The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134209	Escherichia coli strain NCTC11476 genome assembly, chromosome: 1	4809759	48047	57673	4809759	integrase	Enterobacteria_phage(100.0%)	10	48105:48118	62445:62458
VEC06876.1|48047_50381_-	putative prophage DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
48105:48118	attL	CAGCGTCAGGTTGG	NA	NA	NA	NA
VEC06878.1|50395_50716_-	P4 phage protein	NA	NA	NA	NA	NA
VEC06880.1|50851_51307_-	putative prophage protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
VEC06882.1|51299_51587_-	prophage derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
VEC06884.1|52175_52442_-	prophage regulatory protein	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
VEC06886.1|52995_53730_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.0	1.1e-128
VEC06888.1|53726_54227_+	transcriptional activator Ogr/delta	NA	NA	NA	NA	NA
VEC06890.1|54300_54873_+	prophage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	3.8e-95
VEC06892.1|55076_56498_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC06894.1|56497_57673_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	92.0	2.6e-207
62445:62458	attR	CAGCGTCAGGTTGG	NA	NA	NA	NA
>prophage 2
LR134209	Escherichia coli strain NCTC11476 genome assembly, chromosome: 1	4809759	1054481	1061621	4809759	tRNA	Escherichia_phage(83.33%)	6	NA	NA
VEC09033.1|1054481_1055120_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
VEC09035.1|1055116_1056379_-|tRNA	paral putative tRNA synthase	tRNA	A0A077SLJ7	Escherichia_phage	61.7	5.7e-136
VEC09037.1|1056375_1057284_-	oxidoreductase YgbJ	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
VEC09039.1|1057479_1058247_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
VEC09041.1|1058297_1058954_-	serine/threonine-specific protein phosphatase 2	NA	A0A222YWF0	Escherichia_phage	47.2	4.3e-50
VEC09043.1|1059059_1061621_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 3
LR134209	Escherichia coli strain NCTC11476 genome assembly, chromosome: 1	4809759	1134640	1142108	4809759	transposase,integrase	Escherichia_phage(66.67%)	6	1125505:1125518	1142418:1142431
1125505:1125518	attL	TACCGCCGCAGTCA	NA	NA	NA	NA
VEC09193.1|1134640_1135507_+|transposase	IS3 element transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
VEC09195.1|1135658_1137377_+	putative histidine kinase-like protein	NA	A0A1B5FPD5	Escherichia_phage	99.8	3.2e-307
VEC09197.1|1137378_1139127_+	Uncharacterised protein	NA	A0A1B5FPH1	Escherichia_phage	99.5	0.0e+00
VEC09199.1|1139198_1139615_-	Uncharacterised protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
VEC09201.1|1139653_1140883_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
VEC09203.1|1141625_1142108_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1142418:1142431	attR	TGACTGCGGCGGTA	NA	NA	NA	NA
>prophage 4
LR134209	Escherichia coli strain NCTC11476 genome assembly, chromosome: 1	4809759	1645335	1654776	4809759		Enterobacteria_phage(85.71%)	10	NA	NA
VEC10137.1|1645335_1646262_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.3	3.1e-22
VEC10142.1|1646266_1646998_+	ABC transporter permease	NA	NA	NA	NA	NA
VEC10144.1|1646978_1647086_-	putative inner membrane protein	NA	NA	NA	NA	NA
VEC10146.1|1647145_1647877_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
VEC10148.1|1648098_1649784_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
VEC10151.1|1649780_1650500_+	two-component response-regulatory protein YehT	NA	NA	NA	NA	NA
VEC10153.1|1650546_1651017_+	conserved protein, DUF1456 family	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
VEC10155.1|1651056_1651518_-	lipoprotein yehR	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
VEC10157.1|1651642_1653643_-	zinc finger SWIM domain-containing protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
VEC10159.1|1653639_1654776_-	von Willebrand factor type A domain protein YehP	NA	Q9EYF7	Enterobacteria_phage	97.1	3.6e-161
>prophage 5
LR134209	Escherichia coli strain NCTC11476 genome assembly, chromosome: 1	4809759	1667340	1733001	4809759	capsid,holin,tRNA,plate,terminase,integrase,tail,protease,lysis	Escherichia_phage(40.0%)	75	1694580:1694607	1727916:1727943
VEC10175.1|1667340_1669374_-|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	27.6	3.0e-54
VEC10177.1|1669505_1670615_+	ATPase	NA	NA	NA	NA	NA
VEC10179.1|1670877_1671159_+	fimbrial-like adhesin protein	NA	NA	NA	NA	NA
VEC10181.1|1671451_1671994_+	fimbrial protein	NA	NA	NA	NA	NA
VEC10183.1|1672073_1672748_+	putative periplasmic pilin chaperone	NA	NA	NA	NA	NA
VEC10185.1|1672763_1675244_+	fimbrial outer membrane usher protein	NA	NA	NA	NA	NA
VEC10187.1|1675257_1676292_+	putative fimbrial adhesin	NA	NA	NA	NA	NA
VEC10189.1|1676373_1676712_-	periplasmic modulator of Ni and Co efflux	NA	NA	NA	NA	NA
VEC10191.1|1676930_1677755_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
VEC10193.1|1677875_1678148_+	transcriptional repressor RcnR	NA	NA	NA	NA	NA
VEC10195.1|1678370_1679159_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
VEC10197.1|1679155_1679956_+	phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
VEC10199.1|1680020_1680839_+	1,4-beta-N-acetylmuramidase	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
VEC10201.1|1680890_1681637_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
VEC10203.1|1681610_1682576_-	putative carbohydrate/pyrimidine kinase	NA	NA	NA	NA	NA
VEC10205.1|1682572_1683577_-	putative ADP-ribosylglycohydrolase	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
VEC10207.1|1683573_1684851_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VEC10209.1|1685107_1686160_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
VEC10211.1|1686469_1687324_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
VEC10213.1|1687352_1688615_+	putative tagatose 6-phosphate kinase	NA	NA	NA	NA	NA
VEC10215.1|1688624_1689077_+	galactitol-specific PTS system EIIA component	NA	NA	NA	NA	NA
VEC10217.1|1689107_1689392_+	galactitol-specific PTS system EIIB component	NA	NA	NA	NA	NA
VEC10219.1|1689395_1690751_+	galactitol-specific PTS system EIIC component	NA	NA	NA	NA	NA
VEC10222.1|1690798_1691839_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
VEC10224.1|1691938_1692718_+	galactitol utilization operon repressor	NA	NA	NA	NA	NA
VEC10226.1|1692799_1693699_-	lipid kinase	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
VEC10228.1|1694104_1694422_+	protein	NA	NA	NA	NA	NA
1694580:1694607	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
VEC10230.1|1694686_1695700_-|integrase	phage integrase	integrase	Q83VS6	Escherichia_phage	99.1	1.4e-193
VEC10233.1|1695815_1696115_-	immunity repressor	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
VEC10235.1|1696229_1696505_+	regulatory protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
VEC10237.1|1696515_1696686_+	Uncharacterised protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
VEC10239.1|1696682_1697183_+	Phage protein B	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
VEC10241.1|1697246_1697771_+	Protein of uncharacterised function (DUF2732)	NA	S4TUD1	Salmonella_phage	99.0	4.3e-45
VEC10243.1|1697773_1697998_+	C4-type zinc finger protein, DksA/TraR family	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
VEC10245.1|1697994_1698270_+	relication initiation protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
VEC10247.1|1698259_1700542_+	Replication gene A protein (GpA)	NA	Q858T4	Yersinia_virus	97.8	0.0e+00
VEC10249.1|1700541_1700985_+	RNA-binding protein	NA	Q2P9X4	Enterobacteria_phage	91.1	4.1e-73
VEC10251.1|1701138_1701900_-	Uncharacterised protein	NA	P79670	Escherichia_phage	83.0	2.2e-114
VEC10253.1|1702083_1703844_-	ATP-dependent endonuclease of the OLD family-like protein	NA	NA	NA	NA	NA
VEC10255.1|1704226_1705261_-|capsid	phage capsid protein	capsid	A0A0F7LDI7	Escherichia_phage	99.1	1.3e-199
VEC10257.1|1705260_1707033_-	Terminase, ATPase subunit (GpP)	NA	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
VEC10259.1|1707206_1708061_+|capsid	phage capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
VEC10261.1|1708119_1709193_+|capsid	major capsid protein	capsid	Q778Z0	Enterobacteria_phage	99.7	1.9e-201
VEC10263.1|1709196_1709940_+|terminase	small terminase subunit	terminase	Q94MK1	Enterobacteria_phage	100.0	2.1e-122
VEC10265.1|1710039_1710549_+|capsid	capsid completion protein	capsid	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
VEC10268.1|1710548_1710752_+|tail	phage tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
VEC10272.1|1710755_1711037_+|holin,lysis	phage lysis holin	holin,lysis	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
VEC10274.1|1711036_1711534_+	phage lysin	NA	A0A0F7LBS0	Escherichia_phage	99.4	9.0e-93
VEC10276.1|1711548_1711974_+	LysA protein	NA	A0A0F7LDU9	Escherichia_phage	97.2	1.6e-58
VEC10278.1|1711961_1712387_+	LysB protein	NA	Q7Y4E2	Escherichia_virus	95.7	6.1e-66
VEC10284.1|1712373_1712532_+|lysis	phage lysis protein LysC	lysis	M1RZ27	Escherichia_phage	100.0	2.6e-22
VEC10290.1|1712494_1712962_+|tail	tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	6.7e-82
VEC10295.1|1712954_1713407_+|tail	tail protein	tail	A0A0F7LDR6	Escherichia_phage	97.3	4.5e-75
VEC10300.1|1713478_1714264_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC10304.1|1714347_1714983_+|plate	Baseplate assembly protein V (GpV)	plate	U5N3F0	Enterobacteria_phage	97.2	4.2e-111
VEC10306.1|1714979_1715327_+|plate	phage baseplate protein	plate	A0A0F7L9X3	Escherichia_phage	99.1	5.0e-58
VEC10308.1|1715331_1716240_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.3	9.8e-162
VEC10310.1|1716232_1716763_+|tail	tail protein I (GpI)	tail	U5N0U8	Enterobacteria_phage	99.4	1.5e-101
VEC10312.1|1716773_1718960_+|tail	Phage tail fiber repeat	tail	U5N099	Enterobacteria_phage	72.0	9.1e-222
VEC10314.1|1718963_1719491_+|tail	tail assembly chaperone gp38	tail	U5N0T1	Enterobacteria_phage	92.6	8.3e-89
VEC10316.1|1719880_1720882_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC10318.1|1721211_1722402_+|tail	major tail sheath protein FI	tail	A0A0F7LBW9	Escherichia_phage	99.7	4.8e-225
VEC10320.1|1722414_1722933_+|tail	phage major tail tube protein FII	tail	A0A0F7LDZ1	Escherichia_phage	99.4	3.2e-93
VEC10322.1|1722989_1723265_+|tail	tail protein E (GpE)	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
VEC10324.1|1723409_1725857_+|tail	phage related tail protein	tail	M1T2S3	Escherichia_phage	98.4	0.0e+00
VEC10326.1|1725871_1726351_+	gpU phage protein	NA	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
VEC10328.1|1726350_1727514_+	phage protein D	NA	U5N3V4	Enterobacteria_phage	98.7	3.5e-204
VEC10330.1|1727595_1727814_+	transcriptional activator Ogr/delta	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
VEC10332.1|1728087_1729449_-|protease	putative protease	protease	Q6DW11	Phage_TP	100.0	1.1e-217
1727916:1727943	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
VEC10334.1|1729551_1729848_-	plasmid stabilisation system protein	NA	NA	NA	NA	NA
VEC10336.1|1729849_1730101_-	putative addiction module antidote protein	NA	NA	NA	NA	NA
VEC10338.1|1730354_1730522_-	protein	NA	NA	NA	NA	NA
VEC10340.1|1730499_1730688_-	protein	NA	NA	NA	NA	NA
VEC10342.1|1730878_1731601_-	two-component response regulator	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
VEC10344.1|1731597_1733001_-	two-component sensor kinase	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 6
LR134209	Escherichia coli strain NCTC11476 genome assembly, chromosome: 1	4809759	1834459	1864139	4809759	transposase	Shigella_phage(42.86%)	26	NA	NA
VEC10521.1|1834459_1835137_-|transposase	IS911 transposase orfB	transposase	Q716C2	Shigella_phage	61.0	1.2e-79
VEC10523.1|1836587_1836953_+	IS150 conserved protein InsB	NA	A0A2I6AZV9	Macacine_betaherpesvirus	98.3	1.7e-64
VEC10525.1|1837495_1838098_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC10527.1|1838191_1838398_-	InterPro motifs Prophage CP4-57 regulatory protein (AlpA)	NA	NA	NA	NA	NA
VEC10529.1|1839427_1840105_+|transposase	IS911 transposase orfB	transposase	Q716C2	Shigella_phage	61.0	1.2e-79
VEC10531.1|1840787_1840988_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC10533.1|1841187_1841757_+	malate transporter	NA	NA	NA	NA	NA
VEC10535.1|1842016_1842418_+	ybl85	NA	NA	NA	NA	NA
VEC10537.1|1842405_1842921_+	DNA-directed RNA polymerase, beta subunit/140 kD subunit	NA	NA	NA	NA	NA
VEC10539.1|1843617_1844475_+|transposase	transposase	transposase	NA	NA	NA	NA
VEC10541.1|1845126_1846161_-	phosphotriesterase	NA	NA	NA	NA	NA
VEC10543.1|1846163_1847129_-	Putative inner membrane protein	NA	NA	NA	NA	NA
VEC10545.1|1847185_1847944_-	cytoplasmic protein	NA	NA	NA	NA	NA
VEC10547.1|1847957_1849172_-	carbohydrate kinase	NA	NA	NA	NA	NA
VEC10549.1|1849367_1849484_-|transposase	putative transposase, ISEc23	transposase	A0A0P0ZBS5	Stx2-converting_phage	70.6	6.0e-08
VEC10551.1|1850715_1852116_-	putative aspartate ammonia-lyase	NA	NA	NA	NA	NA
VEC10553.1|1852338_1853637_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
VEC10555.1|1853695_1854415_-	aspartate racemase	NA	NA	NA	NA	NA
VEC10557.1|1854754_1855654_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEC10559.1|1857007_1858300_-	D-galactonate transporter	NA	NA	NA	NA	NA
VEC10561.1|1858419_1859568_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	1.0e-51
VEC10563.1|1859564_1860182_-	2-dehydro-3-deoxy-6-phosphogalactonate aldolase	NA	NA	NA	NA	NA
VEC10565.1|1860165_1861044_-	2-dehydro-3-deoxygalactonokinase	NA	NA	NA	NA	NA
VEC10567.1|1861040_1861730_-	galactonate operon transcriptional repressor	NA	NA	NA	NA	NA
VEC10569.1|1862082_1862415_-|transposase	IS66 transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	57.1	6.3e-18
VEC10571.1|1863461_1864139_+|transposase	IS911 transposase orfB	transposase	Q716C2	Shigella_phage	61.0	1.2e-79
>prophage 7
LR134209	Escherichia coli strain NCTC11476 genome assembly, chromosome: 1	4809759	2305974	2368279	4809759	head,terminase,integrase,tail,protease,lysis,portal	Enterobacteria_phage(43.9%)	64	2313550:2313566	2343808:2343824
VEC11514.1|2305974_2306796_-|protease	putative protease	protease	NA	NA	NA	NA
VEC11516.1|2307071_2307380_-	acid shock protein	NA	NA	NA	NA	NA
VEC11518.1|2307803_2309057_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VEC11520.1|2309163_2310057_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEC11522.1|2310191_2311412_+	protein Mlc (making large colonies protein)	NA	NA	NA	NA	NA
VEC11524.1|2311536_2312232_+	dithiobiotin synthetase	NA	NA	NA	NA	NA
VEC11526.1|2312184_2313441_-	voltage-gated ClC-type chloride channel	NA	NA	NA	NA	NA
2313550:2313566	attL	CTTTAAGAGATAAAAAA	NA	NA	NA	NA
VEC11528.1|2313636_2314251_-	anaerobic dimethyl sulfoxide reductase maturation protein (twin-arginine leader-binding protein)	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
VEC11530.1|2314293_2315148_-	putative dimethyl sulfoxide reductase, anchor subunit	NA	NA	NA	NA	NA
VEC11532.1|2315149_2315767_-	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
VEC11534.1|2315777_2318174_-	putative dimethyl sulfoxide reductase, olydopterin dinucleotide binding subunit	NA	A0A077SK27	Escherichia_phage	48.6	2.8e-208
VEC11536.1|2318261_2320688_-	putative dimethyl sulfoxide reductase, oxidoreductase subunit	NA	A0A077SK27	Escherichia_phage	49.0	2.0e-214
VEC11538.1|2320886_2321192_-	protein	NA	NA	NA	NA	NA
VEC11540.1|2321263_2322010_+	lipoprotein	NA	NA	NA	NA	NA
VEC11542.1|2322012_2322573_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
VEC11544.1|2322607_2322949_-	protein	NA	NA	NA	NA	NA
VEC11546.1|2323083_2323410_+	inner membrane protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
VEC11548.1|2323615_2324830_+	starvation sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
VEC11550.1|2324841_2325861_+	dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.2	7.4e-17
VEC11552.1|2326048_2327329_-|integrase	defective integrase; Qin prophage	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
VEC11554.1|2327363_2327600_-	putative excisionase	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
VEC11556.1|2327687_2330159_-	putative exonuclease from phage origin	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
VEC11558.1|2330252_2330444_-	putative prophage protein	NA	NA	NA	NA	NA
VEC11560.1|2330440_2330629_-	division inhibition protein	NA	NA	NA	NA	NA
VEC11562.1|2331115_2331691_-	putative prophage protein	NA	NA	NA	NA	NA
VEC11564.1|2331692_2331848_-	putative prophage protein	NA	M4QQ57	Salicola_phage	48.9	3.4e-06
VEC11566.1|2332016_2332424_-	transcriptional repressor DicA	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
VEC11568.1|2332504_2332732_+	DNA-binding transcriptional regulator DicC	NA	NA	NA	NA	NA
VEC11570.1|2332715_2333237_+	YdfX	NA	NA	NA	NA	NA
VEC11572.1|2333217_2334183_+	ybl78	NA	U5P0A0	Shigella_phage	61.8	1.2e-56
VEC11574.1|2334223_2334646_+	putative prophage protein	NA	A0A0U2QQN3	Escherichia_phage	91.0	7.7e-61
VEC11576.1|2334963_2336451_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC11578.1|2337095_2337347_+	putative prophage protein	NA	NA	NA	NA	NA
VEC11580.1|2337693_2338743_+	putative prophage protein	NA	A0A291AWV9	Escherichia_phage	58.2	3.0e-114
VEC11582.1|2338760_2339138_+	putative antitermination protein Q-like protein; DLP12 prophage	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
VEC11584.1|2339293_2339818_-	lipoprotein	NA	A0A1W6JNX6	Morganella_phage	52.2	5.1e-46
VEC11586.1|2340010_2340970_+	putative pathogenicity island protein	NA	NA	NA	NA	NA
VEC11588.1|2341376_2342090_+	putative AraC-type regulatory protein encoded in prophage	NA	NA	NA	NA	NA
VEC11590.1|2342280_2342496_+|lysis	lysis protein S from lambdoid prophage	lysis	A5LH82	Enterobacteria_phage	94.4	2.9e-32
VEC11592.1|2342500_2342812_+	Qin prophage protein	NA	K7PGU6	Enterobacteria_phage	62.6	5.0e-25
VEC11594.1|2342808_2343342_+	prophage lysozyme (endolysin)	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
VEC11596.1|2343338_2343836_+	Qin prophage protein	NA	NA	NA	NA	NA
2343808:2343824	attR	CTTTAAGAGATAAAAAA	NA	NA	NA	NA
VEC11598.1|2345086_2345260_+	GnsA/GnsB family transcriptional regulator	NA	NA	NA	NA	NA
VEC11600.1|2345555_2345762_+	DLP12 prophage; predicted protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
VEC11602.1|2346314_2346809_+	prophage protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
VEC11604.1|2346808_2348911_+|terminase	DNA packaging protein of prophage (terminase large subunit)	terminase	K7PH40	Enterobacteria_phage	99.7	0.0e+00
VEC11606.1|2348907_2349120_+	prophage protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
VEC11608.1|2349119_2350628_+|head,tail,portal	portal protein (head-tail preconnector protein) from prophage	head,tail,portal	A5LH29	Enterobacteria_phage	100.0	3.1e-290
VEC11610.1|2350572_2352600_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A5LH30	Enterobacteria_phage	99.2	0.0e+00
VEC11612.1|2352686_2353010_+	prophage protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
VEC11613.1|2353002_2353278_+	prophage protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
VEC11615.1|2353289_2353868_+|tail	Minor tail protein Z (GPZ) of prophage	tail	A5LH33	Enterobacteria_phage	99.5	7.2e-102
VEC11617.1|2353864_2354266_+|tail	Minor tail protein U	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
VEC11619.1|2354277_2355021_+|tail	Major tail protein V	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
VEC11621.1|2355081_2355468_+|tail	minor tail component of prophage	tail	A0A291AWW5	Escherichia_phage	99.2	3.6e-65
VEC11623.1|2355488_2355806_+|tail	minor tail protein T of prophage	tail	A5LH37	Enterobacteria_phage	99.0	1.7e-52
VEC11625.1|2355777_2358843_+|tail	putative tail length tape measure protein from putative prophage	tail	A0A291AWX1	Escherichia_phage	99.4	0.0e+00
VEC11627.1|2358842_2359172_+|tail	Minor tail protein M	tail	A0A291AWW9	Escherichia_phage	100.0	1.7e-60
VEC11629.1|2359181_2359880_+|tail	phage minor tail protein	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
VEC11631.1|2360029_2360629_+|tail	putative tail fiber component K of prophage	tail	K7PLW1	Enterobacteria_phage	97.0	1.0e-119
VEC11633.1|2360625_2361174_+	Tail assembly protein I from prophage	NA	K7PH50	Enterobacteria_phage	100.0	4.7e-95
VEC11635.1|2361234_2364633_+	Host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.4	0.0e+00
VEC11637.1|2364699_2365299_+	outer membrane precursor Lom	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.7e-109
VEC11639.1|2365363_2368279_+|tail	putative tail fiber protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
>prophage 8
LR134209	Escherichia coli strain NCTC11476 genome assembly, chromosome: 1	4809759	2592650	2644745	4809759	coat,tRNA,integrase,terminase,tail,lysis	Escherichia_phage(53.33%)	57	2611537:2611553	2650346:2650362
VEC12016.1|2592650_2596004_-|tail	phage tail domain-containing protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
VEC12018.1|2596068_2596668_-	outer membrane precursor Lom	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.8e-109
VEC12020.1|2596734_2600133_-	Host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.3	0.0e+00
VEC12022.1|2600193_2600736_-|tail	putative phage tail component	tail	A0A291AWV5	Escherichia_phage	81.9	5.4e-75
VEC12024.1|2600732_2601332_-|tail	tail component	tail	C6ZCZ3	Enterobacteria_phage	97.0	5.7e-118
VEC12026.1|2601481_2602180_-|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
VEC12028.1|2602179_2602476_-|tail	putative phage minor tail protein	tail	H6WZM2	Escherichia_phage	52.0	1.8e-24
VEC12030.1|2602510_2605744_-|tail	putative phage tail length tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.5	1.1e-111
VEC12033.1|2606215_2606665_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC12035.1|2606725_2607688_-	Uncharacterised protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
VEC12037.1|2607714_2608107_-	phage protein	NA	NA	NA	NA	NA
VEC12039.1|2608103_2608484_-	Uncharacterised protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
VEC12041.1|2608484_2608868_-	Uncharacterised protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
VEC12043.1|2608867_2609263_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC12045.1|2609266_2609443_-	Uncharacterised protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
VEC12047.1|2609485_2610625_-|coat	P22 coat protein - gene protein 5	coat	G8C7P7	Escherichia_phage	75.0	7.4e-159
VEC12049.1|2610723_2611488_-	Uncharacterised protein	NA	G8C7P6	Escherichia_phage	66.5	3.9e-87
2611537:2611553	attL	GATCGCAGCAATAAAAA	NA	NA	NA	NA
VEC12051.1|2611592_2612708_-	phage protein	NA	I6PD76	Cronobacter_phage	54.4	6.7e-112
VEC12053.1|2612688_2614095_-	Uncharacterised protein	NA	G8C7P4	Escherichia_phage	68.8	6.7e-186
VEC12055.1|2614097_2614970_-|terminase	phage terminase	terminase	A0A2P1MXD8	Escherichia_phage	57.9	2.4e-88
VEC12057.1|2614959_2615397_-|terminase	phage terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	69.3	1.1e-54
VEC12059.1|2615377_2616331_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.2	8.8e-113
VEC12061.1|2616476_2616686_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC12063.1|2616663_2617596_-	Uncharacterised protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.5	4.2e-83
VEC12065.1|2617588_2618383_-	ParB-like nuclease	NA	R4TG31	Halovirus	40.7	7.5e-49
VEC12067.1|2618520_2619945_-	Rac prophage; potassium transporter subunit	NA	NA	NA	NA	NA
VEC12069.1|2620115_2620580_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	89.5	1.6e-67
VEC12071.1|2620576_2621074_-	phage lysozome	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
VEC12073.1|2621073_2621289_-|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
VEC12075.1|2621540_2621936_-	tolA protein (fragment) of prophage	NA	NA	NA	NA	NA
VEC12077.1|2622086_2622515_-	TolA protein (fragment) of prophage	NA	NA	NA	NA	NA
VEC12079.1|2623293_2623491_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC12081.1|2623560_2624103_-	antitermination protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
VEC12083.1|2624099_2624390_-	phage protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
VEC12085.1|2624389_2624989_-	phage protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
VEC12087.1|2625677_2627747_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC12089.1|2628000_2628750_-	transcription regulatory protein	NA	A0A0U2SAW4	Escherichia_phage	85.6	1.1e-110
VEC12091.1|2628772_2629519_-	putative phage DNA replication protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
VEC12093.1|2629525_2630314_-	phage protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
VEC12095.1|2630391_2630814_-	Protein of uncharacterised function (DUF1019)	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
VEC12097.1|2630810_2631065_-	putative phage regultory protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
VEC12099.1|2631144_2631564_+	transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
VEC12101.1|2631996_2632152_+	Rac prophage; predicted protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
VEC12103.1|2632148_2632760_-	prophage CP-933R superinfection exclusion protein	NA	NA	NA	NA	NA
VEC12105.1|2633078_2633300_+	FtsZ inhibitor protein	NA	A0A0U2RTC4	Escherichia_phage	98.6	1.2e-36
VEC12107.1|2633299_2633470_+	Rac prophage; zinc-binding protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
VEC12109.1|2633544_2633820_+	putative bacteriophage protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
VEC12111.1|2633921_2636522_+	exonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	1.1e-247
VEC12113.1|2636514_2637324_+	recombination and repair protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
VEC12115.1|2637567_2637777_+	gydaC	NA	A0A0U2QL97	Escherichia_phage	96.8	8.8e-26
VEC12117.1|2637855_2638071_+	excisionase	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
VEC12119.1|2638072_2639308_+|integrase	phage integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.5	1.6e-239
VEC12121.1|2639359_2640295_+|tRNA	C32 tRNA thiolase	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
VEC12122.1|2640423_2641797_-	ATP-independent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
VEC12123.1|2641826_2642000_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC12124.1|2642274_2643258_-	zinc transport protein	NA	NA	NA	NA	NA
VEC12125.1|2643512_2644745_+	putative signaling protein	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2650346:2650362	attR	TTTTTATTGCTGCGATC	NA	NA	NA	NA
