The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134206	Klebsiella aerogenes strain NCTC9667 genome assembly, chromosome: 1	5284076	994	12600	5284076	tail	Cronobacter_phage(33.33%)	13	NA	NA
VEB96507.1|994_1207_+	Haemolysin XhlA	NA	H6WRV2	Salmonella_phage	58.8	1.0e-13
VEB96508.1|1279_1621_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB96509.1|2761_4024_+|tail	tail length tape measure protein	tail	Q5G8W8	Enterobacteria_phage	79.7	4.4e-120
VEB96511.1|4047_4947_+|tail	Phage tail length tape-measure protein 1	tail	R9TMK1	Aeromonas_phage	68.8	2.4e-88
VEB96512.1|5216_5435_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB96514.1|5713_6175_+	phage tape measure protein	NA	F1C5E9	Cronobacter_phage	51.4	2.2e-24
VEB96516.1|6215_6395_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB96519.1|6371_6638_-	Domain of uncharacterised function (DUF1883)	NA	NA	NA	NA	NA
VEB96521.1|6751_7228_+	Uncharacterised protein	NA	A0A2P1MXB5	Escherichia_phage	47.7	4.3e-36
VEB96523.1|7227_7698_+	Uncharacterised protein	NA	R9TPR6	Aeromonas_phage	40.4	9.6e-28
VEB96525.1|7694_8090_+	NlpC/P60 family.	NA	F1C5F2	Cronobacter_phage	55.6	1.2e-36
VEB96527.1|8076_10554_+	Uncharacterised protein	NA	F1C5A7	Cronobacter_phage	44.9	3.9e-197
VEB96529.1|10623_12600_+	Uncharacterised protein	NA	H6X4Y6	Enterobacteria_phage	33.3	3.7e-57
>prophage 2
LR134206	Klebsiella aerogenes strain NCTC9667 genome assembly, chromosome: 1	5284076	491011	500475	5284076	tRNA,protease	Dickeya_phage(16.67%)	8	NA	NA
VEB97523.1|491011_492127_+	Macrolide-specific efflux protein MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
VEB97525.1|492123_494064_+	Macrolide export ATP-binding/permease protein MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
VEB97527.1|494140_494362_-	cold-shock DNA-binding protein family protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
VEB97529.1|494687_495005_+|protease	ATP-dependent Clp protease adaptor protein ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
VEB97531.1|495035_497315_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
VEB97533.1|497435_497654_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
VEB97535.1|498007_498709_-|tRNA	Leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
VEB97537.1|498753_500475_-	Transport ATP-binding protein CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 3
LR134206	Klebsiella aerogenes strain NCTC9667 genome assembly, chromosome: 1	5284076	504487	515476	5284076	tRNA	Escherichia_phage(50.0%)	10	NA	NA
VEB97545.1|504487_508741_+	cell division protein	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
VEB97547.1|508862_509474_+	Outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
VEB97550.1|509538_510159_+	recombination factor protein RarA	NA	G3MBE0	Bacillus_virus	44.1	2.2e-40
VEB97552.1|510178_510619_+	recombination factor protein RarA	NA	NA	NA	NA	NA
VEB97554.1|510618_510843_+	recombination factor protein RarA	NA	NA	NA	NA	NA
VEB97556.1|510916_512209_+|tRNA	seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
VEB97558.1|512409_513867_+	anaerobic dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.9	9.0e-125
VEB97560.1|513826_513949_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB97562.1|514179_514848_+	anaerobic dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.3	2.2e-54
VEB97564.1|514858_515476_+	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.1	2.6e-73
>prophage 4
LR134206	Klebsiella aerogenes strain NCTC9667 genome assembly, chromosome: 1	5284076	767346	830240	5284076	tail,head,capsid,terminase,portal,plate,tRNA	Enterobacteria_phage(48.48%)	72	NA	NA
VEB98067.1|767346_768513_-|tRNA	tRNA-specific 2-thiouridylase mnmA	tRNA	NA	NA	NA	NA
VEB98069.1|768509_768968_-	Nudix-like NDP and NTP phosphohydrolase YmfB	NA	NA	NA	NA	NA
VEB98071.1|768984_769635_-	pseudouridine synthase	NA	NA	NA	NA	NA
VEB98073.1|769875_771126_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
VEB98075.1|771398_772112_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
VEB98077.1|772108_772501_-	amino acid-binding ACT domain-containing protein	NA	NA	NA	NA	NA
VEB98079.1|772493_772817_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
VEB98081.1|773265_773493_-	Uncharacterized protein conserved in bacteria	NA	NA	NA	NA	NA
VEB98083.1|773605_774799_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
VEB98085.1|775421_775607_+	Stress-induced bacterial acidophilic repeat motif.	NA	NA	NA	NA	NA
VEB98087.1|775697_776192_+	protein YciF	NA	NA	NA	NA	NA
VEB98089.1|776218_776725_+	protein YciE	NA	NA	NA	NA	NA
VEB98091.1|776741_777629_+	manganese catalase	NA	NA	NA	NA	NA
VEB98093.1|777684_779091_+	cytochrome bd ubiquinol oxidase, subunit I	NA	NA	NA	NA	NA
VEB98095.1|779087_780098_+	cytochrome bd-I oxidase subunit II	NA	NA	NA	NA	NA
VEB98097.1|780213_780411_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB98099.1|780786_780891_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB98101.1|780977_781610_+	DNA-binding protein	NA	NA	NA	NA	NA
VEB98104.1|782226_782913_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
VEB98106.1|783223_784732_-	protein YigC	NA	NA	NA	NA	NA
VEB98108.1|784852_785743_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEB98110.1|785749_787534_-	Diguanylate cyclase DosC	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
VEB98112.1|787607_787883_-	HD-GYP domain	NA	NA	NA	NA	NA
VEB98114.1|787837_788815_-	HD-GYP domain	NA	NA	NA	NA	NA
VEB98116.1|789117_790161_+	type II L-asparaginase	NA	NA	NA	NA	NA
VEB98118.1|790822_791737_+	Lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
VEB98120.1|791826_792465_+	Putative transport protein	NA	NA	NA	NA	NA
VEB98122.1|792595_792712_+	putative inner membrane protein	NA	NA	NA	NA	NA
VEB98124.1|792750_792858_+	putative inner membrane protein	NA	NA	NA	NA	NA
VEB98126.1|793234_793336_-	membrane protein	NA	NA	NA	NA	NA
VEB98128.1|793393_794407_-	Probable diguanylate cyclase YeaP	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
VEB98130.1|794672_795656_-	tyrosine recombinase XerC	NA	Q83VS6	Escherichia_phage	79.8	3.2e-150
VEB98132.1|796191_796470_+	bacteriophage P2 Cox-like protein	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
VEB98134.1|796490_796709_+	Uncharacterised protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
VEB98136.1|796724_797102_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB98138.1|797117_797381_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB98140.1|797680_798247_+	phage protein	NA	D4HTX2	Vibrio_phage	33.2	1.2e-13
VEB98142.1|798255_798483_+	Uncharacterised protein	NA	A0A286S1P6	Klebsiella_phage	41.0	1.9e-05
VEB98144.1|798479_799367_+	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	55.4	4.7e-84
VEB98146.1|799610_801641_+	bacteriophage replication gene A	NA	A0A1S6L028	Salmonella_phage	63.1	9.3e-237
VEB98148.1|802082_802577_+	Protein of uncharacterised function DUF91	NA	NA	NA	NA	NA
VEB98150.1|802696_804196_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB98152.1|804797_805316_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB98154.1|805318_806518_-	Predicted ATP-binding protein involved in virulence	NA	A0A0P0IKU8	Acinetobacter_phage	31.7	9.9e-53
VEB98156.1|806971_808024_-|portal	phage portal protein, PBSX family	portal	A0A0A7NPT9	Enterobacteria_phage	68.4	3.1e-143
VEB98158.1|808026_809754_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	68.4	8.2e-234
VEB98160.1|809910_810750_+|capsid	capsid scaffolding	capsid	A0A0A7NRY7	Enterobacteria_phage	65.9	2.8e-94
VEB98162.1|810759_811794_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	6.2e-96
VEB98164.1|811843_812710_+|terminase	small terminase subunit	terminase	A0A0A7NPX9	Enterobacteria_phage	58.1	2.2e-70
VEB98166.1|812814_813330_+|head	head completion protein	head	A0A0A7NPU2	Enterobacteria_phage	50.0	3.7e-41
VEB98168.1|813329_813530_+|tail	tail X family protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
VEB98170.1|813526_813805_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB98172.1|813801_814347_+	lysozyme from lambdoid prophage DLP12	NA	Q1I0Z1	Pasteurella_virus	43.0	3.7e-31
VEB98174.1|814548_814869_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB98176.1|814869_815337_+|tail	P2 phage tail completion R family protein	tail	A0A0A7NPU6	Enterobacteria_phage	59.5	7.0e-47
VEB98178.1|815333_815969_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.9	4.6e-57
VEB98180.1|815965_816553_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.5	6.9e-60
VEB98182.1|816549_816900_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	54.8	1.6e-27
VEB98184.1|816901_817825_+|plate	Baseplate J family protein	plate	A0A0A7NPY5	Enterobacteria_phage	44.6	6.9e-54
VEB98186.1|817814_819449_+	phage Tail protein I	NA	D5LGZ2	Escherichia_phage	40.7	3.4e-24
VEB98188.1|820001_820607_+	bacterial surface protein 26-residue repeat	NA	NA	NA	NA	NA
VEB98190.1|820833_821046_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB98192.1|821045_821684_+	Tail Fiber protein	NA	G4KKN6	Yersinia_phage	34.1	2.7e-09
VEB98194.1|821803_822139_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB98196.1|822280_822949_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB98198.1|822974_823118_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB98200.1|823613_823763_-	P2 GpU family protein	NA	A0A0A7NV65	Enterobacteria_phage	73.5	7.7e-08
VEB98202.1|824147_826751_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	47.9	3.3e-186
VEB98204.1|826894_827212_-|tail	tail E family protein	tail	B9A7B2	Serratia_phage	54.8	1.0e-17
VEB98206.1|827257_827773_-|tail	major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.8	2.2e-57
VEB98208.1|827772_828945_-|tail	major tail sheath protein FI	tail	A0A0A7NV69	Enterobacteria_phage	70.7	3.8e-158
VEB98210.1|829100_830240_+	late control D family protein	NA	B9A7A9	Serratia_phage	70.7	1.6e-145
>prophage 5
LR134206	Klebsiella aerogenes strain NCTC9667 genome assembly, chromosome: 1	5284076	1220239	1231125	5284076		Escherichia_phage(88.89%)	10	NA	NA
VEB99031.1|1220239_1220860_-	Ribulose-5-phosphate 4-epimerase and related epimerases and aldolases	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
VEB99033.1|1220852_1222118_-	Predicted pyridoxine biosynthesis protein (probably from glycolaldehide)	NA	A0A077SLJ7	Escherichia_phage	99.5	3.9e-233
VEB99035.1|1222129_1223032_-	2-hydroxy-3-oxopropionate reductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
VEB99037.1|1223291_1224053_+	DeoR-family trancriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
VEB99040.1|1224073_1224934_-	Beta-lactamase	NA	A0A077SL40	Escherichia_phage	99.3	9.9e-156
VEB99042.1|1225231_1225492_+	Uncharacterised protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
VEB99044.1|1225578_1226352_+	putative RecF protein	NA	A0A077SLJ9	Escherichia_phage	95.5	8.7e-135
VEB99046.1|1226354_1226666_+	putative RecF protein	NA	A0A077SLJ9	Escherichia_phage	100.0	4.1e-51
VEB99048.1|1226696_1227647_-	Lactose permease	NA	NA	NA	NA	NA
VEB99050.1|1228017_1231125_-	Beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 6
LR134206	Klebsiella aerogenes strain NCTC9667 genome assembly, chromosome: 1	5284076	2222731	2229271	5284076		Bacillus_phage(33.33%)	7	NA	NA
VEC00986.1|2222731_2223844_+	Sensory histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	6.4e-30
VEC00988.1|2223840_2224563_+	DNA-binding transcriptional regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
VEC00990.1|2225039_2226245_+	peptidase U32	NA	Q6DW11	Phage_TP	94.8	1.6e-207
VEC00992.1|2226487_2227384_+	Transcription regulator [contains diacylglycerol kinase catalytic domain]	NA	A0A1V0SBJ0	Catovirus	29.8	1.6e-15
VEC00994.1|2227624_2228398_-	ABC transporter	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
VEC00996.1|2228408_2228672_-	ABC transporter	NA	NA	NA	NA	NA
VEC00998.1|2228623_2229271_-	ABC transporter	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.0	2.2e-06
>prophage 7
LR134206	Klebsiella aerogenes strain NCTC9667 genome assembly, chromosome: 1	5284076	3407586	3423361	5284076	protease	uncultured_Mediterranean_phage(100.0%)	22	NA	NA
VEC03008.1|3407586_3407736_-|protease	ClpXP protease specificity-enhancing factor / Stringent starvation protein B	protease	NA	NA	NA	NA
VEC03009.1|3407881_3408520_-	stringent starvation protein A	NA	NA	NA	NA	NA
VEC03010.1|3408830_3409223_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
VEC03011.1|3409238_3409667_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
VEC03012.1|3409932_3411060_-	ATPase, AFG1 family	NA	NA	NA	NA	NA
VEC03013.1|3411250_3411649_+	cytochrome d ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
VEC03014.1|3411821_3413189_+|protease	Outer membrane stress sensor protease DegQ, serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
VEC03015.1|3413276_3414335_+|protease	Outer membrane stress sensor protease DegS	protease	NA	NA	NA	NA
VEC03016.1|3414471_3415410_-	malate dehydrogenase	NA	NA	NA	NA	NA
VEC03017.1|3415824_3416295_+	arginine repressor	NA	NA	NA	NA	NA
VEC03018.1|3416669_3416933_+	Protein of uncharacterised function (DUF1471).	NA	NA	NA	NA	NA
VEC03019.1|3417031_3417298_+	probable exported protein YPO3518	NA	NA	NA	NA	NA
VEC03020.1|3417348_3417624_-	probable ribonuclease inhibitor YPO3690	NA	NA	NA	NA	NA
VEC03021.1|3417703_3418180_-	FUSARIC ACID RESISTANCE PROTEIN FUSB / FUSARIC ACID RESISTANCE PROTEIN FUSC	NA	NA	NA	NA	NA
VEC03022.1|3418179_3419670_-	FUSARIC ACID RESISTANCE PROTEIN FUSB / FUSARIC ACID RESISTANCE PROTEIN FUSC	NA	NA	NA	NA	NA
VEC03023.1|3419675_3420608_-	Fusaric acid resistance protein fusE	NA	NA	NA	NA	NA
VEC03024.1|3420635_3420818_-	probable membrane protein YPO3684	NA	NA	NA	NA	NA
VEC03025.1|3420949_3421606_+	transcriptional regulator	NA	NA	NA	NA	NA
VEC03026.1|3421602_3421878_+	transcriptional regulator	NA	NA	NA	NA	NA
VEC03027.1|3421913_3422363_-|protease	protease TldD	protease	NA	NA	NA	NA
VEC03028.1|3422352_3422622_-|protease	protease TldD	protease	NA	NA	NA	NA
VEC03029.1|3422572_3423361_-|protease	protease TldD	protease	NA	NA	NA	NA
>prophage 8
LR134206	Klebsiella aerogenes strain NCTC9667 genome assembly, chromosome: 1	5284076	4097897	4103991	5284076		Moumouvirus(14.29%)	9	NA	NA
VEC03691.1|4097897_4098593_+	UDP-N-acetylglucosamine 2-epimerase	NA	A0A2P1ELS7	Moumouvirus	30.5	9.8e-13
VEC03692.1|4098565_4098982_+	UDP-N-acetylglucosamine 2-epimerase	NA	A0A1V0SAG5	Catovirus	42.3	5.7e-08
VEC03693.1|4098978_4099305_+	UDP-glucose dehydrogenase	NA	NA	NA	NA	NA
VEC03694.1|4099259_4100240_+	UDP-glucose dehydrogenase	NA	M1H3J6	Paramecium_bursaria_Chlorella_virus	27.1	9.3e-17
VEC03695.1|4100236_4100470_+	dTDP-glucose 4,6-dehydratase	NA	M1H4P8	Acanthocystis_turfacea_Chlorella_virus	45.9	1.1e-05
VEC03696.1|4100469_4101303_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	58.8	1.6e-86
VEC03697.1|4101321_4102203_+	Glucose-1-phosphate thymidylyltransferase	NA	A0A291LA53	Escherichia_phage	67.4	6.0e-108
VEC03698.1|4102180_4102855_+	Lipopolysaccharide biosynthesis protein RffC	NA	NA	NA	NA	NA
VEC03699.1|4102860_4103991_+	4-keto-6-deoxy-N-Acetyl-D-hexosaminyl-(Lipid carrier) aminotransferase	NA	A0A0F7LAY0	uncultured_marine_virus	40.9	3.3e-18
>prophage 9
LR134206	Klebsiella aerogenes strain NCTC9667 genome assembly, chromosome: 1	5284076	5071101	5079622	5284076		Bacillus_phage(50.0%)	7	NA	NA
VEC04647.1|5071101_5071287_-	DNA recombinase	NA	A0A222YY21	Escherichia_phage	72.4	1.1e-16
VEC04648.1|5071261_5072014_-	DNA recombinase	NA	S4TWL4	Salmonella_phage	63.5	4.1e-81
VEC04649.1|5072105_5073020_+	ROK family protein	NA	NA	NA	NA	NA
VEC04650.1|5073093_5076231_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	24.9	1.0e-08
VEC04651.1|5076227_5077433_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	35.5	1.8e-06
VEC04652.1|5077615_5078305_+	transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	37.6	3.7e-36
VEC04653.1|5078326_5079622_+	Phosphate regulon sensor protein PhoR (SphS)	NA	W8CYF6	Bacillus_phage	30.0	2.2e-26
>prophage 10
LR134206	Klebsiella aerogenes strain NCTC9667 genome assembly, chromosome: 1	5284076	5226581	5269658	5284076	integrase,lysis,tRNA,tail	Salmonella_phage(26.42%)	67	5229399:5229443	5276812:5276856
VEC04803.1|5226581_5227145_+|tRNA	cysteinyl-tRNA synthetase	tRNA	A0A2K9L6B7	Tupanvirus	36.7	1.6e-21
VEC04804.1|5227141_5227297_+|tRNA	cysteinyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VEC04805.1|5227545_5227737_+|tRNA	cysteinyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VEC04806.1|5228159_5229026_-	bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/ 5,10-methylene-tetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
5229399:5229443	attL	TTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCAT	NA	NA	NA	NA
VEC04807.1|5229457_5230621_-|integrase	phage integrase family protein	integrase	G8C7S0	Escherichia_phage	86.8	2.5e-202
VEC04808.1|5230834_5231053_-	phage/conjugal plasmid C-4 type zinc finger protein, TraR family	NA	A0A0K2FI84	Escherichia_phage	52.2	2.0e-12
VEC04809.1|5231049_5231586_-	Uncharacterised protein	NA	J9Q748	Salmonella_phage	74.9	7.2e-72
VEC04810.1|5231582_5231804_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC04811.1|5231800_5232970_-	DNA (cytosine-5-)-methyltransferase	NA	Q858D4	Salmonella_phage	67.5	9.7e-146
VEC04812.1|5233522_5234146_-	exodeoxyribonuclease (lambda-induced)	NA	A0A0S2SY31	Pseudomonas_phage	60.2	3.1e-58
VEC04813.1|5234198_5234888_-	Recombination protein BET	NA	A0A0M4RD39	Salmonella_phage	66.1	5.1e-62
VEC04814.1|5235012_5235189_-	Uncharacterised protein	NA	M9NZI3	Enterobacteria_phage	62.2	3.7e-09
VEC04815.1|5235468_5235579_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC04816.1|5236014_5236134_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC04817.1|5236156_5236477_-	putative phage repressor protein CI	NA	Q76H56	Enterobacteria_phage	93.4	1.5e-53
VEC04818.1|5236947_5237175_+	regulatory protein	NA	A0A2I6PIE5	Escherichia_phage	61.2	5.6e-18
VEC04819.1|5237214_5237436_+	bacteriophage CII family protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
VEC04820.1|5237569_5238298_+	PaaX family transcriptional regulator	NA	H9C164	Pectobacterium_phage	73.0	7.8e-37
VEC04821.1|5238294_5239071_+	replication P family protein	NA	A0A193GYX1	Enterobacter_phage	64.6	1.5e-94
VEC04822.1|5239070_5239373_+	Uncharacterized protein conserved in archaea	NA	NA	NA	NA	NA
VEC04823.1|5239369_5239792_+	Uncharacterised protein	NA	A0A193GYX5	Enterobacter_phage	74.4	1.3e-12
VEC04824.1|5239788_5239995_+	Uncharacterised protein	NA	R9TRD3	Aeromonas_phage	98.5	3.6e-32
VEC04825.1|5239991_5240723_+	Uncharacterised protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	81.1	9.6e-35
VEC04826.1|5240722_5240911_+	Uncharacterised protein	NA	A0A192Y8X2	Salmonella_phage	90.3	2.2e-23
VEC04827.1|5240914_5241577_+	Protein of uncharacterised function (DUF551)	NA	A0A0H4IU61	Shigella_phage	34.5	2.5e-21
VEC04828.1|5241569_5241851_+	Uncharacterised protein	NA	A0A220NQY7	Salmonella_phage	39.2	4.0e-05
VEC04829.1|5242594_5243191_+	Protein of uncharacterised function (DUF1367)	NA	A0A0U2RT94	Escherichia_phage	53.8	1.2e-56
VEC04830.1|5243190_5243367_+	prophage protein NinE	NA	G8C7V4	Escherichia_phage	71.4	3.8e-14
VEC04831.1|5243359_5243998_+	NinG-like phage protein	NA	H6WRY9	Salmonella_phage	68.4	3.5e-73
VEC04832.1|5243994_5244135_+	Gifsy-1 Prophage protein	NA	NA	NA	NA	NA
VEC04833.1|5244131_5244632_+	antitermination protein	NA	G8C7V7	Escherichia_phage	92.1	2.5e-87
VEC04834.1|5245704_5245953_+|lysis	lysis S family protein	lysis	NA	NA	NA	NA
VEC04835.1|5245955_5246486_+	Phage lysin	NA	K7PLY1	Enterobacteria_phage	79.4	4.2e-80
VEC04836.1|5246690_5247011_+	Uncharacterised protein	NA	Q8SBD8	Shigella_phage	72.1	2.7e-34
VEC04837.1|5247075_5247294_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC04838.1|5247419_5248055_+	Uncharacterised protein	NA	I6S676	Salmonella_phage	80.2	5.1e-101
VEC04839.1|5248085_5248544_+	phage protein	NA	I6S1P9	Salmonella_phage	86.8	1.7e-69
VEC04840.1|5248536_5249790_+	phage Terminase Large Subunit	NA	I6RSK1	Salmonella_phage	97.0	1.5e-213
VEC04841.1|5250130_5251528_+	gp5	NA	Q5G8Y4	Enterobacteria_phage	90.4	3.4e-238
VEC04842.1|5251524_5252367_+	gp6	NA	Q5G8Y3	Enterobacteria_phage	91.8	1.1e-146
VEC04843.1|5252369_5253635_+	gp7	NA	Q5G8Y2	Enterobacteria_phage	90.7	2.4e-219
VEC04844.1|5253647_5254097_+	gp8	NA	I6S1Q2	Salmonella_phage	85.2	7.1e-65
VEC04845.1|5254114_5255191_+	gp9	NA	Q5G8Y0	Enterobacteria_phage	91.6	9.1e-191
VEC04846.1|5255200_5255494_+	gp10	NA	A0A1V0E5P8	Salmonella_phage	87.6	3.6e-41
VEC04847.1|5255560_5255962_+	gp11	NA	G0ZNE1	Cronobacter_phage	72.9	3.6e-52
VEC04848.1|5255961_5256135_+	gp12	NA	I6R0P9	Salmonella_phage	59.6	2.9e-14
VEC04849.1|5256134_5256497_+	Uncharacterised protein	NA	A0A0M3LSC9	Mannheimia_phage	49.2	1.6e-19
VEC04850.1|5256499_5256868_+	Uncharacterised protein	NA	F1C5E3	Cronobacter_phage	82.8	1.1e-47
VEC04851.1|5256864_5257248_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC04852.1|5257306_5258071_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	43.6	2.1e-40
VEC04853.1|5258138_5258432_+	Uncharacterised protein	NA	G0ZNE7	Cronobacter_phage	66.7	2.8e-17
VEC04854.1|5258549_5258858_+	Uncharacterised protein	NA	F1C5E8	Cronobacter_phage	64.6	2.7e-23
VEC04855.1|5259278_5259551_+	ORF45	NA	A0A1V0E5P7	Salmonella_phage	91.1	2.5e-41
VEC04856.1|5260105_5260318_+	Haemolysin XhlA	NA	H6WRV2	Salmonella_phage	58.8	1.0e-13
VEC04857.1|5260390_5260702_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC04858.1|5260720_5261812_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC04859.1|5261877_5262693_+|tail	tail length tape measure protein	tail	Q5G8W8	Enterobacteria_phage	79.3	2.0e-105
VEC04860.1|5262749_5263565_+|tail	Phage tail length tape-measure protein 1	tail	R9TMK1	Aeromonas_phage	63.1	1.1e-31
VEC04861.1|5263519_5264062_+	Uncharacterised protein	NA	R9TMK1	Aeromonas_phage	81.3	2.5e-48
VEC04862.1|5264078_5264747_+	phage tape measure protein	NA	Q5G8W8	Enterobacteria_phage	59.0	3.7e-49
VEC04863.1|5265041_5265260_+	phage tape measure protein	NA	F1C5E9	Cronobacter_phage	41.9	3.6e-06
VEC04864.1|5265325_5265505_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC04865.1|5265492_5265795_-	Domain of uncharacterised function (DUF1883)	NA	NA	NA	NA	NA
VEC04866.1|5266332_5266803_+	Uncharacterised protein	NA	R9TPR6	Aeromonas_phage	40.4	9.6e-28
VEC04867.1|5266799_5267195_+	NlpC/P60 family.	NA	F1C5F2	Cronobacter_phage	55.6	1.2e-36
VEC04868.1|5267181_5267610_+	Uncharacterised protein	NA	R9TR21	Aeromonas_phage	43.9	1.3e-15
VEC04869.1|5267768_5269658_+	Uncharacterised protein	NA	F1C5A7	Cronobacter_phage	45.2	9.5e-151
5276812:5276856	attR	TTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCAT	NA	NA	NA	NA
>prophage 1
LR134207	Klebsiella aerogenes strain NCTC9667 genome assembly, plasmid: 2	223253	81954	174588	223253	integrase,protease,transposase	Stx2-converting_phage(21.88%)	86	76251:76268	113512:113529
76251:76268	attL	AAAAGTAACTTTTCTATC	NA	NA	NA	NA
VEC04979.1|81954_82611_-|transposase	putative transposase	transposase	Q9ZXG3	Shigella_phage	84.9	5.3e-109
VEC04980.1|82817_82955_-|transposase	IS2 transposase orfA	transposase	Q76S41	Shigella_phage	91.1	4.6e-15
VEC04981.1|83197_83965_+	Transposase	NA	A0A1S7J231	Thermus_phage	27.6	5.6e-09
VEC04982.1|83979_84165_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC04983.1|84174_84348_-|transposase	IS2 transposase orfA	transposase	Q76S41	Shigella_phage	94.5	1.4e-21
VEC04984.1|84730_85108_+|transposase	IS1 transposase orfB	transposase	Q71TF0	Escherichia_phage	92.7	2.1e-62
VEC04985.1|85528_86065_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC04986.1|86061_86265_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC04987.1|86344_86827_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC04988.1|86875_88021_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
VEC04989.1|88070_89519_+	SsrAB activated protein	NA	NA	NA	NA	NA
VEC04990.1|89536_92611_+	virulence protein SrfB	NA	NA	NA	NA	NA
VEC04991.1|92603_95318_+	Virulence effector protein SrfC	NA	NA	NA	NA	NA
VEC04992.1|95311_95638_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC04993.1|95693_96332_+	Uncharacterized protein conserved in bacteria	NA	NA	NA	NA	NA
VEC04994.1|96328_97579_+	von Willebrand factor, type A	NA	NA	NA	NA	NA
VEC04995.1|97596_98298_+	von Willebrand factor, type A	NA	NA	NA	NA	NA
VEC04996.1|98297_99023_+	ABC transporter related	NA	G9BWD6	Planktothrix_phage	32.8	3.1e-17
VEC04997.1|99012_100227_+	acidobacterial duplicated orphan permease	NA	NA	NA	NA	NA
VEC04998.1|100277_101846_+	gliding motility-associated lipoprotein GldK	NA	NA	NA	NA	NA
VEC04999.1|101881_102385_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05000.1|102993_104586_-	Transposase and inactivated derivatives	NA	A0A0P0ZEB3	Stx2-converting_phage	61.8	3.2e-176
VEC05001.1|104616_104967_-	Transposase and inactivated derivatives	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
VEC05002.1|104963_105404_-	Transposase	NA	Q6H9S5	Enterobacteria_phage	60.3	2.6e-19
VEC05003.1|105635_105782_+	DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	60.0	2.6e-08
VEC05004.1|107329_108301_-	plasmid-partitioning protein SopB	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
VEC05005.1|108300_109467_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.2	7.5e-223
VEC05006.1|110196_111207_+	initiator RepB protein	NA	J9Q7H0	Salmonella_phage	53.5	1.1e-86
VEC05007.1|112027_112315_-|integrase	integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	54.9	8.4e-19
VEC05008.1|112299_112884_-|integrase	integrase family protein	integrase	NA	NA	NA	NA
VEC05009.1|113521_114058_-	Uncharacterised protein	NA	NA	NA	NA	NA
113512:113529	attR	GATAGAAAAGTTACTTTT	NA	NA	NA	NA
VEC05010.1|114045_114162_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05011.1|115308_116325_+|transposase	transposase	transposase	NA	NA	NA	NA
VEC05012.1|116513_117083_-|transposase	putative IS903 transposase	transposase	Q9MCT5	Escherichia_phage	97.9	1.2e-104
VEC05013.1|117991_119224_+	major facilitator superfamily protein	NA	NA	NA	NA	NA
VEC05014.1|119353_120421_+	isopropylmalate isomerase large subunit	NA	NA	NA	NA	NA
VEC05015.1|120744_121071_+	isopropylmalate isomerase small subunit	NA	NA	NA	NA	NA
VEC05016.1|121037_121400_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
VEC05017.1|121416_122286_+	5-oxopent-3-ene-1,2,5-tricarboxylate decarboxylase	NA	NA	NA	NA	NA
VEC05018.1|122378_123080_+	Haloalkane dehalogenase 1	NA	NA	NA	NA	NA
VEC05019.1|123285_124140_+	Positive regulator of Tartrate dehydrogenase/decarboxylase/D-malic enzyme	NA	NA	NA	NA	NA
VEC05020.1|124237_124450_-	Uncharacterised protein	NA	A0A0P0ZEB3	Stx2-converting_phage	98.6	6.2e-35
VEC05021.1|124567_125110_-	Transposase and inactivated derivatives	NA	A0A0P0ZEB3	Stx2-converting_phage	92.2	2.4e-83
VEC05022.1|125213_125774_-	Transposase and inactivated derivatives	NA	A0A0P0ZEB3	Stx2-converting_phage	95.0	5.2e-89
VEC05023.1|125822_126170_-	Transposase and inactivated derivatives	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
VEC05024.1|126166_126571_-|transposase	IS2 transposase orfA	transposase	A0A0P0ZCV4	Stx2-converting_phage	97.0	2.1e-68
VEC05025.1|127302_127482_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05026.1|128940_129255_-	radical SAM protein	NA	NA	NA	NA	NA
VEC05027.1|129221_130103_-	radical SAM protein	NA	S5VT21	Leptospira_phage	31.5	7.0e-32
VEC05028.1|130698_130890_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05029.1|130904_131183_-	Transposase IS116/IS110/IS902 family	NA	NA	NA	NA	NA
VEC05030.1|131155_131644_-	Transposase	NA	A0A1S7J231	Thermus_phage	41.4	6.7e-08
VEC05031.1|133884_134133_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05032.1|134502_134940_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05033.1|135518_136091_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05034.1|136094_136469_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05035.1|139614_139806_-	Protein of uncharacterised function (DUF1656)	NA	NA	NA	NA	NA
VEC05036.1|139795_140311_-	protein YhcP	NA	NA	NA	NA	NA
VEC05037.1|141048_141327_-	protein YhcP	NA	NA	NA	NA	NA
VEC05038.1|141901_142708_+	protein YeaM	NA	NA	NA	NA	NA
VEC05039.1|142903_143113_-|transposase	IS1 transposase orfB	transposase	U5P0U6	Shigella_phage	98.6	1.7e-32
VEC05040.1|143739_144597_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEC05041.1|144689_145064_+	nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
VEC05042.1|145023_145683_+	nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
VEC05043.1|146021_146618_+|protease	ATP-dependent Clp protease ClpP	protease	A0A223W000	Agrobacterium_phage	36.9	1.9e-25
VEC05044.1|147659_147842_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05045.1|148669_149155_+|transposase	IS911 transposase orfB	transposase	Q716C2	Shigella_phage	62.0	1.9e-55
VEC05046.1|149528_150257_+	TonB-dependent copper receptor	NA	NA	NA	NA	NA
VEC05047.1|151414_151870_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
VEC05048.1|151923_152184_+	putative inner membrane protein	NA	NA	NA	NA	NA
VEC05049.1|152410_152518_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05050.1|152744_153623_+	iron aquisition regulator (YbtA,AraC-like, required for transcription of FyuA/psn,Irp2)	NA	NA	NA	NA	NA
VEC05051.1|153723_155400_+	cysteine/glutathione ABC transporter membrane /ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.9	7.9e-16
VEC05052.1|155389_157027_+	Inner membrane ABC-transporter YbtQ	NA	W8CYL7	Bacillus_phage	27.7	2.9e-15
VEC05053.1|157113_159252_+	TonB-dependent siderophore receptor	NA	A0A1B0VCF0	Salmonella_phage	25.3	3.1e-09
VEC05054.1|159251_159500_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05055.1|159496_160909_+	Uncharacterized iron-regulated membrane protein	NA	NA	NA	NA	NA
VEC05056.1|160921_162157_+	AmpG permease	NA	NA	NA	NA	NA
VEC05057.1|163294_164458_-	acyl-CoA thioester hydrolase	NA	A0A1J0GNR5	Mycobacterium_phage	30.6	1.4e-08
VEC05058.1|164509_165466_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEC05059.1|166734_167658_-|transposase	transposase	transposase	Q1MVF0	Enterobacteria_phage	96.4	1.1e-171
VEC05060.1|168285_168504_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05061.1|168759_169401_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05062.1|170457_171990_+	Transposase and inactivated derivatives	NA	A0A1B1P773	Bacillus_phage	39.8	4.1e-51
VEC05063.1|172147_172630_-	acetyltransferase	NA	NA	NA	NA	NA
VEC05064.1|174396_174588_+|transposase	putative transposase	transposase	Q9MCT5	Escherichia_phage	97.4	3.9e-12
>prophage 2
LR134207	Klebsiella aerogenes strain NCTC9667 genome assembly, plasmid: 2	223253	180177	188269	223253	transposase	Stx2-converting_phage(37.5%)	11	NA	NA
VEC05071.1|180177_180318_-|transposase	putative transposase	transposase	Q9MCT5	Escherichia_phage	87.0	6.7e-14
VEC05072.1|180383_181100_-|transposase	transposase	transposase	Q1MVF0	Enterobacteria_phage	91.3	3.3e-112
VEC05073.1|181291_181609_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
VEC05074.1|181708_182020_-	mRNA interferase HigB	NA	NA	NA	NA	NA
VEC05075.1|182152_182713_-|transposase	putative transposase	transposase	Q9ZXG3	Shigella_phage	83.0	9.8e-72
VEC05076.1|182775_183114_+	Transposase	NA	A0A0P0ZBP6	Stx2-converting_phage	81.0	2.3e-47
VEC05077.1|183110_183458_+	Transposase and inactivated derivatives	NA	A0A0P0ZDM8	Stx2-converting_phage	94.8	1.3e-58
VEC05078.1|183506_184109_+	Transposase and inactivated derivatives	NA	A0A0P0ZEB3	Stx2-converting_phage	92.4	4.0e-95
VEC05079.1|184826_186215_-	protein YdcR	NA	A0A1X9I5H2	Streptococcus_phage	23.3	7.0e-10
VEC05080.1|186361_187150_+	N-hydroxyarylamine O-acetyltransferase	NA	NA	NA	NA	NA
VEC05081.1|187594_188269_+|transposase	transposase	transposase	Q9MCT5	Escherichia_phage	97.7	5.6e-122
