The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134083	Escherichia coli strain NCTC12655 genome assembly, chromosome: 1	4757324	846041	854420	4757324	tRNA	Bacillus_phage(33.33%)	9	NA	NA
VDZ07071.1|846041_846938_+	tyrosine recombinase	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
VDZ07072.1|846962_847673_+	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
VDZ07073.1|847678_848092_+	single-stranded DNA-specific exonuclease	NA	A7KV88	Bacillus_phage	35.7	1.2e-10
VDZ07074.1|848133_849414_+	single-stranded DNA-specific exonuclease	NA	A7KV88	Bacillus_phage	26.7	7.3e-38
VDZ07075.1|849721_850603_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.5e-05
VDZ07076.1|850612_852130_+|tRNA	lysyl-tRNA synthetase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
VDZ07077.1|852173_852722_-	isopentenyl-diphosphate delta-isomerase	NA	NA	NA	NA	NA
VDZ07078.1|852844_852970_-	small predicted membrane protein	NA	NA	NA	NA	NA
VDZ07079.1|852971_854420_-	purine permease ygfU	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
>prophage 2
LR134083	Escherichia coli strain NCTC12655 genome assembly, chromosome: 1	4757324	1021557	1028696	4757324	tRNA	Escherichia_phage(83.33%)	6	NA	NA
VDZ07228.1|1021557_1022196_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
VDZ07229.1|1022287_1023454_-|tRNA	paral putative tRNA synthase	tRNA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
VDZ07230.1|1023450_1024359_-	oxidoreductase YgbJ	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
VDZ07231.1|1024554_1025322_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
VDZ07232.1|1025372_1026029_-	serine/threonine-specific protein phosphatase 2	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
VDZ07233.1|1026134_1028696_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 3
LR134083	Escherichia coli strain NCTC12655 genome assembly, chromosome: 1	4757324	1224258	1230693	4757324		Mycoplasma_phage(33.33%)	9	NA	NA
VDZ07421.1|1224258_1225473_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
VDZ07422.1|1225500_1225887_+	NifU-like protein	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
VDZ07423.1|1225903_1226227_+	iron-sulfur cluster assembly protein	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
VDZ07424.1|1226322_1226838_+	co-chaperone HscB	NA	NA	NA	NA	NA
VDZ07425.1|1226854_1228705_+	chaperone protein HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
VDZ07426.1|1228706_1229042_+	ferredoxin	NA	NA	NA	NA	NA
VDZ07427.1|1229053_1229254_+	FeS assembly protein IscX	NA	NA	NA	NA	NA
VDZ07428.1|1229431_1230250_+	peptidase B (aminopeptidase B)	NA	Q6GYZ8	Mycoplasma_phage	41.2	1.9e-10
VDZ07429.1|1230249_1230693_+	peptidase B (aminopeptidase B)	NA	Q6GYZ8	Mycoplasma_phage	40.4	3.6e-08
>prophage 4
LR134083	Escherichia coli strain NCTC12655 genome assembly, chromosome: 1	4757324	1358329	1414962	4757324	tail,integrase,tRNA,transposase	Enterobacteria_phage(42.86%)	53	1398801:1398817	1416972:1416988
VDZ07548.1|1358329_1359745_+|tRNA	glutamyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VDZ07549.1|1359796_1360168_-	putative regulatory protein	NA	NA	NA	NA	NA
VDZ07550.1|1360190_1360550_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
VDZ07551.1|1361169_1363359_+	putative diguanylate cyclase	NA	NA	NA	NA	NA
VDZ07552.1|1363395_1363536_-|transposase	transposase	transposase	NA	NA	NA	NA
VDZ07553.1|1363558_1364671_-|transposase	IS186, transposase	transposase	NA	NA	NA	NA
VDZ07554.1|1364757_1365960_-	nucleoside permease nupC	NA	NA	NA	NA	NA
VDZ07555.1|1366295_1367534_+	manganese transport protein	NA	NA	NA	NA	NA
VDZ07556.1|1367674_1368001_-	protein	NA	NA	NA	NA	NA
VDZ07557.1|1368115_1369372_-	putative voltage gated chloride channel protein	NA	NA	NA	NA	NA
VDZ07558.1|1369575_1370541_+	glucokinase	NA	NA	NA	NA	NA
VDZ07559.1|1370759_1371086_+	PTS system IIB component ypdH	NA	NA	NA	NA	NA
VDZ07560.1|1371107_1372355_+	fructose-like specific PTS system EIIC component 1	NA	NA	NA	NA	NA
VDZ07561.1|1372369_1373455_+	aminopeptidase	NA	NA	NA	NA	NA
VDZ07562.1|1373454_1374492_+	aminopeptidase	NA	NA	NA	NA	NA
VDZ07563.1|1374516_1377012_+	multiphosphoryl transfer protein 1 [includes phosphoenolpyruvate-protein phosphotransferase;phosphocarrier protein Hp; fructose-like phosphotransferase enzyme IIA component]	NA	NA	NA	NA	NA
VDZ07564.1|1377014_1377872_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
VDZ07565.1|1377884_1378619_-	putative response regulator in two-component system with YpdA	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
VDZ07566.1|1378633_1380331_-	two-component system sensor kinase	NA	NA	NA	NA	NA
VDZ07567.1|1380706_1381945_+	putative aminotransferase	NA	NA	NA	NA	NA
VDZ07568.1|1382436_1383357_-	lipid A biosynthesis lauroyl (or palmitoleoyl) acyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
VDZ07569.1|1383709_1383952_+	inner membrane protein	NA	NA	NA	NA	NA
VDZ07570.1|1384028_1384304_-	putative lipoprotein involved in colanic acid biosynthesis	NA	NA	NA	NA	NA
VDZ07571.1|1384599_1385235_+	protein	NA	NA	NA	NA	NA
VDZ07572.1|1385747_1386998_+	putative transferase	NA	NA	NA	NA	NA
VDZ07573.1|1387051_1388746_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.4e-23
VDZ07574.1|1388815_1389760_+	transporter YfdV	NA	NA	NA	NA	NA
VDZ07575.1|1389833_1390979_+	CoA-transferase	NA	NA	NA	NA	NA
VDZ07576.1|1391034_1394628_-	hybrid sensory histidine kinase in two-component regulatory system with EvgA	NA	W8CYM9	Bacillus_phage	40.0	1.1e-09
VDZ07577.1|1394632_1395247_-	DNA-binding transcriptional activator EvgA	NA	NA	NA	NA	NA
VDZ07578.1|1395662_1396826_+	EmrKY-TolC multidrug resistance efflux pump, membrane fusion protein component	NA	NA	NA	NA	NA
VDZ07579.1|1396825_1398364_+	multidrug resistance protein Y	NA	NA	NA	NA	NA
VDZ07580.1|1398471_1399800_-	D-serine dehydratase	NA	NA	NA	NA	NA
1398801:1398817	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
VDZ07581.1|1399817_1401155_-	permease DsdX	NA	NA	NA	NA	NA
VDZ07582.1|1401372_1402308_+	DNA-binding transcriptional regulator DsdC	NA	NA	NA	NA	NA
VDZ07583.1|1402491_1402692_-	response regulator inhibitor for tor operon	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
VDZ07584.1|1402823_1403129_-	CPS-53 (KpLE1) prophage protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
VDZ07585.1|1403128_1403491_-	CPS-53 (KpLE1) prophage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
VDZ07586.1|1403481_1404018_-	CPS-53 (KpLE1) prophage protein	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
VDZ07587.1|1404145_1404970_-	CPS-53 (KpLE1) prophage protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
VDZ07588.1|1405035_1405398_-	CPS-53 (KpLE1) prophage protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
VDZ07589.1|1405755_1406124_+	putative phage replication protein O	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
VDZ07590.1|1406120_1406615_+	CPS-53 (KpLE1) prophage protein	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
VDZ07591.1|1406614_1406890_+	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
VDZ07592.1|1406855_1407458_+	Uncharacterised protein	NA	M1FN94	Enterobacteria_phage	72.8	1.9e-52
VDZ07593.1|1407484_1407925_+	CPS-53 (KpLE1) prophage protein	NA	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
VDZ07594.1|1407896_1408199_-|tail	tail assembly chaperone gp38	tail	Q9MCR5	Enterobacteria_phage	95.8	3.0e-43
VDZ07595.1|1408539_1409871_-	CPS-53 (KpLE1) prophage; putative inner membrane protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
VDZ07596.1|1409867_1410689_-	CPS-53 (KpLE1) prophage; bactoprenol glucosyl transferase	NA	M1FQW5	Enterobacteria_phage	89.4	1.6e-142
VDZ07597.1|1410734_1411601_-|transposase	IS3 element transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
VDZ07598.1|1411597_1411897_-|transposase	transposase	transposase	NA	NA	NA	NA
VDZ07599.1|1412560_1413718_-|integrase	integrase	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
VDZ07600.1|1414029_1414962_-	transporter protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
1416972:1416988	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 5
LR134083	Escherichia coli strain NCTC12655 genome assembly, chromosome: 1	4757324	1649882	1711584	4757324	tRNA,transposase	Enterobacteria_phage(40.0%)	59	NA	NA
VDZ07815.1|1649882_1650830_+|tRNA	tRNA-dihydrouridine synthase C	tRNA	NA	NA	NA	NA
VDZ07816.1|1651754_1652945_+	multidrug resistance outer membrane protein	NA	NA	NA	NA	NA
VDZ07817.1|1652997_1653759_+	putative short-chain dehydrogenase	NA	NA	NA	NA	NA
VDZ07818.1|1653888_1654467_-	DedA family membrane protein	NA	NA	NA	NA	NA
VDZ07819.1|1654636_1655224_+	inner membrane protein	NA	NA	NA	NA	NA
VDZ07820.1|1655397_1656330_+	penicillin-binding protein 7	NA	NA	NA	NA	NA
VDZ07821.1|1656367_1658083_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
VDZ07822.1|1658308_1660576_+	periplasmic beta-glucosidase	NA	NA	NA	NA	NA
VDZ07823.1|1660786_1661704_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDZ07824.1|1661710_1662868_+	ABC transporter permease	NA	NA	NA	NA	NA
VDZ07825.1|1662860_1663787_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
VDZ07826.1|1663791_1664523_+	ABC transporter permease	NA	NA	NA	NA	NA
VDZ07827.1|1664503_1664611_-	putative inner membrane protein	NA	NA	NA	NA	NA
VDZ07828.1|1664670_1665402_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
VDZ07829.1|1665623_1667309_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
VDZ07830.1|1667305_1668025_+	two-component response-regulatory protein YehT	NA	NA	NA	NA	NA
VDZ07831.1|1668071_1668542_+	conserved protein, DUF1456 family	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
VDZ07832.1|1668581_1669043_-	lipoprotein yehR	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
VDZ07833.1|1669323_1671168_-	zinc finger SWIM domain-containing protein	NA	Q9EYF6	Enterobacteria_phage	95.9	0.0e+00
VDZ07834.1|1671164_1672301_-	von Willebrand factor type A domain protein YehP	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
VDZ07835.1|1672293_1674573_-	protein	NA	NA	NA	NA	NA
VDZ07836.1|1674583_1675672_-	ATPase	NA	NA	NA	NA	NA
VDZ07837.1|1675978_1676296_-	protein	NA	NA	NA	NA	NA
VDZ07838.1|1676356_1679989_-	molybdate metabolism regulator MolR-like protein	NA	NA	NA	NA	NA
VDZ07839.1|1679998_1680958_-	WGR domain-containing protein	NA	NA	NA	NA	NA
VDZ07840.1|1680920_1682858_-	WGR domain-containing protein	NA	NA	NA	NA	NA
VDZ07841.1|1682969_1683794_-	molybdate metabolism regulator	NA	NA	NA	NA	NA
VDZ07842.1|1683934_1685968_-|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
VDZ07843.1|1686099_1687209_+	ATPase	NA	NA	NA	NA	NA
VDZ07844.1|1687471_1687753_+	fimbrial-like adhesin protein	NA	NA	NA	NA	NA
VDZ07845.1|1688045_1688588_+	fimbrial protein	NA	NA	NA	NA	NA
VDZ07846.1|1688667_1689342_+	putative periplasmic pilin chaperone	NA	NA	NA	NA	NA
VDZ07847.1|1689357_1691838_+	fimbrial outer membrane usher protein	NA	NA	NA	NA	NA
VDZ07848.1|1691853_1692645_+	putative fimbrial adhesin	NA	NA	NA	NA	NA
VDZ07849.1|1692673_1692949_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	2.0e-46
VDZ07850.1|1692993_1693371_+|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	100.0	1.3e-67
VDZ07851.1|1693746_1694085_-	periplasmic modulator of Ni and Co efflux	NA	NA	NA	NA	NA
VDZ07852.1|1694303_1695128_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
VDZ07853.1|1695248_1695521_+	transcriptional repressor RcnR	NA	NA	NA	NA	NA
VDZ07854.1|1695743_1696532_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
VDZ07855.1|1696528_1697329_+	phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
VDZ07856.1|1697393_1698212_+	1,4-beta-N-acetylmuramidase	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
VDZ07857.1|1698263_1699010_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
VDZ07858.1|1698983_1699949_-	putative carbohydrate/pyrimidine kinase	NA	NA	NA	NA	NA
VDZ07859.1|1699945_1700950_-	putative ADP-ribosylglycohydrolase	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
VDZ07860.1|1700946_1702224_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VDZ07861.1|1702480_1703533_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
VDZ07862.1|1703840_1704695_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
VDZ07863.1|1704723_1705986_+	putative tagatose 6-phosphate kinase	NA	NA	NA	NA	NA
VDZ07864.1|1705995_1706448_+	galactitol-specific PTS system EIIA component	NA	NA	NA	NA	NA
VDZ07865.1|1706478_1706763_+	galactitol-specific PTS system EIIB component	NA	NA	NA	NA	NA
VDZ07866.1|1706766_1706862_+	PTS system, galactitol-specific IIC component protein	NA	NA	NA	NA	NA
VDZ07867.1|1706855_1707233_-|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	100.0	1.3e-67
VDZ07868.1|1707277_1707553_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	2.0e-46
VDZ07869.1|1707633_1708899_+	galactitol-specific PTS system EIIC component	NA	NA	NA	NA	NA
VDZ07870.1|1708946_1709987_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
VDZ07871.1|1710086_1710425_+	galactitol utilization operon repressor	NA	NA	NA	NA	NA
VDZ07872.1|1710421_1711288_-|transposase	IS3 element transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
VDZ07873.1|1711284_1711584_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
LR134083	Escherichia coli strain NCTC12655 genome assembly, chromosome: 1	4757324	1765923	1774593	4757324		Enterobacteria_phage(28.57%)	8	NA	NA
VDZ07916.1|1765923_1767318_+	colanic acid biosynthesis protein	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
VDZ07917.1|1767492_1768386_+	UTP--glucose-1-phosphate uridylyltransferase subunit GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
VDZ07918.1|1768758_1769844_+	dTDP-D-glucose 4,6-dehydratase rmlB	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
VDZ07919.1|1769843_1770701_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.2	6.0e-28
VDZ07920.1|1770799_1771681_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
VDZ07921.1|1771680_1772238_+	dTDP-4-deoxyrhamnose-3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
VDZ07922.1|1772234_1773482_+	putative polisoprenol-linked O-antigen transporter	NA	NA	NA	NA	NA
VDZ07923.1|1773489_1774593_+	UDP-galactopyranose mutase, FAD/NAD(P)-binding	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
>prophage 7
LR134083	Escherichia coli strain NCTC12655 genome assembly, chromosome: 1	4757324	1846576	1855497	4757324		Enterobacteria_phage(33.33%)	11	NA	NA
VDZ07991.1|1846576_1846966_-	outer membrane protein F	NA	Q1MVN1	Enterobacteria_phage	55.5	5.3e-32
VDZ07992.1|1846971_1847064_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ07993.1|1847283_1847769_-	outer membrane protein yedS	NA	Q1MVN1	Enterobacteria_phage	63.1	7.0e-50
VDZ07994.1|1848398_1848701_+	inner membrane protein YedR	NA	NA	NA	NA	NA
VDZ07995.1|1848740_1849436_+	putative phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
VDZ07996.1|1849502_1850921_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
VDZ07997.1|1850901_1851372_+	patch repair protein	NA	E5E3X5	Burkholderia_phage	47.6	2.0e-33
VDZ07998.1|1851360_1852281_-	putative DMT superfamily transporter inner membrane protein	NA	NA	NA	NA	NA
VDZ07999.1|1852453_1853371_+	putative methyl-independent mismatch repair protein	NA	NA	NA	NA	NA
VDZ08000.1|1853449_1853632_+	putative small protein	NA	NA	NA	NA	NA
VDZ08001.1|1853802_1855497_+	cellulose synthesis regulatory protein (signal transduction protein)	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
>prophage 8
LR134083	Escherichia coli strain NCTC12655 genome assembly, chromosome: 1	4757324	2208265	2249041	4757324	transposase,lysis,tail,integrase,protease	Enterobacteria_phage(32.0%)	51	2215842:2215857	2241989:2242004
VDZ08362.1|2208265_2209087_-|protease	putative protease	protease	NA	NA	NA	NA
VDZ08363.1|2209362_2209671_-	acid shock protein	NA	NA	NA	NA	NA
VDZ08364.1|2210094_2211348_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VDZ08365.1|2211454_2212348_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDZ08366.1|2212482_2212914_+	protein Mlc (making large colonies protein)	NA	NA	NA	NA	NA
VDZ08367.1|2213008_2213704_+	transcriptional regulator	NA	NA	NA	NA	NA
VDZ08368.1|2213828_2214524_+	dithiobiotin synthetase	NA	NA	NA	NA	NA
VDZ08369.1|2214476_2215733_-	voltage-gated ClC-type chloride channel	NA	NA	NA	NA	NA
2215842:2215857	attL	CTTTAAGAGATAAAAA	NA	NA	NA	NA
VDZ08370.1|2215927_2216542_-	anaerobic dimethyl sulfoxide reductase maturation protein (twin-arginine leader-binding protein)	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
VDZ08371.1|2216584_2218057_-	oxidoreductase, membrane subunit	NA	A0A077SL61	Escherichia_phage	59.9	1.9e-69
VDZ08372.1|2218067_2220464_-	putative dimethyl sulfoxide reductase, olydopterin dinucleotide binding subunit	NA	A0A077SK27	Escherichia_phage	48.6	4.8e-208
VDZ08373.1|2220551_2222978_-	putative dimethyl sulfoxide reductase, oxidoreductase subunit	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
VDZ08374.1|2223176_2223482_-	protein	NA	NA	NA	NA	NA
VDZ08375.1|2223553_2224300_+	lipoprotein	NA	NA	NA	NA	NA
VDZ08376.1|2224302_2224863_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
VDZ08377.1|2224897_2225239_-	protein	NA	NA	NA	NA	NA
VDZ08378.1|2225373_2225700_+	inner membrane protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
VDZ08379.1|2225905_2227120_+	starvation sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
VDZ08380.1|2227131_2228151_+	dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
VDZ08381.1|2228338_2229535_-|integrase	defective integrase; Qin prophage	integrase	B6DZ48	Enterobacteria_phage	59.2	7.9e-135
VDZ08382.1|2229612_2230053_-|transposase	IS2 insertion element transposase InsAB'	transposase	Q9ZXG3	Shigella_phage	93.4	1.6e-72
VDZ08383.1|2230049_2230970_-	Qin prophage; protein	NA	NA	NA	NA	NA
VDZ08384.1|2231062_2231254_-	putative prophage protein	NA	NA	NA	NA	NA
VDZ08385.1|2231250_2231439_-	division inhibition protein	NA	NA	NA	NA	NA
VDZ08386.1|2231838_2232003_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ08387.1|2232006_2232225_-	putative prophage protein	NA	NA	NA	NA	NA
VDZ08388.1|2232254_2232383_-	putative prophage protein	NA	NA	NA	NA	NA
VDZ08389.1|2232384_2232540_-	putative prophage protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
VDZ08390.1|2232706_2233114_-	repressor protein of division inhibition gene	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
VDZ08391.1|2233197_2233428_+	repressor protein of division inhibition gene	NA	NA	NA	NA	NA
VDZ08392.1|2233411_2233702_+	Qin prophage protein	NA	NA	NA	NA	NA
VDZ08393.1|2233698_2233926_+	Qin prophage protein	NA	NA	NA	NA	NA
VDZ08394.1|2234310_2234643_-	Qin prophage protein	NA	NA	NA	NA	NA
VDZ08395.1|2235174_2235414_+	antitoxin of the RelE-RelB toxin-antitoxin system and transcriptional repressor of relBEF	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
VDZ08396.1|2235413_2235701_+	toxin of the RelE-RelB toxin-antitoxin system	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
VDZ08397.1|2235772_2235928_+	putative host cell-killing modulation protein	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
VDZ08398.1|2236144_2236396_+	putative prophage protein	NA	NA	NA	NA	NA
VDZ08399.1|2236742_2237792_+	putative prophage protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
VDZ08400.1|2237805_2238558_+	lambdoid prophage Qin antitermination protein Q-like protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
VDZ08401.1|2238979_2239192_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
VDZ08402.1|2240309_2240429_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ08403.1|2240470_2240677_+|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	94.1	4.5e-30
VDZ08404.1|2240681_2240993_+	Qin prophage protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
VDZ08405.1|2240989_2241523_+	prophage lysozyme (endolysin)	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
VDZ08406.1|2241519_2242017_+	Qin prophage protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
2241989:2242004	attR	CTTTAAGAGATAAAAA	NA	NA	NA	NA
VDZ08407.1|2243264_2243438_+	GnsA/GnsB family transcriptional regulator	NA	NA	NA	NA	NA
VDZ08408.1|2243589_2244000_-	Qin prophage	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
VDZ08409.1|2244679_2245249_+	DNA packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
VDZ08410.1|2245199_2246162_+|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
VDZ08411.1|2247016_2247424_-	putative DNA-invertase	NA	A0A219Y912	Aeromonas_phage	36.1	1.0e-14
VDZ08412.1|2248060_2249041_-|transposase	IS5 transposase and trans-activator	transposase	Q38213	Escherichia_phage	100.0	5.5e-187
>prophage 9
LR134083	Escherichia coli strain NCTC12655 genome assembly, chromosome: 1	4757324	2411739	2475685	4757324	tRNA,transposase,lysis,tail,integrase	Escherichia_phage(40.62%)	63	2454635:2454653	2485008:2485026
VDZ08554.1|2411739_2412891_-|transposase	IS30 transposase encoded within prophage CP-933T	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
VDZ08555.1|2413099_2413465_+|transposase	transposase	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
VDZ08556.1|2413422_2414328_+	IS2 element protein	NA	Q9ZXG3	Shigella_phage	99.7	3.3e-178
VDZ08557.1|2414298_2416857_-	autotransporter (AT) family porin	NA	NA	NA	NA	NA
VDZ08558.1|2417187_2417778_-	phenylacetic acid degradation protein	NA	NA	NA	NA	NA
VDZ08559.1|2417759_2418710_-	DNA-binding transcriptional repressor of phenylacetic acid degradation, aryl-CoA responsive	NA	NA	NA	NA	NA
VDZ08560.1|2418810_2420124_-	phenylacetyl-CoA ligase	NA	NA	NA	NA	NA
VDZ08561.1|2420150_2421356_-	beta-ketoadipyl CoA thiolase	NA	NA	NA	NA	NA
VDZ08562.1|2421355_2421778_-	phenylacetate pathway hotdog-fold thioesterase	NA	NA	NA	NA	NA
VDZ08563.1|2421767_2423150_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
VDZ08564.1|2423196_2423985_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
VDZ08565.1|2423984_2424590_-	enoyl-CoA hydratase-isomerase	NA	NA	NA	NA	NA
VDZ08566.1|2424749_2425820_-	subunit of the phenylacetly-CoA oxygenase/reductase	NA	NA	NA	NA	NA
VDZ08567.1|2425827_2426325_-	Phenylacetic acid degradation protein paaD	NA	NA	NA	NA	NA
VDZ08568.1|2426339_2427086_-	multicomponent oxygenase/reductase subunit for phenylacetic acid degradation	NA	NA	NA	NA	NA
VDZ08569.1|2427094_2427382_-	phenylacetate-CoA oxygenase subunit PaaB	NA	NA	NA	NA	NA
VDZ08570.1|2427393_2428323_-	phenylacetate-CoA oxygenase subunit PaaA	NA	NA	NA	NA	NA
VDZ08571.1|2428607_2430653_+	bifunctional aldehyde dehydrogenase/enoyl-CoA hydratase	NA	NA	NA	NA	NA
VDZ08572.1|2430900_2433174_+	tyramine oxidase	NA	NA	NA	NA	NA
VDZ08573.1|2433231_2434731_-	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
VDZ08574.1|2434966_2435872_+	DNA-binding transcriptional activator FeaR	NA	NA	NA	NA	NA
VDZ08575.1|2436043_2436370_-	Uncharacterized protein conserved in bacteria	NA	NA	NA	NA	NA
VDZ08576.1|2436377_2436563_-	lipoprotein	NA	NA	NA	NA	NA
VDZ08577.1|2436559_2439199_-	protein	NA	NA	NA	NA	NA
VDZ08578.1|2439406_2440396_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
VDZ08579.1|2440506_2440929_+	heat-inducible protein	NA	NA	NA	NA	NA
VDZ08580.1|2440925_2441192_-	protein	NA	NA	NA	NA	NA
VDZ08581.1|2441465_2444990_+	pyruvate-flavodoxin oxidoreductase	NA	NA	NA	NA	NA
VDZ08582.1|2445356_2446490_+	outer membrane protein N (porin)	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
VDZ08583.1|2446630_2447065_+	putative universal stress protein	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
VDZ08584.1|2448025_2448259_+	Qin prophage DNA-binding transcriptional regulator	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
VDZ08585.1|2448575_2449166_+	putative DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
VDZ08586.1|2449838_2451836_-|tail	phage tail domain-containing protein	tail	X2KTY7	Enterobacteria_phage	58.0	9.3e-189
VDZ08587.1|2451966_2452704_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ08588.1|2453523_2454504_+|transposase	IS5 transposase and trans-activator	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
2454635:2454653	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
VDZ08589.1|2454767_2455796_-|tail	putative phage tail protein	tail	G8C7Q6	Escherichia_phage	35.2	7.2e-20
VDZ08590.1|2456269_2456629_-	Rac prophage; protein	NA	NA	NA	NA	NA
VDZ08591.1|2456609_2456873_-	Rac prophage protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
VDZ08592.1|2457010_2458435_-	Rac prophage; potassium transporter subunit	NA	NA	NA	NA	NA
VDZ08593.1|2458605_2458905_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	93.8	2.5e-42
VDZ08594.1|2458937_2459498_-	DNA-binding protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
VDZ08595.1|2459520_2460267_-	putative phage DNA replication protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
VDZ08596.1|2460273_2461131_-	phage protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
VDZ08597.1|2461143_2461566_-	Protein of uncharacterised function (DUF1019)	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
VDZ08598.1|2461588_2461885_-	Rac prophage; putative DNA-binding transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
VDZ08599.1|2462008_2462485_+	Rac prophage; putative DNA-binding transcriptional regulator	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
VDZ08600.1|2462793_2462928_+	Rac prophage protein	NA	NA	NA	NA	NA
VDZ08601.1|2462938_2463094_+	Rac prophage; predicted protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
VDZ08602.1|2463090_2463702_-	prophage CP-933R superinfection exclusion protein	NA	NA	NA	NA	NA
VDZ08603.1|2464020_2464242_+	FtsZ inhibitor protein	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
VDZ08604.1|2464241_2464412_+	Rac prophage; zinc-binding protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
VDZ08605.1|2464486_2464762_+	putative bacteriophage protein	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
VDZ08606.1|2464863_2465997_+	exonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	68.6	2.6e-127
VDZ08607.1|2466077_2467463_+	exonuclease VIII	NA	Q9QF34	Lambdoid_phage	97.1	1.5e-177
VDZ08608.1|2467455_2468265_+	recombination and repair protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
VDZ08609.1|2468508_2468718_+	gydaC	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
VDZ08610.1|2468796_2469012_+	excisionase	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
VDZ08611.1|2469483_2470248_+|integrase	phage integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	4.1e-145
VDZ08612.1|2470299_2471235_+|tRNA	C32 tRNA thiolase	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
VDZ08613.1|2471363_2472737_-	ATP-independent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
VDZ08614.1|2472766_2472940_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ08615.1|2473214_2474198_-	zinc transport protein	NA	NA	NA	NA	NA
VDZ08616.1|2474452_2475685_+	putative signaling protein	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2485008:2485026	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
>prophage 10
LR134083	Escherichia coli strain NCTC12655 genome assembly, chromosome: 1	4757324	2669475	2681373	4757324	terminase,tail,portal,integrase	Shigella_phage(43.75%)	20	2664370:2664383	2682399:2682412
2664370:2664383	attL	AAAATAAGATGAAT	NA	NA	NA	NA
VDZ08827.1|2669475_2669640_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
VDZ08828.1|2669873_2670707_-	HNH endonuclease	NA	NA	NA	NA	NA
VDZ08829.1|2670813_2671368_-	DNA invertase from prophage CP-933H	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
VDZ08830.1|2671397_2671775_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ08831.1|2671814_2672189_+|tail	Caudovirales tail fibre assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	53.6	6.4e-27
VDZ08832.1|2672160_2672763_-|tail	tail fiber assembly	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
VDZ08833.1|2672762_2673551_-	Tail Collar domain-containing protein	NA	U5P0I1	Shigella_phage	94.4	2.7e-51
VDZ08834.1|2673554_2674139_-|tail	putative phage tail protein	tail	O22003	Shigella_phage	98.5	2.0e-112
VDZ08835.1|2674129_2674879_-	YmfP protein	NA	M1FQW3	Enterobacteria_phage	96.8	2.2e-135
VDZ08836.1|2674847_2675321_-|portal	phage portal protein, HK97 family	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
VDZ08837.1|2675320_2675503_-	prophage protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
VDZ08838.1|2675514_2676882_-|terminase	terminase	terminase	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
VDZ08839.1|2676891_2677230_-	Uncharacterised protein	NA	U5P0J9	Shigella_phage	96.4	2.3e-55
VDZ08840.1|2677226_2677784_-	nucleic acid-binding protein; e14 prophage	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
VDZ08841.1|2677827_2678028_-	DNA-binding transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
VDZ08842.1|2678118_2678793_+	phage repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
VDZ08843.1|2678967_2679276_+	Uncharacterised protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
VDZ08844.1|2679213_2679555_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ08845.1|2680019_2680265_+	Excisionase domain protein	NA	NA	NA	NA	NA
VDZ08846.1|2680245_2681373_+|integrase	e14 prophage; predicted integrase	integrase	O21925	Phage_21	61.5	7.2e-122
2682399:2682412	attR	AAAATAAGATGAAT	NA	NA	NA	NA
>prophage 11
LR134083	Escherichia coli strain NCTC12655 genome assembly, chromosome: 1	4757324	3272689	3317207	4757324	lysis,protease,integrase,transposase	Enterobacteria_phage(58.33%)	48	3295920:3295966	3317221:3317267
VDZ09415.1|3272689_3272830_-|transposase	transposase	transposase	NA	NA	NA	NA
VDZ09416.1|3273723_3273957_-|transposase	IS186 transposase	transposase	NA	NA	NA	NA
VDZ09417.1|3274637_3275756_+	carboxylate-amine ligase	NA	NA	NA	NA	NA
VDZ09418.1|3275821_3276070_+	membrane protein YbdJ	NA	NA	NA	NA	NA
VDZ09419.1|3276134_3276503_+	putative cytoplasmic protein YjbR	NA	NA	NA	NA	NA
VDZ09420.1|3276596_3277250_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
VDZ09421.1|3277357_3278605_+	putative mechanosensitive ion channel protein	NA	NA	NA	NA	NA
VDZ09422.1|3278685_3280062_-	phenylalanine transporter	NA	NA	NA	NA	NA
VDZ09423.1|3280163_3283307_-	cation efflux system protein	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
VDZ09424.1|3283418_3283772_-	cation efflux system protein	NA	NA	NA	NA	NA
VDZ09425.1|3283722_3284514_-	cation efflux system protein	NA	NA	NA	NA	NA
VDZ09426.1|3284558_3284891_-	cation efflux system protein	NA	NA	NA	NA	NA
VDZ09427.1|3285048_3286422_-	copper/silver efflux system outer membrane protein CusC	NA	NA	NA	NA	NA
VDZ09428.1|3286578_3287262_+	two-component system response regulator	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
VDZ09429.1|3287251_3288694_+	sensor kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.2	3.0e-11
VDZ09430.1|3288843_3289863_+	bacteriophage N4 adsorption protein B	NA	NA	NA	NA	NA
VDZ09431.1|3289954_3291082_+	bacteriophage N4 adsorption protein B	NA	NA	NA	NA	NA
VDZ09432.1|3291068_3294041_+	bacteriophage N4 receptor, outer membrane subunit	NA	NA	NA	NA	NA
VDZ09433.1|3294041_3294932_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ09434.1|3295114_3295876_+	porin thermoregulatory protein	NA	NA	NA	NA	NA
3295920:3295966	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
VDZ09435.1|3296389_3297343_+|protease	outer membrane protease	protease	NA	NA	NA	NA
VDZ09436.1|3297592_3298342_-	DNA-binding transcriptional activator	NA	NA	NA	NA	NA
VDZ09437.1|3299439_3299871_+	methylase	NA	NA	NA	NA	NA
VDZ09438.1|3300643_3301189_-	prophage qsr' DNA packaging protein NU1-like protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
VDZ09439.1|3301936_3302143_-	DLP12 prophage; predicted protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
VDZ09440.1|3302428_3302839_+	putative envelope protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
VDZ09441.1|3303129_3303423_+	lambdoid prophage DLP12 Bor-like protein	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
VDZ09442.1|3303454_3303916_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	97.4	3.9e-74
VDZ09443.1|3303912_3304410_-	phage lysozome	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
VDZ09444.1|3304409_3304625_-|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
VDZ09445.1|3305197_3306265_+	outer membrane porin; DLP12 prophage	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
VDZ09446.1|3306305_3307286_+|transposase	IS5 transposase and trans-activator	transposase	Q38213	Escherichia_phage	100.0	5.5e-187
VDZ09447.1|3307323_3307542_-	type IV secretory pathway VirB6 component (fragment)	NA	Q38586	Enterobacteria_phage	70.2	1.1e-13
VDZ09448.1|3307683_3308067_-	lambdoid prophage DLP12 antitermination protein Q	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
VDZ09449.1|3308152_3308290_-	DLP12 prophage; small protein	NA	K7PHH3	Enterobacteria_phage	70.7	2.4e-08
VDZ09450.1|3308289_3308652_-	endodeoxyribonuclease RUS	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
VDZ09451.1|3308648_3308939_-	DLP12 prophage	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
VDZ09452.1|3308931_3309102_-	prophage protein NinE	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
VDZ09453.1|3309101_3309557_-	DLP12 prophage; DNA base-flipping protein	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
VDZ09454.1|3309771_3310569_-	DNA-binding transcriptional regulator; DLP12 prophage	NA	NA	NA	NA	NA
VDZ09455.1|3310578_3311130_-	kinase inhibitor	NA	NA	NA	NA	NA
VDZ09456.1|3311594_3313121_-	site-specific invertase; DLP12 prophage	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
VDZ09457.1|3313375_3313708_-	Multidrug transporter emrE	NA	NA	NA	NA	NA
VDZ09458.1|3314018_3314939_-|transposase	IS3 element transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.4e-51
VDZ09459.1|3314886_3315180_-|transposase	transposase	transposase	NA	NA	NA	NA
VDZ09460.1|3315242_3315338_-	ren protein from phage origin	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
VDZ09461.1|3315660_3315924_+	DLP12 prophage; exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
VDZ09462.1|3316043_3317207_+|integrase	site-specific recombinase, phage integrase family protein	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
3317221:3317267	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 12
LR134083	Escherichia coli strain NCTC12655 genome assembly, chromosome: 1	4757324	3649004	3731907	4757324	protease,integrase,transposase	Escherichia_phage(26.09%)	77	3701826:3701885	3736134:3736193
VDZ09791.1|3649004_3650504_-|protease	putative protease	protease	NA	NA	NA	NA
VDZ09792.1|3650596_3651544_-|protease	outer membrane protease	protease	NA	NA	NA	NA
VDZ09793.1|3652264_3656380_+	Outer membrane autotransporter barrel domain protein precursor	NA	A0A2L1IV18	Escherichia_phage	37.1	1.6e-126
VDZ09794.1|3656606_3656876_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ09795.1|3657015_3662325_+	outer membrane autotransporter domain protein	NA	NA	NA	NA	NA
VDZ09796.1|3662410_3662644_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ09797.1|3663077_3663770_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ09798.1|3664723_3664954_-|transposase	truncated transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	3.5e-07
VDZ09799.1|3664964_3665330_+|transposase	transposase	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
VDZ09800.1|3665287_3666193_+	IS2 element protein	NA	Q9ZXG3	Shigella_phage	99.7	3.3e-178
VDZ09801.1|3666317_3666578_-|transposase	putative transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.1	1.5e-22
VDZ09802.1|3667307_3667451_-	IS orf	NA	NA	NA	NA	NA
VDZ09803.1|3667545_3668412_-|transposase	IS3 element transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	3.3e-50
VDZ09804.1|3668408_3668708_-|transposase	transposase	transposase	NA	NA	NA	NA
VDZ09805.1|3669810_3670413_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ09806.1|3670405_3670819_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ09807.1|3670993_3671389_+	Polymer-forming cytoskeletal	NA	NA	NA	NA	NA
VDZ09808.1|3671393_3671519_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ09809.1|3671555_3671966_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ09810.1|3672075_3673137_+	putative signal transduction protein	NA	NA	NA	NA	NA
VDZ09811.1|3673727_3676736_-|transposase	transposase	transposase	Q1MVP5	Enterobacteria_phage	64.4	0.0e+00
VDZ09812.1|3676899_3677451_+	resolvase	NA	Q1MVP4	Enterobacteria_phage	81.8	1.7e-76
VDZ09813.1|3677466_3679563_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ09814.1|3680249_3680507_-	replication regulatory protein 1	NA	NA	NA	NA	NA
VDZ09815.1|3682116_3682305_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ09816.1|3682439_3682592_-	fertility inhibition protein	NA	NA	NA	NA	NA
VDZ09817.1|3682637_3683504_-|transposase	IS3 element transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
VDZ09818.1|3683500_3683800_-|transposase	transposase	transposase	NA	NA	NA	NA
VDZ09819.1|3683846_3684734_-	Ig domain-containing protein	NA	NA	NA	NA	NA
VDZ09820.1|3685848_3685950_+	small predicted membrane protein	NA	NA	NA	NA	NA
VDZ09821.1|3686310_3686577_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
VDZ09822.1|3686576_3686717_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
VDZ09823.1|3687802_3688345_+	putative fimbrial transcriptional regulator	NA	NA	NA	NA	NA
VDZ09824.1|3688419_3689007_+	fimbrillin	NA	NA	NA	NA	NA
VDZ09825.1|3689064_3689733_+	putative fimbrial protein	NA	NA	NA	NA	NA
VDZ09826.1|3689758_3692284_+	putative fimbrial outer membrane usher protein	NA	NA	NA	NA	NA
VDZ09827.1|3692273_3693917_+	putative fimbrial protein	NA	NA	NA	NA	NA
VDZ09828.1|3693885_3694596_+	putative fimbrial protein	NA	NA	NA	NA	NA
VDZ09829.1|3695485_3696100_-	integral membrane protein	NA	NA	NA	NA	NA
VDZ09830.1|3696517_3697207_+	putative xanthine dehydrogenase, iron-sulfur binding subunit	NA	NA	NA	NA	NA
VDZ09831.1|3697203_3698160_+	putative xanthine dehydrogenase, FAD-binding subunit	NA	NA	NA	NA	NA
VDZ09832.1|3698156_3700355_+	putative xanthine dehydrogenase, molybdenum-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
VDZ09833.1|3700364_3701321_+	xanthine dehydrogenase accessory factor	NA	NA	NA	NA	NA
VDZ09834.1|3701299_3701710_+	transcriptional regulator	NA	NA	NA	NA	NA
3701826:3701885	attL	TTTGATTTTAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAATGCG	NA	NA	NA	NA
VDZ09835.1|3702069_3703395_+|integrase	CP4-6 prophage phage integrase	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.0e-07
VDZ09836.1|3703511_3703952_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ09837.1|3703948_3704173_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ09838.1|3704291_3705146_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ09839.1|3705172_3705871_+	CP4-6 prophage; DNA-binding protein	NA	NA	NA	NA	NA
VDZ09840.1|3706142_3706769_+	CP4-6 prophage protein	NA	NA	NA	NA	NA
VDZ09841.1|3706859_3707591_-	type III restriction enzyme, res subunit	NA	NA	NA	NA	NA
VDZ09842.1|3707744_3708020_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
VDZ09843.1|3708064_3708442_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	99.2	8.4e-67
VDZ09844.1|3708785_3709790_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
VDZ09845.1|3709928_3710687_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
VDZ09846.1|3710691_3712302_-	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
VDZ09847.1|3712313_3713696_-	sugar (Glycoside-Pentoside-Hexuronide) transporter	NA	NA	NA	NA	NA
VDZ09848.1|3713922_3715890_-	dehydratase, YjhG/YagF family	NA	NA	NA	NA	NA
VDZ09849.1|3715904_3716813_-	CP4-6 prophage; lyase/synthase	NA	NA	NA	NA	NA
VDZ09850.1|3717119_3718262_+	CP4-6 prophage DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
VDZ09851.1|3718355_3718706_+	YagBYeeUYfjZ family protein	NA	NA	NA	NA	NA
VDZ09852.1|3718728_3719067_+|transposase	transposase IS3/IS911 family protein	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
VDZ09853.1|3719215_3719491_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
VDZ09854.1|3719535_3719913_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	99.2	8.4e-67
VDZ09855.1|3719914_3720277_+	ferric transporter subunit	NA	NA	NA	NA	NA
VDZ09856.1|3720288_3721335_+	Fe(3+) ions import ATP-binding protein fbpC	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
VDZ09857.1|3721443_3722376_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
VDZ09858.1|3722362_3723790_-	amino acid permease	NA	NA	NA	NA	NA
VDZ09859.1|3723842_3723932_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ09860.1|3724009_3724990_+|transposase	IS5 transposase and trans-activator	transposase	Q38213	Escherichia_phage	100.0	5.5e-187
VDZ09861.1|3725098_3726244_-	RNA-directed DNA polymerase	NA	A0A0U4J920	Pseudomonas_phage	34.2	6.8e-35
VDZ09862.1|3726835_3727075_-	IS911 orfA	NA	Q716C2	Shigella_phage	98.3	5.7e-29
VDZ09863.1|3727336_3728488_-|transposase	IS30 transposase encoded within prophage CP-933T	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
VDZ09864.1|3728444_3728813_-	CP4-6 prophage; partial regulator of insertion element IS911A	NA	Q716C1	Shigella_phage	97.7	7.2e-39
VDZ09865.1|3728908_3729802_+	CP4-6 prophage; putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
VDZ09866.1|3730130_3730994_+	CP4-6 prophage; putative GTP-binding protein	NA	NA	NA	NA	NA
VDZ09867.1|3731085_3731907_+	CP4-6 prophage protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
3736134:3736193	attR	TTTGATTTTAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAATGCG	NA	NA	NA	NA
>prophage 13
LR134083	Escherichia coli strain NCTC12655 genome assembly, chromosome: 1	4757324	4098063	4133962	4757324	transposase	Shigella_phage(50.0%)	35	NA	NA
VDZ10210.1|4098063_4099044_+|transposase	IS5 transposase and trans-activator	transposase	Q38213	Escherichia_phage	100.0	5.5e-187
VDZ10211.1|4101657_4102374_+	N-acetylneuraminic acid outer membrane porin	NA	NA	NA	NA	NA
VDZ10212.1|4102393_4103500_+	N-acetylneuraminic acid mutarotase	NA	NA	NA	NA	NA
VDZ10213.1|4103564_4104545_+	YjhS protein	NA	Q08JA2	Stx2-converting_phage	56.6	4.7e-101
VDZ10214.1|4105127_4106144_-	Putative phospholipase D	NA	NA	NA	NA	NA
VDZ10215.1|4107105_4107363_+	putative xanthine dehydrogenase, Fe-S subunit	NA	NA	NA	NA	NA
VDZ10216.1|4107374_4107920_+	putative acetyltransferase	NA	NA	NA	NA	NA
VDZ10217.1|4107975_4108722_+	methyltransferase	NA	NA	NA	NA	NA
VDZ10218.1|4109507_4110629_+	endoglucanase with Zn-dependent exopeptidase domain	NA	NA	NA	NA	NA
VDZ10219.1|4110625_4110904_+	PTS system IIB component	NA	NA	NA	NA	NA
VDZ10220.1|4110915_4112229_+	PTS system IIC component	NA	NA	NA	NA	NA
VDZ10221.1|4112241_4113048_+	nucleoside triphosphatase	NA	NA	NA	NA	NA
VDZ10222.1|4113178_4113610_+	PTS system IIA component	NA	NA	NA	NA	NA
VDZ10223.1|4113621_4114254_+	putative ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
VDZ10224.1|4114270_4115053_+	putative transcriptional repressor	NA	NA	NA	NA	NA
VDZ10225.1|4115355_4116144_+	putative transcriptional regulator	NA	NA	NA	NA	NA
VDZ10226.1|4116094_4117054_+	putative dihydrodipicolinate synthetase	NA	NA	NA	NA	NA
VDZ10227.1|4117064_4119032_+	dehydratase	NA	NA	NA	NA	NA
VDZ10228.1|4119138_4120488_+	putative transport protein	NA	NA	NA	NA	NA
VDZ10229.1|4120834_4121821_+	putative transcriptional regulator	NA	NA	NA	NA	NA
VDZ10230.1|4121934_4122144_-|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	98.6	2.2e-32
VDZ10231.1|4122144_4122438_-	IS1 protein InsB	NA	U5P0U6	Shigella_phage	89.0	4.2e-42
VDZ10232.1|4122923_4123445_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
VDZ10233.1|4123441_4124395_+	iron(III) dicitrate sensor protein	NA	NA	NA	NA	NA
VDZ10234.1|4124481_4126806_+	iron(III) dicitrate TonB-dependent receptor	NA	NA	NA	NA	NA
VDZ10235.1|4126850_4127753_+	iron-dicitrate transporter substrate-binding subunit	NA	NA	NA	NA	NA
VDZ10236.1|4127749_4128748_+	iron(III) dicitrate transport system, permease protein	NA	NA	NA	NA	NA
VDZ10237.1|4128744_4129701_+	iron-dicitrate transporter subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	8.2e-18
VDZ10238.1|4129701_4130469_+	iron(III) dicitrate transport system, ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
VDZ10239.1|4131025_4131283_-	KpLE2 phage-like element	NA	NA	NA	NA	NA
VDZ10240.1|4131365_4131608_-|transposase	putative transposase	transposase	Q716C2	Shigella_phage	92.4	4.7e-39
VDZ10241.1|4131604_4132018_-|transposase	transposase	transposase	Q716C2	Shigella_phage	97.4	1.0e-62
VDZ10242.1|4132216_4132585_+|transposase	transposase IS3/IS911 family protein	transposase	NA	NA	NA	NA
VDZ10243.1|4132541_4133693_+|transposase	IS30 transposase encoded within prophage CP-933T	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
VDZ10244.1|4133695_4133962_-	IS911 protein	NA	Q716C1	Shigella_phage	97.7	1.3e-37
