroxyacid oxidoreductase (Fe-S centre)	NA	NA	NA	NA	NA
VDY80914.1|3510727_3511375_-	transcriptional regulator YkgD	NA	NA	NA	NA	NA
VDY80915.1|3511600_3512926_+	putative pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
VDY80916.1|3513282_3513876_+	inner membrane protein	NA	NA	NA	NA	NA
VDY80917.1|3514465_3515317_+	Putatve transcriptional regulator ykgA	NA	NA	NA	NA	NA
VDY80918.1|3515273_3515432_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY80919.1|3515456_3519713_-	Ig domain-containing protein	NA	NA	NA	NA	NA
3519039:3519055	attL	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
VDY80920.1|3520827_3520929_+	small predicted membrane protein	NA	NA	NA	NA	NA
VDY80921.1|3521289_3521556_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
VDY80922.1|3521555_3521696_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
VDY80923.1|3522781_3523324_+	putative fimbrial transcriptional regulator	NA	NA	NA	NA	NA
VDY80924.1|3523398_3523986_+	fimbrillin	NA	NA	NA	NA	NA
VDY80925.1|3524043_3524712_+	putative fimbrial protein	NA	NA	NA	NA	NA
VDY80926.1|3524737_3527263_+	putative fimbrial outer membrane usher protein	NA	NA	NA	NA	NA
VDY80927.1|3527252_3528350_+	putative fimbrial protein	NA	NA	NA	NA	NA
VDY80928.1|3528524_3528896_+	putative fimbrial protein	NA	NA	NA	NA	NA
VDY80929.1|3528864_3529575_+	putative fimbrial protein	NA	NA	NA	NA	NA
VDY80930.1|3530464_3531079_-	integral membrane protein	NA	NA	NA	NA	NA
VDY80931.1|3531496_3532186_+	putative xanthine dehydrogenase, iron-sulfur binding subunit	NA	NA	NA	NA	NA
VDY80932.1|3532182_3533139_+	putative xanthine dehydrogenase, FAD-binding subunit	NA	NA	NA	NA	NA
VDY80933.1|3533135_3535334_+	putative xanthine dehydrogenase, molybdenum-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
VDY80934.1|3535343_3536300_+	xanthine dehydrogenase accessory factor	NA	NA	NA	NA	NA
VDY80935.1|3536278_3536689_+	transcriptional regulator	NA	NA	NA	NA	NA
VDY80936.1|3536950_3537079_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY80937.1|3537190_3539026_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
VDY80938.1|3539737_3540511_+	Uncharacterised protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
VDY80939.1|3540568_3541123_-	DNA invertase from prophage CP-933H	NA	A0A1S6L009	Salmonella_phage	87.8	9.7e-88
VDY80940.1|3541152_3541626_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	63.8	7.8e-54
VDY80941.1|3541625_3542228_+|tail	tail fiber assembly	tail	Q9MCR5	Enterobacteria_phage	87.7	4.9e-93
VDY80942.1|3542199_3542367_-|tail	tail fiber assembly protein	tail	M1SNQ2	Escherichia_phage	94.5	3.9e-24
VDY80943.1|3542383_3542644_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	97.4	1.0e-39
VDY80944.1|3542664_3543327_-|tail	tail fiber protein	tail	A0A0F7LBW5	Escherichia_phage	65.7	1.6e-65
VDY80945.1|3543330_3543915_-|tail	putative phage tail protein	tail	O22003	Shigella_phage	99.5	4.1e-113
VDY80946.1|3543905_3544964_-|plate	putative phage baseplate protein	plate	M1FQW3	Enterobacteria_phage	98.9	1.6e-200
VDY80947.1|3544950_3545376_-|tail	bacteriophage V tail protein	tail	U5P0R9	Shigella_phage	99.3	2.0e-80
VDY80948.1|3545485_3545782_+	Uncharacterised protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
VDY80949.1|3545699_3545945_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY80950.1|3546057_3546270_+	CPS-53 (KpLE1) prophage protein	NA	U5P4J6	Shigella_phage	100.0	5.6e-20
VDY80951.1|3546335_3547160_+	CPS-53 (KpLE1) prophage protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
VDY80952.1|3547287_3547824_+	CPS-53 (KpLE1) prophage protein	NA	U5P0T3	Shigella_phage	99.4	6.3e-100
VDY80953.1|3547814_3548177_+	CPS-53 (KpLE1) prophage protein	NA	U5P092	Shigella_phage	99.2	1.0e-66
VDY80954.1|3548176_3548482_+	CPS-53 (KpLE1) prophage protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
VDY80955.1|3548708_3549590_+|integrase	prophage integrase	integrase	U5P434	Shigella_phage	99.6	1.6e-148
VDY80956.1|3550077_3551331_-	gamma-glutamyl phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
3551235:3551251	attR	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
VDY80957.1|3551342_3552446_-	gamma-glutamyl kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
VDY80958.1|3552733_3553789_+	outer membrane phosphoporin protein E	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
>prophage 11
LR134075	Escherichia coli strain NCTC9084 genome assembly, chromosome: 1	4601921	3962241	3978963	4601921	transposase,integrase	Shigella_phage(33.33%)	18	3956704:3956717	3982461:3982474
3956704:3956717	attL	CTGCAAAACGAGAA	NA	NA	NA	NA
VDY81343.1|3962241_3962451_-|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	98.6	2.2e-32
VDY81344.1|3962451_3962745_-	IS1 protein InsB	NA	U5P0U6	Shigella_phage	89.0	4.2e-42
VDY81345.1|3963230_3963752_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
VDY81346.1|3963748_3964702_+	iron(III) dicitrate sensor protein	NA	NA	NA	NA	NA
VDY81347.1|3964788_3967113_+	iron(III) dicitrate TonB-dependent receptor	NA	NA	NA	NA	NA
VDY81348.1|3967157_3968060_+	iron-dicitrate transporter substrate-binding subunit	NA	NA	NA	NA	NA
VDY81349.1|3968056_3969055_+	iron(III) dicitrate transport system, permease protein	NA	NA	NA	NA	NA
VDY81350.1|3969051_3970008_+	iron-dicitrate transporter subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
VDY81351.1|3970008_3970776_+	iron(III) dicitrate transport system, ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
VDY81352.1|3971333_3971591_-	KpLE2 phage-like element	NA	NA	NA	NA	NA
VDY81353.1|3971673_3972327_-|transposase	putative transposase subunit	transposase	Q716C2	Shigella_phage	97.2	9.6e-127
VDY81354.1|3972588_3973740_-|transposase	IS30 transposase encoded within prophage CP-933T	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
VDY81355.1|3974032_3974710_+|transposase	IS911 transposase orfB	transposase	Q716C2	Shigella_phage	61.0	1.2e-79
VDY81356.1|3974702_3975275_-|transposase	IS66 family transposase orfB	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.9	4.5e-64
VDY81357.1|3975533_3976799_-|integrase	phage integrase family site specific recombinase	integrase	Q7M297	Enterobacteria_phage	38.0	2.2e-79
VDY81358.1|3977002_3977236_-	Uncharacterised protein	NA	Q38404	Enterobacteria_phage	96.1	3.5e-23
VDY81359.1|3977544_3978120_-	putative prophage DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.4	2.4e-105
VDY81360.1|3978390_3978963_+	prophage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
3982461:3982474	attR	TTCTCGTTTTGCAG	NA	NA	NA	NA
