The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134080	Escherichia coli strain NCTC9082 genome assembly, chromosome: 1	5030213	842131	909799	5030213	tRNA,transposase,protease,integrase	Escherichia_phage(19.05%)	59	846035:846053	909594:909612
VDY92568.1|842131_842329_-|transposase	putative transposase	transposase	NA	NA	NA	NA
VDY92569.1|842721_842928_+	polyketide synthase pksM (fragment)	NA	NA	NA	NA	NA
VDY92570.1|844123_844432_-|transposase	transposase (fragment), IS630 family	transposase	NA	NA	NA	NA
VDY92571.1|844827_845304_+	putative type VI secretion protein	NA	NA	NA	NA	NA
VDY92572.1|845306_846785_+	putative type VI secretion protein	NA	NA	NA	NA	NA
846035:846053	attL	GGGGCGTATTCCATATGGC	NA	NA	NA	NA
VDY92573.1|846794_847301_+	putative type VI secretion protein	NA	NA	NA	NA	NA
VDY92574.1|847310_847733_+	putative type VI secretion protein	NA	NA	NA	NA	NA
VDY92575.1|847725_849528_+	putative type VI secretion protein	NA	NA	NA	NA	NA
VDY92576.1|849518_850451_+	putative type VI secretion protein	NA	NA	NA	NA	NA
VDY92577.1|850463_852446_+	putative type VI secretion protein	NA	A0A077K8Q4	Ralstonia_phage	35.6	2.2e-12
VDY92578.1|852456_852924_+	putative type VI secretion protein	NA	NA	NA	NA	NA
VDY92579.1|852933_853233_+	putative type VI secretion protein	NA	NA	NA	NA	NA
VDY92580.1|853236_854313_+	putative type VI secretion protein	NA	NA	NA	NA	NA
VDY92581.1|854320_854872_+	putative type VI secretion protein	NA	NA	NA	NA	NA
VDY92582.1|854890_856303_+	putative type VI secretion protein	NA	NA	NA	NA	NA
VDY92583.1|856426_856645_+	putative type VI secretion protein	NA	NA	NA	NA	NA
VDY92584.1|856641_857232_+	putative type VI secretion protein	NA	NA	NA	NA	NA
VDY92585.1|857237_860642_+	putative type VI secretion protein	NA	NA	NA	NA	NA
VDY92586.1|860645_863195_+	putative type VI secretion protein	NA	A0A1C3S747	Escherichia_phage	33.9	2.7e-92
VDY92587.1|864216_864603_+|transposase	IS629, transposase orfB, truncation	transposase	Q6H9S6	Enterobacteria_phage	95.3	6.1e-65
VDY92588.1|865159_865309_+	putative type VI secretion protein	NA	NA	NA	NA	NA
VDY92589.1|865292_865412_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY92590.1|865569_865779_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY92591.1|866365_866932_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY92592.1|867410_868565_+	ImpA-related N-terminal family protein	NA	NA	NA	NA	NA
VDY92593.1|869630_869816_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	72.4	2.6e-21
VDY92594.1|869879_871013_+|transposase	transposase, IS110 family protein	transposase	NA	NA	NA	NA
VDY92595.1|871151_871415_+|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	58.6	3.6e-24
VDY92596.1|871996_873130_+|transposase	transposase, IS110 family protein	transposase	NA	NA	NA	NA
VDY92597.1|873358_874807_-|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	59.6	1.0e-141
VDY92598.1|874837_875188_-|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
VDY92599.1|875184_875619_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
VDY92600.1|875727_876159_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.3	2.1e-77
VDY92601.1|876221_876440_+	IS encoded protein	NA	NA	NA	NA	NA
VDY92602.1|876590_880709_-|protease	serine protease (autotransporter)	protease	Q9LA54	Enterobacteria_phage	45.8	0.0e+00
VDY92603.1|881170_881545_-|transposase	putative transposase subunit	transposase	Q716C2	Shigella_phage	98.4	4.0e-69
VDY92604.1|881739_883272_-	reverse transcriptase-like protein from prophage or plasmid	NA	A0A0U4J920	Pseudomonas_phage	31.8	2.8e-44
VDY92605.1|883853_884093_-	IS911 orfA	NA	Q716C2	Shigella_phage	98.3	9.8e-29
VDY92606.1|884409_885561_+|transposase	IS30 transposase encoded within prophage CP-933T	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
VDY92607.1|885480_885831_-|transposase	transposase ORF A, IS3 family	transposase	Q716C1	Shigella_phage	98.9	1.8e-39
VDY92608.1|885900_886194_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY92609.1|886282_889153_-	PstII restriction-modification enzyme Res subunit	NA	NA	NA	NA	NA
VDY92610.1|889155_890784_-	DNA methylase N-4/N-6	NA	A0A0K1LNZ9	Escherichia_phage	42.6	4.6e-85
VDY92611.1|890793_893181_-|protease	putative serine protease	protease	NA	NA	NA	NA
VDY92612.1|893190_894171_-	ATPase	NA	A0A1B2RW50	Lymphocystis_disease_virus	30.2	4.2e-17
VDY92613.1|894196_897046_-	Helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	39.6	2.2e-183
VDY92614.1|897456_898050_+	putative type VI secretion protein	NA	NA	NA	NA	NA
VDY92615.1|898515_898779_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY92616.1|898919_899297_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	99.2	8.4e-67
VDY92617.1|899341_899617_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	2.0e-46
VDY92618.1|900029_901292_-|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	43.1	6.9e-81
VDY92619.1|901670_902147_-	membrane protein YqgA	NA	NA	NA	NA	NA
VDY92620.1|902094_902379_-	membrane protein YqgA	NA	NA	NA	NA	NA
VDY92621.1|902776_904912_+	Ornithine decarboxylase	NA	NA	NA	NA	NA
VDY92622.1|904961_906218_-	nucleoside permease	NA	NA	NA	NA	NA
VDY92623.1|906419_907499_-	membrane-bound lytic murein transglycosylase C	NA	NA	NA	NA	NA
VDY92624.1|907563_907839_-	Fe(2+)-trafficking protein	NA	NA	NA	NA	NA
VDY92625.1|907866_908919_-	adenine DNA glycosylase	NA	NA	NA	NA	NA
VDY92626.1|909079_909799_+|tRNA	tRNA (guanine-N(7)-)-methyltransferase	tRNA	NA	NA	NA	NA
909594:909612	attR	GGGGCGTATTCCATATGGC	NA	NA	NA	NA
>prophage 2
LR134080	Escherichia coli strain NCTC9082 genome assembly, chromosome: 1	5030213	1156736	1163874	5030213	tRNA	Escherichia_phage(87.5%)	8	NA	NA
VDY92867.1|1156736_1157375_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
VDY92868.1|1157371_1158190_-|tRNA	paral putative tRNA synthase	tRNA	A0A077SLJ7	Escherichia_phage	54.2	6.0e-70
VDY92869.1|1158186_1158633_-|tRNA	paral putative tRNA synthase	tRNA	A0A077SLJ7	Escherichia_phage	74.8	7.1e-57
VDY92870.1|1158629_1158914_-	oxidoreductase YgbJ	NA	A0A077SLF7	Escherichia_phage	86.0	6.6e-40
VDY92871.1|1158913_1159537_-	oxidoreductase YgbJ	NA	A0A077SLF7	Escherichia_phage	73.0	2.8e-67
VDY92872.1|1159732_1160500_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
VDY92873.1|1160550_1161207_-	serine/threonine-specific protein phosphatase 2	NA	A0A222YWF0	Escherichia_phage	47.9	1.1e-50
VDY92874.1|1161312_1163874_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 3
LR134080	Escherichia coli strain NCTC9082 genome assembly, chromosome: 1	5030213	1763820	1773261	5030213		Enterobacteria_phage(87.5%)	11	NA	NA
VDY93410.1|1763820_1764747_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
VDY93411.1|1764751_1765483_+	ABC transporter permease	NA	NA	NA	NA	NA
VDY93412.1|1765463_1765571_-	putative inner membrane protein	NA	NA	NA	NA	NA
VDY93413.1|1765630_1766362_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
VDY93414.1|1766583_1768269_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
VDY93415.1|1768265_1768985_+	two-component response-regulatory protein YehT	NA	NA	NA	NA	NA
VDY93416.1|1769031_1769502_+	conserved protein, DUF1456 family	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
VDY93417.1|1769542_1770004_-	lipoprotein yehR	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
VDY93418.1|1770128_1772129_-	zinc finger SWIM domain-containing protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
VDY93419.1|1772125_1772581_-	von Willebrand factor type A domain protein YehP	NA	Q9EYF7	Enterobacteria_phage	98.0	6.3e-77
VDY93420.1|1772568_1773261_-	von Willebrand factor type A domain protein YehP	NA	Q9EYF7	Enterobacteria_phage	86.7	1.9e-64
>prophage 4
LR134080	Escherichia coli strain NCTC9082 genome assembly, chromosome: 1	5030213	2317817	2385315	5030213	transposase,tail,integrase,capsid,coat,head,lysis,portal,protease,terminase	Enterobacteria_phage(40.82%)	75	2325393:2325408	2357939:2357954
VDY93938.1|2317817_2318639_-|protease	putative protease	protease	NA	NA	NA	NA
VDY93939.1|2318914_2319223_-	acid shock protein	NA	NA	NA	NA	NA
VDY93940.1|2319646_2320900_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VDY93941.1|2321006_2321900_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDY93942.1|2322034_2323255_+	protein Mlc (making large colonies protein)	NA	NA	NA	NA	NA
VDY93943.1|2323379_2324075_+	dithiobiotin synthetase	NA	NA	NA	NA	NA
VDY93944.1|2324027_2325284_-	voltage-gated ClC-type chloride channel	NA	NA	NA	NA	NA
2325393:2325408	attL	CTTTAAGAGATAAAAA	NA	NA	NA	NA
VDY93945.1|2325477_2326092_-	anaerobic dimethyl sulfoxide reductase maturation protein (twin-arginine leader-binding protein)	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
VDY93946.1|2326134_2326989_-	putative dimethyl sulfoxide reductase, anchor subunit	NA	NA	NA	NA	NA
VDY93947.1|2326990_2327608_-	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
VDY93948.1|2327618_2330015_-	putative dimethyl sulfoxide reductase, olydopterin dinucleotide binding subunit	NA	A0A077SK27	Escherichia_phage	48.6	8.2e-208
VDY93949.1|2330102_2332529_-	putative dimethyl sulfoxide reductase, oxidoreductase subunit	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
VDY93950.1|2332727_2333033_-	protein	NA	NA	NA	NA	NA
VDY93951.1|2333104_2333851_+	lipoprotein	NA	NA	NA	NA	NA
VDY93952.1|2333853_2334414_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
VDY93953.1|2334448_2334790_-	protein	NA	NA	NA	NA	NA
VDY93954.1|2334924_2335251_+	inner membrane protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
VDY93955.1|2335456_2336671_+	starvation sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
VDY93956.1|2336682_2337702_+	dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.2	7.4e-17
VDY93957.1|2337759_2337870_+	protein, truncated	NA	NA	NA	NA	NA
VDY93958.1|2337889_2339170_-|integrase	defective integrase; Qin prophage	integrase	B6DZ48	Enterobacteria_phage	62.1	3.3e-155
VDY93959.1|2339204_2339441_-	putative excisionase	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
VDY93960.1|2339528_2342000_-	putative exonuclease from phage origin	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
VDY93961.1|2342093_2342285_-	putative prophage protein	NA	NA	NA	NA	NA
VDY93962.1|2342281_2342470_-	division inhibition protein	NA	NA	NA	NA	NA
VDY93963.1|2342972_2343173_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY93964.1|2343141_2343507_-	ybl81	NA	NA	NA	NA	NA
VDY93965.1|2343518_2343671_-	ydfA	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
VDY93966.1|2343863_2344322_-	transcriptional repressor DicA	NA	I6PD69	Cronobacter_phage	46.2	2.8e-24
VDY93967.1|2344348_2344576_+	DNA-binding transcriptional regulator DicC	NA	NA	NA	NA	NA
VDY93968.1|2344559_2345081_+	YdfX	NA	NA	NA	NA	NA
VDY93969.1|2345061_2346027_+	ybl78	NA	U5P0A0	Shigella_phage	60.2	2.2e-55
VDY93970.1|2346067_2346490_+	putative prophage protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
VDY93971.1|2346486_2346843_+	putative methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
VDY93972.1|2347995_2348175_+	membrane protein	NA	NA	NA	NA	NA
VDY93973.1|2348509_2349823_+|integrase,transposase	putative integrase/transposase	integrase,transposase	NA	NA	NA	NA
VDY93974.1|2350259_2350592_-	Qin prophage protein	NA	NA	NA	NA	NA
VDY93975.1|2351124_2351364_+	antitoxin of the RelE-RelB toxin-antitoxin system and transcriptional repressor of relBEF	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
VDY93976.1|2351363_2351651_+	toxin of the RelE-RelB toxin-antitoxin system	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
VDY93977.1|2351722_2351878_+	putative host cell-killing modulation protein	NA	A0A0U2QV81	Escherichia_phage	94.1	2.5e-17
VDY93978.1|2352094_2352346_+	putative prophage protein	NA	NA	NA	NA	NA
VDY93979.1|2352692_2353742_+	putative prophage protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
VDY93980.1|2353755_2354508_+	lambdoid prophage Qin antitermination protein Q-like protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
VDY93981.1|2354929_2355142_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
VDY93982.1|2356259_2356379_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY93983.1|2356420_2356627_+|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	94.1	4.5e-30
VDY93984.1|2356631_2356943_+	Qin prophage protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
VDY93985.1|2356939_2357473_+	prophage lysozyme (endolysin)	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
VDY93986.1|2357469_2357967_+	Qin prophage protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
2357939:2357954	attR	CTTTAAGAGATAAAAA	NA	NA	NA	NA
VDY93987.1|2359215_2359389_+	GnsA/GnsB family transcriptional regulator	NA	NA	NA	NA	NA
VDY93988.1|2359540_2359951_-	Qin prophage	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
VDY93989.1|2360630_2361176_+	prophage qsr' DNA packaging protein NU1-like protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
VDY93990.1|2361150_2363076_+|terminase	phage terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
VDY93991.1|2363072_2363279_+|head,tail	head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
VDY93992.1|2363275_2364877_+|capsid,portal	phage portal protein (minor capsid protein)	capsid,portal	A0A0K2FJC0	Enterobacteria_phage	99.4	1.0e-310
VDY93993.1|2364857_2366177_+|capsid	minor capsid protein C from bacteriophage origin	capsid	A0A0K2FI53	Enterobacteria_phage	99.1	5.6e-235
VDY93994.1|2366186_2366519_+	Head decoration protein from bacteriophage origin	NA	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
VDY93995.1|2366574_2367600_+|head,coat	phage major head protein (major coat protein)	head,coat	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
VDY93996.1|2367641_2368037_+	DNA packaging protein from bacteriophage origin	NA	A0A2R9YJP4	Escherichia_phage	92.4	1.6e-55
VDY93997.1|2368048_2368402_+|capsid	minor capsid protein	capsid	A0A0K2FJB7	Enterobacteria_phage	99.1	4.4e-62
VDY93998.1|2368413_2368992_+|tail	Minor tail protein Z (GpZ)	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
VDY93999.1|2368988_2369384_+|tail	phage minor tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	2.9e-70
VDY94000.1|2369391_2370132_+|tail	Major tail protein V	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	4.0e-129
VDY94001.1|2370147_2370570_+|tail	phage minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	95.0	1.5e-69
VDY94002.1|2370551_2370986_+|tail	minor tail protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
VDY94003.1|2370978_2373558_+|tail	putative phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	95.5	0.0e+00
VDY94004.1|2373554_2373884_+|tail	Minor tail protein M	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
VDY94005.1|2373883_2374582_+|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.4e-131
VDY94006.1|2374731_2375331_+|tail	tail component	tail	C6ZCZ3	Enterobacteria_phage	98.5	3.6e-120
VDY94007.1|2375327_2375900_+|tail	phage tail assembly protein	tail	A0A0K2FJB0	Escherichia_phage	98.9	3.3e-83
VDY94008.1|2375960_2379374_+|tail	tail component of prophage CP-933K	tail	K7PKJ2	Enterobacteria_phage	96.7	0.0e+00
VDY94009.1|2379443_2380043_+	outer membrane precursor Lom	NA	A0A291AWV3	Escherichia_phage	99.0	3.3e-110
VDY94010.1|2380064_2383502_+|tail	phage side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	6.4e-12
VDY94011.1|2384174_2384765_-	putative DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
VDY94012.1|2385081_2385315_-	Qin prophage DNA-binding transcriptional regulator	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
>prophage 5
LR134080	Escherichia coli strain NCTC9082 genome assembly, chromosome: 1	5030213	2587247	2640542	5030213	tail,integrase,coat,lysis,tRNA,protease,terminase	Escherichia_phage(55.1%)	64	2605879:2605895	2646144:2646160
VDY94190.1|2587247_2590319_-|tail	tail fiber protein	tail	U5N099	Enterobacteria_phage	82.1	1.9e-68
VDY94191.1|2590383_2590983_-	outer membrane precursor Lom	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
VDY94192.1|2591052_2593917_-|tail	tail component of prophage CP-933K	tail	K7PKJ2	Enterobacteria_phage	96.9	0.0e+00
VDY94193.1|2593954_2594467_-	Host specificity protein J of prophage	NA	A0A291AWT4	Escherichia_phage	99.4	1.9e-82
VDY94194.1|2594527_2595076_-	Tail assembly protein I from prophage	NA	K7PH50	Enterobacteria_phage	97.8	5.8e-93
VDY94195.1|2595072_2595672_-|tail	tail component	tail	K7PLW1	Enterobacteria_phage	96.5	2.0e-118
VDY94196.1|2595821_2596520_-|tail	phage minor tail protein	tail	A0A1B5FP81	Escherichia_phage	95.7	8.4e-129
VDY94197.1|2596519_2596816_-|tail	putative phage minor tail protein	tail	H6WZM2	Escherichia_phage	52.0	1.8e-24
VDY94198.1|2596850_2600084_-|tail	putative phage tail length tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.5	1.9e-111
VDY94199.1|2600557_2601007_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY94200.1|2601067_2602030_-	Uncharacterised protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
VDY94201.1|2602056_2602449_-	phage protein	NA	NA	NA	NA	NA
VDY94202.1|2602445_2602826_-	Uncharacterised protein	NA	A0A059VF88	Pseudomonas_phage	44.4	6.5e-19
VDY94203.1|2602826_2603210_-	Uncharacterised protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
VDY94204.1|2603209_2603605_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY94205.1|2603608_2603785_-	Uncharacterised protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
VDY94206.1|2603827_2604967_-|coat	P22 coat protein - gene protein 5	coat	G8C7P7	Escherichia_phage	75.0	7.4e-159
VDY94207.1|2605065_2605830_-	Uncharacterised protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
2605879:2605895	attL	GATCGCAGCAATAAAAA	NA	NA	NA	NA
VDY94208.1|2605934_2607050_-	phage protein	NA	I6PD76	Cronobacter_phage	54.4	1.2e-113
VDY94209.1|2607030_2608437_-	Uncharacterised protein	NA	G8C7P4	Escherichia_phage	69.0	1.4e-186
VDY94210.1|2608439_2609741_-|terminase	phage terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.8	1.6e-149
VDY94211.1|2609721_2610816_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.9	2.0e-113
VDY94212.1|2610819_2611029_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY94213.1|2611006_2611939_-	Uncharacterised protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.9e-83
VDY94214.1|2611931_2612723_-	ParB-like nuclease	NA	R4TG31	Halovirus	40.2	3.7e-48
VDY94215.1|2612860_2614285_-	Rac prophage; potassium transporter subunit	NA	NA	NA	NA	NA
VDY94216.1|2614455_2614920_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	92.8	5.3e-71
VDY94217.1|2614916_2615414_-	phage lysozome	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
VDY94218.1|2615413_2615629_-|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
VDY94219.1|2615880_2616276_-	tolA protein (fragment) of prophage	NA	NA	NA	NA	NA
VDY94220.1|2616426_2616855_-	TolA protein (fragment) of prophage	NA	NA	NA	NA	NA
VDY94221.1|2617633_2617771_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY94222.1|2617899_2618442_-	antitermination protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
VDY94223.1|2618438_2618729_-	phage protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
VDY94224.1|2618728_2619328_-	phage protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
VDY94225.1|2619626_2619800_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY94226.1|2619744_2622009_-|protease	putative serine protease	protease	NA	NA	NA	NA
VDY94227.1|2621983_2623138_-	ATPase	NA	A0A2H4UTU5	Bodo_saltans_virus	31.3	1.9e-13
VDY94228.1|2623113_2623335_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY94229.1|2623331_2623763_-	putative prophage protein	NA	A0A0U2QQN3	Escherichia_phage	92.7	4.4e-64
VDY94230.1|2623778_2624540_-	transcription regulatory protein	NA	A0A0U2SAW4	Escherichia_phage	87.0	1.7e-114
VDY94231.1|2624562_2625309_-	putative phage DNA replication protein	NA	V5UQI5	Shigella_phage	80.5	1.1e-113
VDY94232.1|2625315_2626173_-	phage protein	NA	A0A0U2RT81	Escherichia_phage	83.9	1.8e-69
VDY94233.1|2626185_2626608_-	Protein of uncharacterised function (DUF1019)	NA	A0A0U2RXZ9	Escherichia_phage	95.7	6.9e-70
VDY94234.1|2626604_2626859_-	putative phage regultory protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
VDY94235.1|2626938_2627358_+	transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
VDY94236.1|2627648_2627783_+	Rac prophage protein	NA	NA	NA	NA	NA
VDY94237.1|2627793_2627949_+	Rac prophage; predicted protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
VDY94238.1|2627945_2628557_-	prophage CP-933R superinfection exclusion protein	NA	NA	NA	NA	NA
VDY94239.1|2628875_2629097_+	FtsZ inhibitor protein	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
VDY94240.1|2629096_2629267_+	Rac prophage; zinc-binding protein	NA	A0A0U2SHB5	Escherichia_phage	73.2	1.6e-17
VDY94241.1|2629341_2629617_+	putative bacteriophage protein	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
VDY94242.1|2629718_2632319_+	exonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	2.0e-247
VDY94243.1|2632311_2632581_+	recombination and repair protein RecT	NA	A0A1P8DTF2	Proteus_phage	69.9	3.8e-21
VDY94244.1|2632681_2633122_+	recombination and repair protein RecT	NA	A0A1P8DTF2	Proteus_phage	69.4	1.0e-52
VDY94245.1|2633364_2633574_+	gydaC	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
VDY94246.1|2633652_2633868_+	excisionase	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
VDY94247.1|2633869_2634616_+|integrase	phage integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.6	1.6e-122
VDY94248.1|2634615_2635104_+|integrase	phage integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	3.1e-90
VDY94249.1|2635155_2636091_+|tRNA	C32 tRNA thiolase	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
VDY94250.1|2636220_2637594_-	ATP-independent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
VDY94251.1|2637623_2637797_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY94252.1|2638071_2639055_-	zinc transport protein	NA	NA	NA	NA	NA
VDY94253.1|2639309_2640542_+	putative signaling protein	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2646144:2646160	attR	TTTTTATTGCTGCGATC	NA	NA	NA	NA
>prophage 6
LR134080	Escherichia coli strain NCTC9082 genome assembly, chromosome: 1	5030213	2717084	2786813	5030213	tail,integrase,capsid,head,lysis,protease,terminase	Enterobacteria_phage(39.58%)	76	2730862:2730889	2778637:2778664
VDY94330.1|2717084_2718134_-|protease	protease	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
VDY94331.1|2718352_2719111_+	putative short chain dehydrogenase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	8.8e-07
VDY94332.1|2719107_2719698_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
VDY94333.1|2719737_2720610_-	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
VDY94334.1|2720710_2721331_-	putative RNA binding protein	NA	NA	NA	NA	NA
VDY94335.1|2721327_2722209_-	putative phosphoesterase	NA	NA	NA	NA	NA
VDY94336.1|2722482_2724045_+	anthranilate synthase component I	NA	NA	NA	NA	NA
VDY94337.1|2724044_2725640_+	anthranilate synthase component II [includes: glutamine amidotransferase; anthranilate phosphoribosyltransferase]	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
VDY94338.1|2725643_2727002_+	tryptophan biosynthesis protein [includes: indole-3-glycero phosphate synthase; N-(5'-phospho ribosyl)anthranilate isomerase]	NA	A0A0P0IR83	Acinetobacter_phage	40.7	1.1e-36
VDY94339.1|2727013_2728207_+	tryptophan synthase	NA	NA	NA	NA	NA
VDY94340.1|2728206_2729013_+	tryptophan synthase alpha chain	NA	NA	NA	NA	NA
VDY94341.1|2729393_2729573_+	protein	NA	NA	NA	NA	NA
VDY94342.1|2729658_2730159_+	YciF protein	NA	NA	NA	NA	NA
VDY94343.1|2730204_2730711_+	protein YciE	NA	NA	NA	NA	NA
2730862:2730889	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
VDY94344.1|2731199_2731370_-|tail	tail component	tail	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
VDY94345.1|2731822_2732479_+	methylase	NA	NA	NA	NA	NA
VDY94346.1|2733117_2736132_-|tail	Side tail fiber protein from bacteriophage origin	tail	A0A0K2FIZ6	Escherichia_phage	55.2	5.9e-54
VDY94347.1|2736283_2736883_-	putative prophage-encoded outer membrane protein	NA	Q9EV15	Enterobacteria_phage	96.5	2.0e-107
VDY94348.1|2736950_2740430_-	Host specificity protein J of prophage	NA	A0A291AWT4	Escherichia_phage	89.6	0.0e+00
VDY94349.1|2740496_2740751_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY94350.1|2740907_2741450_-|tail	tail component of prophage CP-933K	tail	A0A291AWV5	Escherichia_phage	82.4	1.9e-75
VDY94351.1|2741446_2742046_-|tail	putative tail fiber component K of prophage	tail	K7PLW1	Enterobacteria_phage	94.5	4.8e-117
VDY94352.1|2742194_2742893_-|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
VDY94353.1|2742892_2743222_-|tail	Minor tail protein M	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
VDY94354.1|2743221_2745792_-|tail	Minor tail protein precursor H	tail	A0A2R9YJM8	Escherichia_phage	85.4	0.0e+00
VDY94355.1|2745772_2746186_-|tail	phage minor tail protein	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
VDY94356.1|2746212_2746644_-|tail	tail component of prophage CP-933O	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	1.8e-41
VDY94357.1|2746657_2747410_-|tail	phage major tail protein	tail	Q687F6	Enterobacteria_phage	97.2	3.0e-132
VDY94358.1|2747417_2747813_-|tail	phage minor tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
VDY94359.1|2747809_2748385_-|tail	phage minor tail protein	tail	A0A2R9YJK4	Escherichia_phage	56.8	2.1e-48
VDY94360.1|2748400_2748754_-|capsid	Tail attachment protein (Minor capsid protein FII)	capsid	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
VDY94361.1|2748746_2749130_-	phage protein	NA	NA	NA	NA	NA
VDY94362.1|2749181_2750210_-|head	phage major head protein	head	C6ZCY2	Enterobacteria_phage	62.2	2.3e-114
VDY94363.1|2750267_2750615_-|head	phage head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
VDY94364.1|2750651_2752157_-|head,tail	phage head-tail preconnector protein [contains: scaffold protein]	head,tail	A0A2I6TC87	Escherichia_phage	53.3	4.6e-100
VDY94365.1|2752146_2753739_-|capsid	capsid protein of prophage	capsid	K7P6U7	Enterobacteria_phage	60.9	1.4e-184
VDY94366.1|2753735_2753942_-|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	56.9	7.9e-11
VDY94367.1|2753925_2755854_-|terminase	DNA packaging protein of prophage; terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	66.6	7.4e-260
VDY94368.1|2755825_2756374_-	Terminase small subunit (gp1)	NA	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
VDY94369.1|2757087_2757228_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY94370.1|2757578_2758046_-	Endopeptidase (Lysis protein) from bacteriophage origin	NA	Q9ZXB6	Enterobacteria_phage	90.3	9.1e-71
VDY94371.1|2758344_2758878_-	membrane-associated lysozyme; Qin prophage	NA	Q6H9V6	Enterobacteria_phage	94.4	2.4e-99
VDY94372.1|2758983_2759256_+	ybl58	NA	NA	NA	NA	NA
VDY94373.1|2759221_2759566_-	putative prophage protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
VDY94374.1|2759570_2759786_-|lysis	putative lysis protein S	lysis	G9L6J5	Escherichia_phage	100.0	9.0e-34
VDY94375.1|2759936_2761790_-	phage protein	NA	Q08JA2	Stx2-converting_phage	88.1	0.0e+00
VDY94376.1|2763064_2764114_-	DNA methylase	NA	A0A0N7KZF8	Stx2-converting_phage	96.0	2.3e-199
VDY94377.1|2764264_2764462_-	lipoprotein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
VDY94378.1|2764688_2765510_-	phage antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	1.2e-81
VDY94379.1|2765506_2765887_-	Holliday juction resolvase	NA	V5URS4	Shigella_phage	62.7	1.2e-33
VDY94380.1|2765887_2766943_-	phage protein	NA	A0A291AWV9	Escherichia_phage	48.4	5.2e-90
VDY94381.1|2767777_2768443_-	putative prophage protein	NA	NA	NA	NA	NA
VDY94382.1|2768617_2769043_-	phage protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
VDY94383.1|2769058_2769829_-	putative phage regulatory protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
VDY94384.1|2769850_2770597_-	putative replication protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
VDY94385.1|2770603_2770942_-	putative prophage replication protein	NA	U5P0A0	Shigella_phage	54.2	3.4e-35
VDY94386.1|2770880_2771567_-	putative prophage replication protein	NA	Q8W642	Enterobacteria_phage	49.6	4.6e-23
VDY94387.1|2771589_2772015_-	putative prophage protein	NA	NA	NA	NA	NA
VDY94388.1|2771998_2772280_-	putative antirepressor protein Cro	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
VDY94389.1|2772380_2772800_+	putative phage repressor protein CI	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
VDY94390.1|2772984_2773221_+	putative prophage protein	NA	M4QQ57	Salicola_phage	53.2	4.6e-07
VDY94391.1|2773222_2773351_+	putative prophage protein	NA	NA	NA	NA	NA
VDY94392.1|2773380_2773599_+	putative prophage protein	NA	NA	NA	NA	NA
VDY94393.1|2773602_2773767_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY94394.1|2774167_2774356_+	division inhibition protein dicB	NA	NA	NA	NA	NA
VDY94395.1|2774352_2774544_+	putative prophage protein	NA	NA	NA	NA	NA
VDY94396.1|2774637_2777079_+	Exodeoxyribonuclease VIII from bacteriophage origin	NA	V5UQJ3	Shigella_phage	46.2	1.0e-112
VDY94397.1|2777369_2778500_+|integrase	integrase for prophage CP-933O	integrase	O21940	Phage_21	51.4	3.4e-103
VDY94398.1|2778545_2779184_-	outer membrane protein W	NA	NA	NA	NA	NA
2778637:2778664	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
VDY94399.1|2779540_2780284_+	membrane protein YciC	NA	NA	NA	NA	NA
VDY94400.1|2780313_2780853_+	putative intracellular septation protein	NA	NA	NA	NA	NA
VDY94401.1|2780957_2781356_+	putative acyl-coA thioester hydrolase	NA	NA	NA	NA	NA
VDY94402.1|2781395_2782151_-	transport protein TonB	NA	NA	NA	NA	NA
VDY94403.1|2782205_2783726_+	recombinase	NA	NA	NA	NA	NA
VDY94404.1|2783758_2784529_-	Uncharacterised protein	NA	A0A0F6TIY9	Escherichia_coli_O157_typing_phage	67.8	1.8e-76
VDY94405.1|2784692_2786813_-|tail	phage tail tape measure protein	tail	A0A1B1PD82	Escherichia_phage	25.7	3.3e-51
>prophage 7
LR134080	Escherichia coli strain NCTC9082 genome assembly, chromosome: 1	5030213	3003744	3069582	5030213	transposase,protease,integrase	Stx2-converting_phage(25.93%)	60	3041599:3041615	3070057:3070073
VDY94628.1|3003744_3003834_-|transposase	IS66 transposase	transposase	NA	NA	NA	NA
VDY94629.1|3003830_3004256_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	89.7	1.5e-43
VDY94630.1|3004309_3004558_+|transposase	transposase	transposase	Q6H9S3	Enterobacteria_phage	87.8	3.2e-35
VDY94631.1|3004815_3007011_-	Ferric aerobactin receptor precursor	NA	NA	NA	NA	NA
VDY94632.1|3007016_3008354_-	L-lysine 6-monooxygenase (Lysine N(6)-hydroxylase)	NA	NA	NA	NA	NA
VDY94633.1|3008350_3010093_-	Aerobactin siderophore biosynthesis protein	NA	NA	NA	NA	NA
VDY94634.1|3010092_3011040_-	aerobactin siderophore biosynthesis protein, N(6)-hydroxylysine acetylase	NA	NA	NA	NA	NA
VDY94635.1|3011040_3012765_-	aerobactin siderophore biosynthesis protein	NA	NA	NA	NA	NA
VDY94636.1|3012900_3014094_+	membrane transport protein, major facilitator superfamily	NA	NA	NA	NA	NA
VDY94637.1|3015660_3017184_+	reverse transcriptase-like protein from prophage or plasmid	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
VDY94638.1|3017375_3017747_+|transposase	IS629, transposase orfB, truncation	transposase	Q6H9S3	Enterobacteria_phage	99.2	1.6e-65
VDY94639.1|3017628_3018129_-	BfpM-like protein	NA	Q9EYF6	Enterobacteria_phage	96.4	4.6e-28
VDY94640.1|3018444_3019089_-	putative SpnT protein	NA	NA	NA	NA	NA
VDY94641.1|3019457_3020096_-	ParB-like nuclease	NA	A0A0F7L444	uncultured_marine_virus	52.5	3.0e-56
VDY94642.1|3020080_3021313_-	putative phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.1	5.0e-60
VDY94643.1|3021813_3024495_-	putative UvrD/REP helicase-like protein	NA	NA	NA	NA	NA
VDY94644.1|3024735_3025782_-	potra domain, shlb-type family	NA	NA	NA	NA	NA
VDY94645.1|3026456_3026648_+	phage protein	NA	NA	NA	NA	NA
VDY94646.1|3026700_3026934_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY94647.1|3027029_3027653_-	putative DNA-binding protein	NA	NA	NA	NA	NA
VDY94648.1|3027741_3028251_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY94649.1|3028708_3029167_+	membraneprotein	NA	NA	NA	NA	NA
VDY94650.1|3029808_3030102_+	IS1 protein InsB	NA	U5P0U6	Shigella_phage	92.8	8.3e-46
VDY94651.1|3030520_3031645_-	glucosyl-transferase	NA	NA	NA	NA	NA
VDY94652.1|3032374_3032572_-	transcriptional regulator	NA	NA	NA	NA	NA
VDY94653.1|3033136_3033409_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY94654.1|3033497_3033677_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY94655.1|3033728_3033923_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY94656.1|3034283_3034412_+	IS150 conserved protein InsB	NA	NA	NA	NA	NA
VDY94657.1|3035691_3035910_-	Putative ShiA	NA	NA	NA	NA	NA
VDY94658.1|3037361_3039452_+	bifunctional enterobactin receptor/adhesin protein	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
VDY94659.1|3040384_3040816_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.3	3.5e-77
VDY94660.1|3041007_3041433_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	97.9	4.4e-48
VDY94661.1|3041429_3041780_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	65.5	1.1e-39
3041599:3041615	attL	TTTGGGCTGATGCTGAT	NA	NA	NA	NA
VDY94662.1|3041810_3043379_+|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	59.7	2.8e-140
VDY94663.1|3043488_3044622_-|transposase	transposase, IS110 family protein	transposase	NA	NA	NA	NA
VDY94664.1|3044922_3045270_+|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	98.3	3.3e-62
VDY94665.1|3045586_3049678_-|protease	secreted autotransporter serine protease	protease	Q9LA58	Enterobacterial_phage	44.6	2.0e-310
VDY94666.1|3050274_3050640_+|transposase	transposase	transposase	Q76S41	Shigella_phage	99.2	1.3e-59
VDY94667.1|3050597_3051476_+	IS2 element protein	NA	Q9ZXG3	Shigella_phage	94.4	6.8e-160
VDY94668.1|3051494_3051710_-|transposase	IS1, transposase orfB	transposase	A0A0U2RK18	Escherichia_phage	95.8	5.0e-32
VDY94669.1|3051916_3052189_-	IS1 InsA protein	NA	A0A0U2RK18	Escherichia_phage	98.8	7.9e-43
VDY94670.1|3053009_3053255_-	Transposase	NA	NA	NA	NA	NA
VDY94671.1|3053943_3054141_-|transposase	putative transposase	transposase	Q6H9S5	Enterobacteria_phage	72.2	2.0e-16
VDY94672.1|3054428_3055001_-	IS150 conserved protein InsB	NA	A0A1B1P773	Bacillus_phage	49.4	3.8e-47
VDY94673.1|3055136_3055535_-|transposase	ISRSO11-transposase orfA protein	transposase	NA	NA	NA	NA
VDY94674.1|3055600_3056005_+|transposase	putative transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	93.3	2.4e-64
VDY94675.1|3056001_3056265_+	prophage CP-933O IS protein	NA	A0A0P0ZDM8	Stx2-converting_phage	98.8	4.1e-44
VDY94676.1|3056294_3056642_+|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	96.5	1.7e-61
VDY94677.1|3056708_3056897_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY94678.1|3056914_3059275_-	putative helicase	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.0	6.9e-34
VDY94679.1|3059429_3059993_-	Protein of uncharacterised function (DUF3296)	NA	NA	NA	NA	NA
VDY94680.1|3061368_3063204_-	membrane protein	NA	NA	NA	NA	NA
VDY94681.1|3063304_3063592_+	regulatory protein	NA	NA	NA	NA	NA
VDY94682.1|3063563_3065093_+	CP4-57 prophage protein	NA	NA	NA	NA	NA
VDY94683.1|3065262_3066480_-|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.7	5.0e-44
VDY94684.1|3067027_3068014_-	inner membrane protein	NA	NA	NA	NA	NA
VDY94685.1|3068010_3068334_-	malonyl CoA-ACP transacylase	NA	NA	NA	NA	NA
VDY94686.1|3068419_3068719_+|transposase	transposase	transposase	NA	NA	NA	NA
VDY94687.1|3068715_3069582_+|transposase	IS3 element transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
3070057:3070073	attR	TTTGGGCTGATGCTGAT	NA	NA	NA	NA
>prophage 8
LR134080	Escherichia coli strain NCTC9082 genome assembly, chromosome: 1	5030213	3233887	3242738	5030213	tRNA,protease	Bacillus_phage(16.67%)	8	NA	NA
VDY94828.1|3233887_3235609_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
VDY94829.1|3235650_3236355_+|tRNA	leucyl/phenylalanyl-tRNA-protein transferase	tRNA	NA	NA	NA	NA
VDY94830.1|3236639_3236858_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
VDY94831.1|3237543_3238689_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	48.0	1.7e-94
VDY94832.1|3238651_3239821_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A1C3S747	Escherichia_phage	42.0	8.1e-68
VDY94833.1|3239851_3240172_-|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
VDY94834.1|3240494_3240719_+	stationary phase/starvation inducible regulatory protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
VDY94835.1|3240791_3242738_-	macrolide export ATP-binding/permease protein	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
>prophage 9
LR134080	Escherichia coli strain NCTC9082 genome assembly, chromosome: 1	5030213	3628006	3690871	5030213	tRNA,protease	Bacillus_phage(20.0%)	57	NA	NA
VDY95180.1|3628006_3628600_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
VDY95181.1|3628628_3629399_+	putative oxidoreductase with NAD(P)-binding Rossmann-fold domain	NA	NA	NA	NA	NA
VDY95182.1|3629459_3630314_+	thioredoxin-like protein	NA	NA	NA	NA	NA
VDY95183.1|3630376_3631156_-	metal resistance protein	NA	NA	NA	NA	NA
VDY95184.1|3631142_3631820_-	ABC transporter ATP-binding protein YbbL	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
VDY95185.1|3631965_3632883_+|protease	protease, membrane anchored	protease	NA	NA	NA	NA
VDY95186.1|3632879_3633338_+	nodulation efficiency family protein	NA	NA	NA	NA	NA
VDY95187.1|3633338_3633746_-	DNA-binding transcriptional regulator CueR	NA	NA	NA	NA	NA
VDY95188.1|3633870_3635163_-	putative amino acid permease	NA	NA	NA	NA	NA
VDY95189.1|3635165_3636098_-	glutaminase 1	NA	NA	NA	NA	NA
VDY95190.1|3636359_3638864_+	copper-transporting P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.4	3.8e-115
VDY95191.1|3639078_3639474_-	XRE family plasmid maintenance system antidote protein	NA	A0A222YWD7	Escherichia_phage	73.6	5.9e-39
VDY95192.1|3640555_3641035_+|tRNA	protein YbaK containing prolyl-tRNA synthetase associated domain	tRNA	NA	NA	NA	NA
VDY95193.1|3641071_3642724_-	protein UshA precursor [includes: UDP-sugar hydrolase; 5'-nucleotidase]	NA	NA	NA	NA	NA
VDY95194.1|3642941_3644162_+	fosmidomycin resistance protein	NA	NA	NA	NA	NA
VDY95195.1|3644399_3646076_+	putative transport protein	NA	NA	NA	NA	NA
VDY95196.1|3646208_3647513_-	inosine-guanosine kinase	NA	NA	NA	NA	NA
VDY95197.1|3647664_3648624_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.7	2.9e-15
VDY95198.1|3648620_3649583_-	ferrochelatase	NA	NA	NA	NA	NA
VDY95199.1|3649714_3650419_-	adenylate kinase	NA	NA	NA	NA	NA
VDY95200.1|3650539_3652414_-	chaperone (heat shock protein)	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
VDY95201.1|3652523_3653129_-	recombination and repair protein RecR	NA	NA	NA	NA	NA
VDY95202.1|3653128_3653458_-	putative cytoplasmic protein	NA	NA	NA	NA	NA
VDY95203.1|3655570_3656122_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
VDY95204.1|3656296_3656653_-	inner membrane protein	NA	NA	NA	NA	NA
VDY95205.1|3656722_3657250_+	primosomal replication protein N	NA	NA	NA	NA	NA
VDY95206.1|3657263_3657425_+	small protein involved in the cell envelope stress response	NA	NA	NA	NA	NA
VDY95207.1|3657636_3660999_-	potassium efflux protein	NA	NA	NA	NA	NA
VDY95208.1|3661126_3661774_-	acrAB operon repressor	NA	NA	NA	NA	NA
VDY95209.1|3661915_3663109_+	acriflavin resistance protein A	NA	NA	NA	NA	NA
VDY95210.1|3663131_3666281_+	acriflavin resistance protein B	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
VDY95211.1|3666826_3667201_+	putative cytoplasmic protein	NA	NA	NA	NA	NA
VDY95212.1|3667226_3667445_+	hemolysin expression-modulating protein	NA	NA	NA	NA	NA
VDY95213.1|3667615_3668167_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
VDY95214.1|3668282_3668753_+	inner membrane protein	NA	NA	NA	NA	NA
VDY95215.1|3668916_3670467_+	putative signal transduction protein	NA	NA	NA	NA	NA
VDY95216.1|3670508_3670862_-	RNA signal recognition particle 4.5S RNA	NA	NA	NA	NA	NA
VDY95217.1|3671240_3671552_+	methylated DNA-protein cysteine alkyltransferase	NA	NA	NA	NA	NA
VDY95218.1|3671582_3672155_-	putative lipoprotein	NA	NA	NA	NA	NA
VDY95219.1|3672372_3673233_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
VDY95220.1|3673281_3673461_-	ammonia channel precursor (ammonia transporter)	NA	NA	NA	NA	NA
VDY95221.1|3673471_3674569_-	ammonia channel precursor (ammonia transporter)	NA	NA	NA	NA	NA
VDY95222.1|3674598_3674937_-	glutamine synthetase	NA	NA	NA	NA	NA
VDY95223.1|3675117_3676899_-	multidrug ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.4e-42
VDY95224.1|3676891_3678664_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	29.1	2.6e-49
VDY95225.1|3678693_3679152_-	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
VDY95226.1|3679304_3680123_-	putative hydrolase	NA	NA	NA	NA	NA
VDY95227.1|3680222_3681923_+	bacterial extracellular solute-binding protein, family 5	NA	NA	NA	NA	NA
VDY95228.1|3681987_3682683_+	queuosine biosynthesis protein QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
VDY95229.1|3682734_3683133_-	thioesterase protein YbaW	NA	NA	NA	NA	NA
VDY95230.1|3683238_3683610_-	putative DNA uptake protein	NA	NA	NA	NA	NA
VDY95231.1|3683760_3685632_-	peptidyl-prolyl cis-trans isomerase D	NA	NA	NA	NA	NA
VDY95232.1|3685823_3686096_-	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
VDY95233.1|3686304_3686718_-|protease	DNA-binding ATP-dependent protease La	protease	A0A0R6PGP8	Moraxella_phage	61.3	1.5e-37
VDY95234.1|3686689_3688660_-|protease	DNA-binding ATP-dependent protease La	protease	A0A0R6PGP8	Moraxella_phage	50.4	1.5e-178
VDY95235.1|3688847_3690122_-|protease	ATP-dependent specificity component of ClpP serine protease	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
VDY95236.1|3690247_3690871_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 10
LR134080	Escherichia coli strain NCTC9082 genome assembly, chromosome: 1	5030213	4289854	4296241	5030213	transposase	Stx2-converting_phage(83.33%)	7	NA	NA
VDY95773.1|4289854_4290235_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	97.6	2.3e-64
VDY95774.1|4290231_4290579_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	98.3	1.4e-60
VDY95775.1|4290628_4292014_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.1	2.2e-258
VDY95776.1|4292252_4293611_-	Uncharacterized protein conserved in bacteria	NA	NA	NA	NA	NA
VDY95777.1|4293821_4295438_-|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.9	8.6e-169
VDY95778.1|4295468_4295819_-|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	66.4	2.8e-40
VDY95779.1|4295815_4296241_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	97.9	4.4e-48
>prophage 11
LR134080	Escherichia coli strain NCTC9082 genome assembly, chromosome: 1	5030213	4412525	4455232	5030213	transposase,integrase	Stx2-converting_phage(40.0%)	40	4410463:4410477	4417244:4417258
4410463:4410477	attL	GCCCTTCTGGCTGTG	NA	NA	NA	NA
VDY95885.1|4412525_4413707_+|integrase	putative prophage integrase	integrase	Q7M297	Enterobacteria_phage	47.9	2.2e-97
VDY95886.1|4413989_4414619_+	putative response regulator	NA	NA	NA	NA	NA
VDY95887.1|4414618_4416160_+	putative sensor histidine protein kinase (uhpB-like)	NA	NA	NA	NA	NA
VDY95888.1|4416244_4417549_+	putative regulatory protein	NA	NA	NA	NA	NA
4417244:4417258	attR	GCCCTTCTGGCTGTG	NA	NA	NA	NA
VDY95889.1|4417545_4418577_+	putative periplasmic ferric iron-binding protein	NA	NA	NA	NA	NA
VDY95890.1|4418645_4420724_+	permease component of transport system for ferric iron	NA	NA	NA	NA	NA
VDY95891.1|4420735_4421782_+	Fe(3+) ions import ATP-binding protein fbpC	NA	G3M9Y6	Bacillus_virus	38.2	1.4e-34
VDY95892.1|4422477_4422783_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY95893.1|4422871_4423051_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY95894.1|4423102_4423297_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY95895.1|4423639_4423768_+	IS150 conserved protein InsB	NA	NA	NA	NA	NA
VDY95896.1|4425054_4425273_-	Putative ShiA	NA	NA	NA	NA	NA
VDY95897.1|4426725_4427826_+	bifunctional enterobactin receptor/adhesin protein	NA	A0A0P0I887	Acinetobacter_phage	31.5	1.4e-08
VDY95898.1|4427822_4428815_+	bifunctional enterobactin receptor/adhesin protein	NA	NA	NA	NA	NA
VDY95899.1|4429676_4429919_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY95900.1|4430209_4430578_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY95901.1|4430581_4430797_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY95902.1|4430793_4431066_+	Neurotensin receptor R8	NA	NA	NA	NA	NA
VDY95903.1|4431716_4432205_-|transposase	transposase	transposase	NA	NA	NA	NA
VDY95904.1|4432861_4433053_-	Periplasmic oligopeptide-binding protein (fragment)	NA	NA	NA	NA	NA
VDY95905.1|4433389_4434064_+	L-lactate permease	NA	NA	NA	NA	NA
VDY95906.1|4434060_4434558_+	L-lactate permease	NA	NA	NA	NA	NA
VDY95907.1|4434557_4434944_+	L-lactate permease	NA	NA	NA	NA	NA
VDY95908.1|4434993_4435713_+	hydroxyacid oxidoreductase (Fe-S centre)	NA	NA	NA	NA	NA
VDY95909.1|4435723_4437139_+	putative oxidoreductase subunit with NAD(P)-binding domain and ferridoxin-like domain	NA	NA	NA	NA	NA
VDY95910.1|4437143_4437842_+	transporter	NA	NA	NA	NA	NA
VDY95911.1|4438250_4438460_-	type I restriction-modification system (hsdR-like)	NA	NA	NA	NA	NA
VDY95912.1|4438646_4439027_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
VDY95913.1|4439023_4439332_+	prophage CP-933O IS protein	NA	A0A0P0ZBY2	Stx2-converting_phage	99.0	7.6e-50
VDY95914.1|4439398_4440421_+|transposase	transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
VDY95915.1|4440420_4441200_+	insertion sequence IS100, ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
VDY95916.1|4441379_4442918_+|transposase	putative transposase ORF 1, IS66 family	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.6	4.3e-295
VDY95917.1|4443408_4443624_-	heat resistant agglutinin 1	NA	NA	NA	NA	NA
VDY95918.1|4444494_4445415_-	urea transporter	NA	NA	NA	NA	NA
VDY95919.1|4445713_4447150_-	hemolysin D	NA	NA	NA	NA	NA
VDY95920.1|4447168_4449292_-	alpha-hemolysin translocation ATP-binding protein HlyB	NA	W8CYL7	Bacillus_phage	29.7	1.9e-46
VDY95921.1|4449362_4452437_-	hemolysin A	NA	NA	NA	NA	NA
VDY95922.1|4452448_4452961_-	hemolysin-activating lysine-acyltransferase HlyC	NA	NA	NA	NA	NA
VDY95923.1|4453230_4453452_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY95924.1|4453906_4455232_+|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.8	7.9e-128
